Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1WDR19Ex10NM_025132.3:c.892A>Gp.Ile298Val | p.I298VNM_025132.3:c.892A>G, XM_005262658.1:c.826A>G, XM_005262659.1:c.412A>GVOUS11/13/2015
2WDR19Ex14NM_025132.3:c.1430G>Ap.Arg477His | p.R477HNM_025132.3:c.1430G>AVOUS10/21/2013
3WDR19Ex17NM_025132.3:c.1845T>Cp.Asn615= | p.N615=NM_025132.3:c.1845T>CVOUS04/27/2014
4WDR19Ex18NM_025132.3:c.2095C>Tp.Arg699Trp | p.R699WNM_025132.3:c.2095C>T, XM_005262658.1:c.2029C>T, XM_005262659.1:c.1615C>TVOUS10/15/2015
5WDR19Ex20NM_025132.3:c.2361C>Tp.Phe787= | p.F787=NM_025132.3:c.2361C>T, XM_005262658.1:c.2295C>T, XM_005262659.1:c.1881C>TLikely benign05/17/2016 
6WDR19Ex21NM_025132.3:c.2364-15_2364-14delTTNM_025132.3:c.2364-15_2364-14delTTVOUS06/13/2014
7WDR19Ex21NM_025132.3:c.2364-3delCNM_025132.3:c.2364-3delC, XM_005262658.1:c.2298-3delC, XM_005262659.1:c.1884-3delCVOUS06/06/2014
8WDR19Ex21NM_025132.3:c.2365G>Ap.Gly789Ser | p.G789SNM_025132.3:c.2365G>A, XM_005262658.1:c.2299G>A, XM_005262659.1:c.1885G>AVOUS03/22/2016
9WDR19Ex24NM_025132.3:c.2671C>Tp.His891Tyr | p.H891YNM_025132.3:c.2671C>T, XM_005262658.1:c.2605C>T, XM_005262659.1:c.2191C>TLikely benign04/08/2016 
10WDR19Ex24NM_025132.3:c.2715G>Ap.Lys905= | p.K905=NM_025132.3:c.2715G>A, XM_005262658.1:c.2649G>A, XM_005262659.1:c.2235G>AVOUS03/22/2016
11WDR19Ex25NM_025132.3:c.2792A>Cp.Tyr931Ser | p.Y931SNM_025132.3:c.2792A>C, XM_005262658.1:c.2726A>C, XM_005262659.1:c.2312A>CVOUS04/03/2014
12WDR19Ex25NM_025132.3:c.2830_2866delATTGTTAGAGAGACCCAGTCTCTGGATGGAGCCAAAAp.Ile944Trpfs*2 | p.I944WfsX2NM_025132.3:c.2830_2866delATTGTTAGAGAGACCCAGTCTCTGGATGGAGCCAAAA, XM_005262658.1:c.2764_2800delATTGTTAGAGAGACCCAGTCTCTGGATGGAGCCAAAA, XM_005262659.1:c.2350_2386delATTGTTAGAGAGACCCAGTCTCTGGATGGAGCCAAAALikely pathogenic02/08/2018 
13WDR19Ex31NM_025132.3:c.3400G>Ap.Ala1134Thr | p.A1134TNM_025132.3:c.3400G>AVOUS05/10/2013
14WDR19Ex32NM_025132.3:c.3533G>Ap.Arg1178Gln | p.R1178QNM_025132.3:c.3533G>A, XM_005262658.1:c.3467G>A, XM_005262659.1:c.3053G>APathogenic04/24/2018 

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.