Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1SPTAN1Ex2NM_001130438.2:c.131A>Gp.Tyr44Cys | p.Y44CNM_001130438.1:c.131A>G, NM_001130438.2:c.131A>G, NM_001195532.1:c.131A>G, NM_003127.2:c.131A>G, NM_003127.3:c.131A>G, XM_005252145.1:c.167A>GVOUS01/22/2015
2SPTAN1Ex4NM_001130438.2:c.497A>Gp.Asn166Ser | p.N166SNM_001130438.1:c.497A>G, NM_001130438.2:c.497A>G, NM_001195532.1:c.497A>G, NM_003127.2:c.497A>G, NM_003127.3:c.497A>G, XM_005252145.1:c.533A>GVOUS01/08/2019
3SPTAN1Ex5NM_001130438.2:c.529C>Tp.Leu177= | p.L177=NM_001130438.1:c.529C>T, NM_001130438.2:c.529C>T, NM_001195532.1:c.529C>T, NM_003127.2:c.529C>T, NM_003127.3:c.529C>T, XM_005252145.1:c.565C>TVOUS07/14/2020
4SPTAN1Ex6NM_001130438.2:c.698_723delTCAATGCAGCCTGGCAGCGGCTGAAGp.Val233Glyfs*20 | p.V233GfsX20NM_001130438.1:c.698_723delTCAATGCAGCCTGGCAGCGGCTGAAG, NM_001130438.2:c.698_723delTCAATGCAGCCTGGCAGCGGCTGAAG, NM_001195532.1:c.698_723delTCAATGCAGCCTGGCAGCGGCTGAAG, NM_003127.2:c.698_723delTCAATGCAGCCTGGCAGCGGCTGAAG, NM_003127.3:c.698_723delTCAATGCAGCCTGGCAGCGGCTGAAG, XM_005252145.1:c.734_759delTCAATGCAGCCTGGCAGCGGCTGAAGVOUS01/31/2017
5SPTAN1Ex6NM_001130438.2:c.725G>Cp.Gly242Ala | p.G242ANM_001130438.1:c.725G>C, NM_001130438.2:c.725G>C, NM_001195532.1:c.725G>C, NM_003127.2:c.725G>C, NM_003127.3:c.725G>C, XM_005252145.1:c.761G>CVOUS04/11/2019
6SPTAN1Ex6NM_001130438.2:c.761C>Ap.Ala254Glu | p.A254ENM_001130438.1:c.761C>A, NM_001130438.2:c.761C>A, NM_001195532.1:c.761C>A, NM_003127.2:c.761C>A, NM_003127.3:c.761C>A, XM_005252145.1:c.797C>AVOUS09/08/2014
7SPTAN1Ex6NM_001130438.2:c.774G>Ap.Gln258= | p.Q258=NM_001130438.1:c.774G>A, NM_001130438.2:c.774G>A, NM_001195532.1:c.774G>A, NM_003127.2:c.774G>A, NM_003127.3:c.774G>A, XM_005252145.1:c.810G>ALikely benign05/07/2014 
8SPTAN1Ex8NM_001130438.2:c.958C>Tp.Arg320Cys | p.R320CNM_001130438.1:c.958C>T, NM_001130438.2:c.958C>T, NM_001195532.1:c.958C>T, NM_003127.2:c.958C>T, NM_003127.3:c.958C>T, XM_005252145.1:c.994C>TVOUS03/06/2015
9SPTAN1Ex8NM_001130438.2:c.959G>Ap.Arg320His | p.R320HNM_001130438.1:c.959G>A, NM_001130438.2:c.959G>A, NM_001195532.1:c.959G>A, NM_003127.2:c.959G>A, NM_003127.3:c.959G>A, XM_005252145.1:c.995G>AVOUS02/02/2017
10SPTAN1Ex10NM_001130438.2:c.1303T>Gp.Ser435Ala | p.S435ANM_001130438.1:c.1303T>G, NM_001130438.2:c.1303T>G, NM_001195532.1:c.1303T>G, NM_003127.2:c.1303T>G, NM_003127.3:c.1303T>G, XM_005252145.1:c.1339T>GLikely benign07/10/2019 
11SPTAN1Ex11NM_001130438.2:c.1330G>Ap.Val444Ile | p.V444INM_001130438.1:c.1330G>A, NM_001130438.2:c.1330G>A, NM_001195532.1:c.1330G>A, NM_003127.2:c.1330G>A, NM_003127.3:c.1330G>A, XM_005252145.1:c.1366G>ABenign11/19/2015 
12SPTAN1Ex11NM_001130438.2:c.1337C>Tp.Ser446Phe | p.S446FNM_001130438.1:c.1337C>T, NM_001130438.2:c.1337C>T, NM_001195532.1:c.1337C>T, NM_003127.2:c.1337C>T, NM_003127.3:c.1337C>T, XM_005252145.1:c.1373C>TVOUS06/06/2014
13SPTAN1Ex12NM_001130438.2:c.1511C>Tp.Ala504Val | p.A504VNM_001130438.1:c.1511C>T, NM_001130438.2:c.1511C>T, NM_001195532.1:c.1511C>T, NM_003127.2:c.1511C>T, NM_003127.3:c.1511C>T, XM_005252145.1:c.1547C>TLikely benign09/09/2014 
14SPTAN1Ex12NM_001130438.2:c.1528G>Ap.Glu510Lys | p.E510KNM_001130438.1:c.1528G>A, NM_001130438.2:c.1528G>A, NM_001195532.1:c.1528G>A, NM_003127.2:c.1528G>A, NM_003127.3:c.1528G>A, XM_005252145.1:c.1564G>AVOUS06/07/2016
15SPTAN1Ex14NM_001130438.2:c.1755C>Gp.Leu585= | p.L585=NM_001130438.1:c.1755C>G, NM_001130438.2:c.1755C>G, NM_001195532.1:c.1755C>G, NM_003127.2:c.1755C>G, NM_003127.3:c.1755C>G, XM_005252145.1:c.1791C>GVOUS05/25/2018
16SPTAN1Ex14NM_001130438.2:c.1806+4A>GNM_001130438.1:c.1806+4A>G, NM_001130438.2:c.1806+4A>G, NM_001195532.1:c.1806+4A>G, NM_003127.2:c.1806+4A>G, NM_003127.3:c.1806+4A>G, XM_005252145.1:c.1842+4A>GVOUS01/09/2017
17SPTAN1Ex15NM_001130438.2:c.1954C>Tp.Arg652Cys | p.R652CNM_001130438.1:c.1954C>T, NM_001130438.2:c.1954C>T, NM_001195532.1:c.1954C>T, NM_003127.2:c.1954C>T, NM_003127.3:c.1954C>T, XM_005252145.1:c.1990C>TVOUS09/06/2018
18SPTAN1Ex15NM_001130438.2:c.2011+10G>ANM_001130438.1:c.2011+10G>A, NM_001130438.2:c.2011+10G>A, NM_001195532.1:c.2011+10G>A, NM_003127.2:c.2011+10G>A, NM_003127.3:c.2011+10G>A, XM_005252145.1:c.2047+10G>AVOUS02/27/2015
19SPTAN1Ex17NM_001130438.2:c.2233C>Ap.Gln745Lys | p.Q745KNM_001130438.1:c.2233C>A, NM_001130438.2:c.2233C>A, NM_001195532.1:c.2233C>A, NM_003127.2:c.2233C>A, NM_003127.3:c.2233C>A, XM_005252145.1:c.2269C>ALikely benign04/14/2017 
20SPTAN1Ex17NM_001130438.2:c.2286C>Tp.Leu762= | p.L762=NM_001130438.1:c.2286C>T, NM_001130438.2:c.2286C>T, NM_001195532.1:c.2286C>T, NM_003127.2:c.2286C>T, NM_003127.3:c.2286C>T, XM_005252145.1:c.2322C>TVOUS07/09/2019
21SPTAN1Ex17NM_001130438.2:c.2343C>Tp.Ala781= | p.A781=NM_001130438.1:c.2343C>T, NM_001130438.2:c.2343C>T, NM_001195532.1:c.2343C>T, NM_003127.2:c.2343C>T, NM_003127.3:c.2343C>T, XM_005252145.1:c.2379C>TLikely benign06/07/2016 
22SPTAN1Ex17NM_001130438.2:c.2344G>Ap.Asp782Asn | p.D782NNM_001130438.1:c.2344G>A, NM_001130438.2:c.2344G>A, NM_001195532.1:c.2344G>A, NM_003127.2:c.2344G>A, NM_003127.3:c.2344G>A, XM_005252145.1:c.2380G>AVOUS02/21/2019
23SPTAN1Ex19NM_001130438.2:c.2610A>Gp.Gln870= | p.Q870=NM_001130438.1:c.2610A>G, NM_001130438.2:c.2610A>G, NM_001195532.1:c.2610A>G, NM_003127.2:c.2610A>G, NM_003127.3:c.2610A>G, XM_005252145.1:c.2646A>GVOUS02/25/2016
24SPTAN1Ex19NM_001130438.2:c.2666C>Gp.Ser889Cys | p.S889CNM_001130438.1:c.2666C>G, NM_001130438.2:c.2666C>G, NM_001195532.1:c.2666C>G, NM_003127.2:c.2666C>G, NM_003127.3:c.2666C>G, XM_005252145.1:c.2702C>GLikely pathogenic01/11/2019 
25SPTAN1Ex19NM_001130438.2:c.2700C>Tp.Asn900= | p.N900=NM_001130438.1:c.2700C>T, NM_001130438.2:c.2700C>T, NM_001195532.1:c.2700C>T, NM_003127.2:c.2700C>T, NM_003127.3:c.2700C>T, XM_005252145.1:c.2736C>TVOUS08/19/2020
26SPTAN1Ex19NM_001130438.2:c.2753A>Gp.Tyr918Cys | p.Y918CNM_001130438.1:c.2753A>G, NM_001130438.2:c.2753A>G, NM_001195532.1:c.2753A>G, NM_003127.2:c.2753A>G, NM_003127.3:c.2753A>G, XM_005252145.1:c.2789A>GVOUS02/16/2021
27SPTAN1Ex20NM_001130438.2:c.2871+8T>CNM_001130438.1:c.2871+8T>C, NM_001130438.2:c.2871+8T>C, NM_001195532.1:c.2871+8T>C, NM_003127.2:c.2871+8T>C, NM_003127.3:c.2871+8T>C, XM_005252145.1:c.2907+8T>CVOUS10/12/2016
28SPTAN1Ex21NM_001130438.2:c.2880G>Ap.Val960= | p.V960=NM_001130438.1:c.2880G>A, NM_001130438.2:c.2880G>A, NM_001195532.1:c.2880G>A, NM_003127.2:c.2880G>A, NM_003127.3:c.2880G>A, XM_005252145.1:c.2916G>ALikely benign01/11/2019 
29SPTAN1Ex21NM_001130438.2:c.2889G>Ap.Thr963= | p.T963=NM_001130438.1:c.2889G>A, NM_001130438.2:c.2889G>A, NM_001195532.1:c.2889G>A, NM_003127.2:c.2889G>A, NM_003127.3:c.2889G>A, XM_005252145.1:c.2925G>AVOUS01/25/2017
30SPTAN1Ex22NM_001130438.2:c.3051G>Ap.Pro1017= | p.P1017=NM_001130438.1:c.3051G>A, NM_001130438.2:c.3051G>A, NM_001195532.1:c.3051G>A, NM_003127.2:c.3051G>A, NM_003127.3:c.3051G>A, XM_005252145.1:c.3087G>ABenign03/13/2015 
31SPTAN1Ex22NM_001130438.2:c.3060C>Tp.Tyr1020= | p.Y1020=NM_001130438.1:c.3060C>T, NM_001130438.2:c.3060C>T, NM_001195532.1:c.3060C>T, NM_003127.2:c.3060C>T, NM_003127.3:c.3060C>T, XM_005252145.1:c.3096C>TVOUS08/08/2016
32SPTAN1Ex22NM_001130438.2:c.3078C>Tp.Pro1026= | p.P1026=NM_001130438.1:c.3078C>T, NM_001130438.2:c.3078C>T, NM_001195532.1:c.3078C>T, NM_003127.2:c.3078C>T, NM_003127.3:c.3078C>T, XM_005252145.1:c.3114C>TVOUS05/23/2016
33SPTAN1Ex22NM_001130438.2:c.3133C>Tp.Arg1045Trp | p.R1045WNM_001130438.1:c.3133C>T, NM_001130438.2:c.3133C>T, NM_001195532.1:c.3133C>T, NM_003127.2:c.3133C>T, NM_003127.3:c.3133C>T, XM_005252145.1:c.3169C>TVOUS01/23/2015
34SPTAN1Ex24NM_001130438.2:c.3414+4T>CNM_001130438.1:c.3414+4T>C, NM_001130438.2:c.3414+4T>C, NM_001195532.1:c.3354+4T>C, NM_003127.2:c.3414+4T>C, NM_003127.3:c.3414+4T>C, XM_005252145.1:c.3450+4T>CVOUS05/20/2015
35SPTAN1Ex25NM_001130438.2:c.3482G>Tp.Gly1161Val | p.G1161VNM_001130438.1:c.3482G>T, NM_001130438.2:c.3482G>T, NM_001195532.1:c.3422G>T, NM_003127.2:c.3482G>T, NM_003127.3:c.3482G>T, XM_005252145.1:c.3518G>TVOUS01/19/2021
36SPTAN1Ex27NM_001130438.2:c.3579+3_3579+4dupAAVOUS09/06/2019
37SPTAN1Ex28NM_001130438.2:c.3580-5_3580-2delCCTANM_001130438.1:c.3580-5_3580-2delCCTA, NM_001130438.2:c.3580-5_3580-2delCCTA, NM_001195532.1:c.3520-5_3520-2delCCTA, NM_003127.2:c.3580-5_3580-2delCCTA, NM_003127.3:c.3580-5_3580-2delCCTA, XM_005252145.1:c.3616-5_3616-2delCCTAVOUS12/23/2019
38SPTAN1Ex30NM_001130438.2:c.3720-7C>TNM_001130438.1:c.3720-7C>T, NM_001130438.2:c.3720-7C>T, NM_001195532.1:c.3660-7C>T, NM_003127.2:c.3720-7C>T, NM_003127.3:c.3720-7C>T, XM_005252145.1:c.3756-7C>TVOUS11/16/2015
39SPTAN1Ex30NM_001130438.2:c.3720-5T>GNM_001130438.1:c.3720-5T>G, NM_001130438.2:c.3720-5T>G, NM_001195532.1:c.3660-5T>G, NM_003127.2:c.3720-5T>G, NM_003127.3:c.3720-5T>GLikely benign08/28/2017 
40SPTAN1Ex31NM_001130438.2:c.3965G>Ap.Ser1322Asn | p.S1322NNM_001130438.1:c.3965G>A, NM_001130438.2:c.3965G>A, NM_001195532.1:c.3905G>A, NM_003127.2:c.3965G>A, NM_003127.3:c.3965G>A, XM_005252145.1:c.4001G>AVOUS01/26/2017
41SPTAN1Ex31NM_001130438.2:c.3974G>Tp.Gly1325Val | p.G1325VNM_001130438.1:c.3974G>T, NM_001130438.2:c.3974G>T, NM_001195532.1:c.3914G>T, NM_003127.2:c.3974G>T, NM_003127.3:c.3974G>T, XM_005252145.1:c.4010G>TVOUS03/31/2016
42SPTAN1Ex32NM_001130438.2:c.4075C>Tp.Arg1359Trp | p.R1359WNM_001130438.1:c.4075C>T, NM_001130438.2:c.4075C>T, NM_001195532.1:c.4015C>T, NM_003127.2:c.4075C>T, NM_003127.3:c.4075C>T, XM_005252145.1:c.4111C>TVOUS03/19/2020
43SPTAN1Ex33NM_001130438.2:c.4283C>Gp.Ala1428Gly | p.A1428GNM_001130438.1:c.4283C>G, NM_001130438.2:c.4283C>G, NM_001195532.1:c.4223C>G, NM_003127.2:c.4283C>G, NM_003127.3:c.4283C>G, XM_005252145.1:c.4319C>GLikely benign04/15/2015 
44SPTAN1Ex35NM_001130438.2:c.4558G>Ap.Gly1520Arg | p.G1520RNM_001130438.1:c.4558G>A, NM_001130438.2:c.4558G>A, NM_001195532.1:c.4498G>A, NM_003127.2:c.4558G>A, NM_003127.3:c.4558G>A, XM_005252145.1:c.4594G>AVOUS01/12/2015
45SPTAN1Ex35NM_001130438.2:c.4580A>Gp.Asn1527Ser | p.N1527SNM_001130438.1:c.4580A>G, NM_001130438.2:c.4580A>G, NM_001195532.1:c.4520A>G, NM_003127.2:c.4580A>G, NM_003127.3:c.4580A>G, XM_005252145.1:c.4616A>GVOUS07/16/2014
46SPTAN1Ex39NM_001130438.2:c.4950A>Gp.Gln1650= | p.Q1650=NM_001130438.1:c.4950A>G, NM_001130438.2:c.4950A>G, NM_001195532.1:c.4875A>G, NM_003127.2:c.4935A>G, NM_003127.3:c.4935A>G, XM_005252145.1:c.4986A>GVOUS12/02/2014
47SPTAN1Ex40NM_001130438.2:c.5106G>Ap.Leu1702= | p.L1702=NM_001130438.1:c.5106G>A, NM_001130438.2:c.5106G>A, NM_001195532.1:c.5031G>A, NM_003127.2:c.5091G>A, NM_003127.3:c.5091G>A, XM_005252145.1:c.5142G>AVOUS01/14/2016
48SPTAN1Ex41NM_001130438.2:c.5245G>Ap.Gly1749Arg | p.G1749RNM_001130438.1:c.5245G>A, NM_001130438.2:c.5245G>A, NM_001195532.1:c.5170G>A, NM_003127.2:c.5230G>A, NM_003127.3:c.5230G>AVOUS08/23/2017
49SPTAN1Ex42NM_001130438.2:c.5358-8_5358-7delTCNM_001130438.1:c.5358-8_5358-7delTC, NM_001130438.2:c.5358-8_5358-7delTC, NM_001195532.1:c.5283-8_5283-7delTC, NM_003127.2:c.5343-8_5343-7delTC, NM_003127.3:c.5343-8_5343-7delTC, XM_005252145.1:c.5394-8_5394-7delTCLikely benign10/26/2015 
50SPTAN1Ex42NM_001130438.2:c.5460G>Ap.Ala1820= | p.A1820=NM_001130438.1:c.5460G>A, NM_001130438.2:c.5460G>A, NM_001195532.1:c.5385G>A, NM_003127.2:c.5445G>A, NM_003127.3:c.5445G>A, XM_005252145.1:c.5496G>ALikely benign03/13/2015 
51SPTAN1Ex43NM_001130438.2:c.5546G>Ap.Arg1849Gln | p.R1849QNM_001130438.1:c.5546G>A, NM_001130438.2:c.5546G>A, NM_001195532.1:c.5471G>A, NM_003127.2:c.5531G>A, NM_003127.3:c.5531G>A, XM_005252145.1:c.5582G>AVOUS05/28/2019
52SPTAN1Ex45NM_001130438.2:c.5775C>Tp.Thr1925= | p.T1925=NM_001130438.1:c.5775C>T, NM_001130438.2:c.5775C>T, NM_001195532.1:c.5700C>T, NM_003127.2:c.5760C>T, NM_003127.3:c.5760C>T, XM_005252145.1:c.5811C>TLikely benign07/01/2016 
53SPTAN1Ex46NM_001130438.2:c.5907T>Cp.Ala1969= | p.A1969=NM_001130438.1:c.5907T>C, NM_001130438.2:c.5907T>C, NM_001195532.1:c.5832T>C, NM_003127.2:c.5892T>C, NM_003127.3:c.5892T>C, XM_005252145.1:c.5943T>CVOUS02/02/2017
54SPTAN1Ex47NM_001130438.2:c.5993-9G>AVOUS07/10/2019
55SPTAN1Ex48NM_001130438.2:c.6111C>Tp.Gly2037= | p.G2037=NM_001130438.1:c.6111C>T, NM_001130438.2:c.6111C>T, NM_001195532.1:c.6036C>T, NM_003127.2:c.6096C>T, NM_003127.3:c.6096C>T, XM_005252145.1:c.6147C>TLikely benign09/18/2018 
56SPTAN1Ex48NM_001130438.2:c.6160G>Ap.Val2054Ile | p.V2054INM_001130438.1:c.6160G>A, NM_001130438.2:c.6160G>A, NM_001195532.1:c.6085G>A, NM_003127.2:c.6145G>A, NM_003127.3:c.6145G>A, XM_005252145.1:c.6196G>AVOUS07/09/2019
57SPTAN1Ex48NM_001130438.2:c.6234C>Tp.Ala2078= | p.A2078=NM_001130438.1:c.6234C>T, NM_001130438.2:c.6234C>T, NM_001195532.1:c.6159C>T, NM_003127.2:c.6219C>T, NM_003127.3:c.6219C>T, XM_005252145.1:c.6270C>TBenign05/05/2015 
58SPTAN1Ex48NM_001130438.2:c.6247A>Cp.Lys2083Gln | p.K2083QNM_001130438.1:c.6247A>C, NM_001130438.2:c.6247A>C, NM_001195532.1:c.6172A>C, NM_003127.2:c.6232A>C, NM_003127.3:c.6232A>C, XM_005252145.1:c.6283A>CVOUS09/12/2019
59SPTAN1Ex48NM_001130438.2:c.6275G>Ap.Arg2092His | p.R2092HNM_001130438.1:c.6275G>A, NM_001130438.2:c.6275G>A, NM_001195532.1:c.6200G>A, NM_003127.2:c.6260G>A, NM_003127.3:c.6260G>A, XM_005252145.1:c.6311G>AVOUS08/23/2018
60SPTAN1Ex49NM_001130438.2:c.6303C>Tp.Phe2101= | p.F2101=NM_001130438.1:c.6303C>T, NM_001130438.2:c.6303C>T, NM_001195532.1:c.6228C>T, NM_003127.2:c.6288C>T, NM_003127.3:c.6288C>T, XM_005252145.1:c.6339C>TVOUS11/20/2018
61SPTAN1Ex49NM_001130438.2:c.6498C>Ap.Arg2166= | p.R2166=NM_001130438.1:c.6498C>A, NM_001130438.2:c.6498C>A, NM_001195532.1:c.6423C>A, NM_003127.2:c.6483C>A, NM_003127.3:c.6483C>A, XM_005252145.1:c.6534C>ALikely benign03/29/2018 
62SPTAN1Ex49NM_001130438.2:c.6498C>Tp.Arg2166= | p.R2166=NM_001130438.1:c.6498C>T, NM_001130438.2:c.6498C>T, NM_001195532.1:c.6423C>T, NM_003127.2:c.6483C>T, NM_003127.3:c.6483C>T, XM_005252145.1:c.6534C>TVOUS07/12/2016
63SPTAN1Ex49NM_001130438.2:c.6499G>Ap.Val2167Ile | p.V2167INM_001130438.1:c.6499G>A, NM_001130438.2:c.6499G>A, NM_001195532.1:c.6424G>A, NM_003127.2:c.6484G>A, NM_003127.3:c.6484G>A, XM_005252145.1:c.6535G>AVOUS12/27/2018
64SPTAN1Ex50NM_001130438.2:c.6608G>Ap.Arg2203Gln | p.R2203QNM_001130438.1:c.6608G>A, NM_001130438.2:c.6608G>A, NM_001195532.1:c.6533G>A, NM_003127.2:c.6593G>A, NM_003127.3:c.6593G>A, XM_005252145.1:c.6644G>AVOUS07/02/2019
65SPTAN1Ex50NM_001130438.2:c.6652C>Tp.His2218Tyr | p.H2218YNM_001130438.1:c.6652C>T, NM_001130438.2:c.6652C>T, NM_001195532.1:c.6577C>T, NM_003127.2:c.6637C>T, NM_003127.3:c.6637C>T, XM_005252145.1:c.6688C>TVOUS04/08/2016
66SPTAN1Ex50NM_001130438.2:c.6689+7G>TNM_001130438.1:c.6689+7G>T, NM_001130438.2:c.6689+7G>T, NM_001195532.1:c.6614+7G>T, NM_003127.2:c.6674+7G>T, NM_003127.3:c.6674+7G>T, XM_005252145.1:c.6725+7G>TVOUS02/12/2019
67SPTAN1Ex53NM_001130438.2:c.6763C>Tp.Arg2255Cys | p.R2255CNM_001130438.1:c.6763C>T, NM_001130438.2:c.6763C>T, NM_001195532.1:c.6688C>T, NM_003127.2:c.6748C>T, NM_003127.3:c.6748C>T, NM_052844.3:c.*1617G>A, XM_005252145.1:c.6799C>TLikely benign06/19/2017 
68SPTAN1Ex53NM_001130438.2:c.6876C>Tp.Thr2292= | p.T2292=NM_001130438.1:c.6876C>T, NM_001130438.2:c.6876C>T, NM_001195532.1:c.6801C>T, NM_003127.2:c.6861C>T, NM_003127.3:c.6861C>T, NM_052844.3:c.*1504G>A, XM_005252145.1:c.6912C>TVOUS08/27/2020
69SPTAN1Ex53NM_001130438.2:c.6908_6916dupACCAGCTGGp.Asp2303_Leu2305dup | p.D2303_L2305dupNM_001130438.1:c.6908_6916dupACCAGCTGG, NM_001130438.2:c.6908_6916dupACCAGCTGG, NM_001195532.1:c.6833_6841dupACCAGCTGG, NM_003127.2:c.6893_6901dupACCAGCTGG, NM_003127.3:c.6893_6901dupACCAGCTGG, NM_052844.3:c.*1464_*1472dupCCAGCTGGT, XM_005252145.1:c.6944_6952dupACCAGCTGGPathogenic08/30/2018 
70SPTAN1Ex54NM_001130438.2:c.6960-8T>CNM_001130438.1:c.6960-8T>C, NM_001130438.2:c.6960-8T>C, NM_001195532.1:c.6885-8T>C, NM_003127.2:c.6945-8T>C, NM_003127.3:c.6945-8T>C, NM_052844.3:c.*1321A>G, XM_005252145.1:c.6996-8T>CBenign09/28/2015 
71SPTAN1Ex54NM_001130438.2:c.7013+7T>CNM_001130438.1:c.7013+7T>C, NM_001130438.2:c.7013+7T>C, NM_001195532.1:c.6938+7T>C, NM_003127.2:c.6998+7T>C, NM_003127.3:c.6998+7T>C, NM_052844.3:c.*1253A>G, XM_005252145.1:c.7049+7T>CVOUS11/03/2016
72SPTAN1Ex55NM_001130438.2:c.7074C>Tp.Arg2358= | p.R2358=NM_001130438.1:c.7074C>T, NM_001130438.2:c.7074C>T, NM_001195532.1:c.6999C>T, NM_003127.2:c.7059C>T, NM_003127.3:c.7059C>T, NM_052844.3:c.*1112G>A, XM_005252145.1:c.7110C>TVOUS02/07/2019
73SPTAN1Ex55NM_001130438.2:c.7145C>Tp.Thr2382Met | p.T2382MNM_001130438.1:c.7145C>T, NM_001130438.2:c.7145C>T, NM_001195532.1:c.7070C>T, NM_003127.2:c.7130C>T, NM_003127.3:c.7130C>T, NM_052844.3:c.*1041G>A, XM_005252145.1:c.7181C>TVOUS09/20/2019
74SPTAN1Ex55NM_001130438.2:c.7146G>Ap.Thr2382= | p.T2382=NM_001130438.1:c.7146G>A, NM_001130438.2:c.7146G>A, NM_001195532.1:c.7071G>A, NM_003127.2:c.7131G>A, NM_003127.3:c.7131G>A, NM_052844.3:c.*1040C>T, XM_005252145.1:c.7182G>ALikely benign07/14/2020 
75SPTAN1Ex55NM_001130438.2:c.7155G>Ap.Pro2385= | p.P2385=NM_001130438.1:c.7155G>A, NM_001130438.2:c.7155G>A, NM_001195532.1:c.7080G>A, NM_003127.2:c.7140G>A, NM_003127.3:c.7140G>A, NM_052844.3:c.*1031C>T, XM_005252145.1:c.7191G>ALikely benign08/29/2019 
76SPTAN1Ex56NM_001130438.2:c.7161-9C>TNM_001130438.1:c.7161-9C>T, NM_001130438.2:c.7161-9C>T, NM_001195532.1:c.7086-9C>T, NM_003127.2:c.7146-9C>T, NM_003127.3:c.7146-9C>T, NM_052844.3:c.*945G>A, XM_005252145.1:c.7197-9C>TLikely benign08/29/2019 
77SPTAN1Ex56NM_001130438.2:c.7161-8G>ANM_001130438.1:c.7161-8G>A, NM_001130438.2:c.7161-8G>A, NM_001195532.1:c.7086-8G>A, NM_003127.2:c.7146-8G>A, NM_003127.3:c.7146-8G>A, NM_052844.3:c.*944C>T, XM_005252145.1:c.7197-8G>AVOUS06/26/2017
78SPTAN1Ex56NM_001130438.2:c.7233C>Tp.Ser2411= | p.S2411=NM_001130438.1:c.7233C>T, NM_001130438.2:c.7233C>T, NM_001195532.1:c.7158C>T, NM_003127.2:c.7218C>T, NM_003127.3:c.7218C>T, NM_052844.3:c.*864G>A, XM_005252145.1:c.7269C>TVOUS04/21/2015
79SPTAN1Ex56NM_001130438.2:c.7308+3A>TVOUS05/21/2020
80SPTAN1Ex57NM_001130438.2:c.7360G>Ap.Val2454Met | p.V2454MNM_001130438.1:c.7360G>A, NM_001130438.2:c.7360G>A, NM_001195532.1:c.7285G>A, NM_003127.2:c.7345G>A, NM_003127.3:c.7345G>A, NM_052844.3:c.*484C>T, XM_005252145.1:c.7396G>ALikely benign05/30/2019 
81SPTAN1Ex57NM_001130438.2:c.7365C>Tp.Asp2455= | p.D2455=NM_001130438.1:c.7365C>T, NM_001130438.2:c.7365C>T, NM_001195532.1:c.7290C>T, NM_003127.2:c.7350C>T, NM_003127.3:c.7350C>T, NM_052844.3:c.*479G>A, XM_005252145.1:c.7401C>TVOUS02/05/2021
82SPTAN1Ex57NM_001130438.2:c.7391C>Tp.Ala2464Val | p.A2464VNM_001130438.1:c.7391C>T, NM_001130438.2:c.7391C>T, NM_001195532.1:c.7316C>T, NM_003127.2:c.7376C>T, NM_003127.3:c.7376C>T, NM_052844.3:c.*453G>A, XM_005252145.1:c.7427C>TVOUS07/07/2020
83SPTAN1Ex57NM_001130438.2:c.7392G>Ap.Ala2464= | p.A2464=NM_001130438.1:c.7392G>A, NM_001130438.2:c.7392G>A, NM_001195532.1:c.7317G>A, NM_003127.2:c.7377G>A, NM_003127.3:c.7377G>A, NM_052844.3:c.*452C>T, XM_005252145.1:c.7428G>ALikely benign04/02/2015 
84SPTAN1Ex57NM_001130438.2:c.7395C>Tp.Phe2465= | p.F2465=NM_001130438.1:c.7395C>T, NM_001130438.2:c.7395C>T, NM_001195532.1:c.7320C>T, NM_003127.2:c.7380C>T, NM_003127.3:c.7380C>T, NM_052844.3:c.*449G>A, XM_005252145.1:c.7431C>TVOUS10/13/2016

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.