Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1RYR1Ex2NM_000540.2:c.94C>Tp.Leu32Phe | p.L32FLRG_766t1:c.94C>T, NM_000540.2:c.94C>T, NM_001042723.1:c.94C>TVOUS01/23/2015
2RYR1Ex2NM_000540.2:c.130C>Tp.Arg44Cys | p.R44CLRG_766t1:c.130C>T, NM_000540.2:c.130C>T, NM_001042723.1:c.130C>TVOUS02/08/2017
3RYR1Ex2NM_000540.2:c.152C>Ap.Thr51Asn | p.T51NNM_000540.2:c.152C>A, NM_001042723.1:c.152C>AVOUS04/30/2014
4RYR1Ex2NM_000540.2:c.161C>Tp.Ala54Val | p.A54VLRG_766t1:c.161C>T, NM_000540.2:c.161C>T, NM_001042723.1:c.161C>TVOUS07/11/2018
5RYR1Ex3NM_000540.2:c.216G>Tp.Leu72= | p.L72=LRG_766t1:c.216G>T, NM_000540.2:c.216G>T, NM_001042723.1:c.216G>TBenign09/22/2016 
6RYR1Ex4NM_000540.2:c.271-7C>GLRG_766t1:c.271-7C>G, NM_000540.2:c.271-7C>G, NM_001042723.1:c.271-7C>GVOUS05/16/2018
7RYR1Ex4NM_000540.2:c.297G>Ap.Thr99= | p.T99=LRG_766t1:c.297G>A, NM_000540.2:c.297G>A, NM_001042723.1:c.297G>ALikely benign11/10/2017 
8RYR1Ex6NM_000540.2:c.443C>Tp.Thr148Ile | p.T148ILRG_766t1:c.443C>T, NM_000540.2:c.443C>T, NM_001042723.1:c.443C>TVOUS01/09/2017
9RYR1Ex6NM_000540.2:c.514_519delAGTGTCp.Val173_Ser174del | p.V173_S174delLRG_766t1:c.514_519delAGTGTC, NM_000540.2:c.514_519delAGTGTC, NM_001042723.1:c.514_519delAGTGTCVOUS01/14/2020
10RYR1Ex6NM_000540.2:c.526G>Ap.Glu176Lys | p.E176KNM_000540.2:c.526G>A, NM_001042723.1:c.526G>AVOUS11/17/2014
11RYR1Ex7NM_000540.2:c.573C>Tp.Asp191= | p.D191=LRG_766t1:c.573C>T, NM_000540.2:c.573C>T, NM_001042723.1:c.573C>TBenign03/21/2014 
12RYR1Ex7NM_000540.2:c.594A>Gp.Leu198= | p.L198=LRG_766t1:c.594A>G, NM_000540.2:c.594A>G, NM_001042723.1:c.594A>GBenign06/06/2014 
13RYR1Ex7NM_000540.2:c.624C>Tp.Cys208= | p.C208=LRG_766t1:c.624C>T, NM_000540.2:c.624C>T, NM_001042723.1:c.624C>TVOUS03/06/2015
14RYR1Ex8NM_000540.2:c.641C>Tp.Thr214Met | p.T214MLRG_766t1:c.641C>T, NM_000540.2:c.641C>T, NM_001042723.1:c.641C>TVOUS01/13/2014
15RYR1Ex10NM_000540.2:c.845G>Ap.Arg282Gln | p.R282QLRG_766t1:c.845G>A, NM_000540.2:c.845G>A, NM_001042723.1:c.845G>AVOUS09/23/2019
16RYR1Ex10NM_000540.2:c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCANM_000540.2:c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCA, NM_001042723.1:c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCAVOUS12/08/2014
17RYR1Ex11NM_000540.2:c.1021G>Ap.Gly341Arg | p.G341RLRG_766t1:c.1021G>A, NM_000540.2:c.1021G>A, NM_001042723.1:c.1021G>ALikely pathogenic09/05/2014 
18RYR1Ex11NM_000540.2:c.1077T>Cp.Ala359= | p.A359=LRG_766t1:c.1077T>C, NM_000540.2:c.1077T>C, NM_001042723.1:c.1077T>CBenign04/04/2016 
19RYR1Ex11NM_000540.2:c.1087C>Tp.Pro363Ser | p.P363SLRG_766t1:c.1087C>T, NM_000540.2:c.1087C>T, NM_001042723.1:c.1087C>TVOUS01/06/2014
20RYR1Ex12NM_000540.2:c.1172G>Ap.Arg391His | p.R391HLRG_766t1:c.1172G>A, NM_000540.2:c.1172G>A, NM_001042723.1:c.1172G>AVOUS12/19/2014
21RYR1Ex12NM_000540.2:c.1220A>Gp.Asn407Ser | p.N407SLRG_766t1:c.1220A>G, NM_000540.2:c.1220A>G, NM_001042723.1:c.1220A>GVOUS07/14/2019
22RYR1Ex14NM_000540.2:c.1453A>Gp.Met485Val | p.M485VNM_000540.2:c.1453A>G, NM_001042723.1:c.1453A>GVOUS11/18/2015
23RYR1Ex14NM_000540.2:c.1532C>Ap.Ala511Asp | p.A511DNM_000540.2:c.1532C>A, NM_001042723.1:c.1532C>AVOUS10/01/2015
24RYR1Ex15NM_000540.2:c.1598G>Ap.Arg533His | p.R533HLRG_766t1:c.1598G>A, NM_000540.2:c.1598G>A, NM_001042723.1:c.1598G>AVOUS07/16/2019
25RYR1Ex15NM_000540.2:c.1668G>Ap.Ser556= | p.S556=LRG_766t1:c.1668G>A, NM_000540.2:c.1668G>A, NM_001042723.1:c.1668G>ABenign06/06/2014 
26RYR1Ex17NM_000540.2:c.1810T>Cp.Ser604Pro | p.S604PLRG_766t1:c.1810T>C, NM_000540.2:c.1810T>C, NM_001042723.1:c.1810T>CVOUS10/06/2017
27RYR1Ex17NM_000540.2:c.1841G>Tp.Arg614Leu | p.R614LNM_000540.2:c.1841G>T, NM_001042723.1:c.1841G>TPathogenic12/18/2013 
28RYR1Ex18NM_000540.2:c.1931G>Ap.Arg644His | p.R644HLRG_766t1:c.1931G>A, NM_000540.2:c.1931G>A, NM_001042723.1:c.1931G>AVOUS07/11/2014
29RYR1Ex18NM_000540.2:c.2037C>Ap.Thr679= | p.T679=LRG_766t1:c.2037C>A, NM_000540.2:c.2037C>A, NM_001042723.1:c.2037C>AVOUS08/11/2016
30RYR1Ex18NM_000540.2:c.2058C>Gp.Ala686= | p.A686=LRG_766t1:c.2058C>G, NM_000540.2:c.2058C>G, NM_001042723.1:c.2058C>GVOUS02/22/2019
31RYR1Ex18NM_000540.2:c.2091C>Tp.Ala697= | p.A697=LRG_766t1:c.2091C>T, NM_000540.2:c.2091C>T, NM_001042723.1:c.2091C>TVOUS11/01/2017
32RYR1Ex18NM_000540.2:c.2121C>Ap.Gly707= | p.G707=NM_000540.2:c.2121C>A, NM_001042723.1:c.2121C>AVOUS06/03/2015
33RYR1Ex18NM_000540.2:c.2122G>Ap.Asp708Asn | p.D708NLRG_766t1:c.2122G>A, NM_000540.2:c.2122G>A, NM_001042723.1:c.2122G>ALikely benign07/17/2018 
34RYR1Ex18NM_000540.2:c.2160C>Gp.Leu720= | p.L720=NM_000540.2:c.2160C>G, NM_001042723.1:c.2160C>GVOUS10/02/2015
35RYR1Ex19NM_000540.2:c.2275A>Gp.Asn759Asp | p.N759DNM_000540.2:c.2275A>G, NM_001042723.1:c.2275A>GVOUS01/06/2014
36RYR1Ex19NM_000540.2:c.2286C>Tp.Pro762= | p.P762=LRG_766t1:c.2286C>T, NM_000540.2:c.2286C>T, NM_001042723.1:c.2286C>TBenign06/06/2014 
37RYR1Ex19NM_000540.2:c.2319C>Tp.Asp773= | p.D773=NM_000540.2:c.2319C>T, NM_001042723.1:c.2319C>TVOUS02/18/2015
38RYR1Ex20NM_000540.2:c.2415T>Cp.Pro805= | p.P805=LRG_766t1:c.2415T>C, NM_000540.2:c.2415T>C, NM_001042723.1:c.2415T>CLikely benign03/30/2017 
39RYR1Ex20NM_000540.2:c.2505delGp.Pro836Leufs*48 | p.P836LfsX48LRG_766t1:c.2505delG, NM_000540.2:c.2505delG, NM_001042723.1:c.2505delGPathogenic08/24/2015 
40RYR1Ex20NM_000540.2:c.2528G>Tp.Arg843Leu | p.R843LLRG_766t1:c.2528G>T, NM_000540.2:c.2528G>T, NM_001042723.1:c.2528G>TVOUS05/17/2019
41RYR1Ex21NM_000540.2:c.2603G>Ap.Arg868His | p.R868HLRG_766t1:c.2603G>A, NM_000540.2:c.2603G>A, NM_001042723.1:c.2603G>AVOUS08/22/2019
42RYR1Ex21NM_000540.2:c.2622G>Ap.Ala874= | p.A874=LRG_766t1:c.2622G>A, NM_000540.2:c.2622G>A, NM_001042723.1:c.2622G>ALikely benign01/25/2017 
43RYR1Ex21NM_000540.2:c.2635G>Ap.Glu879Lys | p.E879KNM_000540.2:c.2635G>A, NM_001042723.1:c.2635G>AVOUS08/25/2015
44RYR1Ex21NM_000540.2:c.2677G>Ap.Gly893Ser | p.G893SLRG_766t1:c.2677G>A, NM_000540.2:c.2677G>A, NM_001042723.1:c.2677G>ALikely benign09/27/2017 
45RYR1Ex21NM_000540.2:c.2682+7G>ALRG_766t1:c.2682+7G>A, NM_000540.2:c.2682+7G>A, NM_001042723.1:c.2682+7G>ALikely benign01/06/2017 
46RYR1Ex22NM_000540.2:c.2687G>Ap.Arg896Gln | p.R896QLRG_766t1:c.2687G>A, NM_000540.2:c.2687G>A, NM_001042723.1:c.2687G>AVOUS05/29/2018
47RYR1Ex24NM_000540.2:c.2871-5C>TNM_000540.2:c.2871-5C>T, NM_001042723.1:c.2871-5C>TBenign11/12/2013 
48RYR1Ex24NM_000540.2:c.2919C>Tp.His973= | p.H973=LRG_766t1:c.2919C>T, NM_000540.2:c.2919C>T, NM_001042723.1:c.2919C>TLikely benign03/30/2017 
49RYR1Ex24NM_000540.2:c.2943G>Ap.Thr981= | p.T981=LRG_766t1:c.2943G>A, NM_000540.2:c.2943G>A, NM_001042723.1:c.2943G>ABenign07/14/2014 
50RYR1Ex24NM_000540.2:c.2979C>Tp.Asn993= | p.N993=NM_000540.2:c.2979C>T, NM_001042723.1:c.2979C>TBenign04/22/2014 
51RYR1Ex24NM_000540.2:c.2996G>Ap.Arg999His | p.R999HLRG_766t1:c.2996G>A, NM_000540.2:c.2996G>A, NM_001042723.1:c.2996G>AVOUS09/15/2016
52RYR1Ex24NM_000540.2:c.3042G>Ap.Ala1014= | p.A1014=NM_000540.2:c.3042G>A, NM_001042723.1:c.3042G>ABenign07/10/2014 
53RYR1Ex24NM_000540.2:c.3047G>Ap.Arg1016Gln | p.R1016QLRG_766t1:c.3047G>A, NM_000540.2:c.3047G>A, NM_001042723.1:c.3047G>AVOUS05/18/2016
54RYR1Ex24NM_000540.2:c.3108C>Ap.Asp1036Glu | p.D1036ENM_000540.2:c.3108C>A, NM_001042723.1:c.3108C>AVOUS10/20/2015
55RYR1Ex24NM_000540.2:c.3111C>Tp.Ser1037= | p.S1037=LRG_766t1:c.3111C>T, NM_000540.2:c.3111C>T, NM_001042723.1:c.3111C>TVOUS05/20/2016
56RYR1Ex24NM_000540.2:c.3127C>Tp.Arg1043Cys | p.R1043CLRG_766t1:c.3127C>T, NM_000540.2:c.3127C>T, NM_001042723.1:c.3127C>TVOUS07/11/2014
57RYR1Ex24NM_000540.2:c.3175C>Tp.Pro1059Ser | p.P1059SNM_000540.2:c.3175C>T, NM_001042723.1:c.3175C>TVOUS10/01/2015
58RYR1Ex25NM_000540.2:c.3208C>Tp.Arg1070Trp | p.R1070WLRG_766t1:c.3208C>T, NM_000540.2:c.3208C>T, NM_001042723.1:c.3208C>TVOUS02/09/2017
59RYR1Ex25NM_000540.2:c.3381C>Tp.Arg1127= | p.R1127=NM_000540.2:c.3381C>T, NM_001042723.1:c.3381C>TVOUS01/08/2016
60RYR1Ex26NM_000540.2:c.3456C>Tp.Ile1152= | p.I1152=NM_000540.2:c.3456C>T, NM_001042723.1:c.3456C>TBenign04/22/2014 
61RYR1Ex27NM_000540.2:c.3557-7C>ALRG_766t1:c.3557-7C>A, NM_000540.2:c.3557-7C>A, NM_001042723.1:c.3557-7C>AVOUS06/22/2016
62RYR1Ex28NM_000540.2:c.3858T>Cp.Leu1286= | p.L1286=LRG_766t1:c.3858T>C, NM_000540.2:c.3858T>C, NM_001042723.1:c.3858T>CBenign05/05/2013 
63RYR1Ex28NM_000540.2:c.3972G>Ap.Ala1324= | p.A1324=LRG_766t1:c.3972G>A, NM_000540.2:c.3972G>A, NM_001042723.1:c.3972G>ABenign03/01/2016 
64RYR1Ex28NM_000540.2:c.3982_3986delGACCCp.Asp1328* | p.D1328XLRG_766t1:c.3982_3986delGACCC, NM_000540.2:c.3982_3986delGACCC, NM_001042723.1:c.3982_3986delGACCCPathogenic01/04/2017 
65RYR1Ex28NM_000540.2:c.4024A>Gp.Ser1342Gly | p.S1342GLRG_766t1:c.4024A>G, NM_000540.2:c.4024A>G, NM_001042723.1:c.4024A>GBenign01/06/2017 
66RYR1Ex28NM_000540.2:c.4038C>Ap.Asn1346Lys | p.N1346KLRG_766t1:c.4038C>A, NM_000540.2:c.4038C>A, NM_001042723.1:c.4038C>AVOUS08/24/2016
67RYR1Ex28NM_000540.2:c.4071C>Tp.Pro1357= | p.P1357=LRG_766t1:c.4071C>T, NM_000540.2:c.4071C>T, NM_001042723.1:c.4071C>TBenign12/22/2016 
68RYR1Ex28NM_000540.2:c.4076delGLRG_766t1:c.4076delG, NM_000540.2:c.4076delG, NM_001042723.1:c.4076delGPathogenic09/05/2014 
69RYR1Ex28NM_000540.2:c.4107C>Tp.Pro1369= | p.P1369=NM_000540.2:c.4107C>T, NM_001042723.1:c.4107C>TBenign03/25/2013 
70RYR1Ex28NM_000540.2:c.4113G>Cp.Arg1371Ser | p.R1371SNM_000540.2:c.4113G>C, NM_001042723.1:c.4113G>CVOUS10/17/2014
71RYR1Ex29NM_000540.2:c.4161-6T>CNM_000540.2:c.4161-6T>C, NM_001042723.1:c.4161-6T>CBenign03/25/2013 
72RYR1Ex29NM_000540.2:c.4178A>Gp.Lys1393Arg | p.K1393RLRG_766t1:c.4178A>G, NM_000540.2:c.4178A>G, NM_001042723.1:c.4178A>GVOUS06/03/2015
73RYR1Ex29NM_000540.2:c.4230C>Tp.Leu1410= | p.L1410=NM_000540.2:c.4230C>T, NM_001042723.1:c.4230C>TVOUS12/16/2015
74RYR1Ex29NM_000540.2:c.4293G>Ap.Thr1431= | p.T1431=NM_000540.2:c.4293G>A, NM_001042723.1:c.4293G>AVOUS02/05/2014
75RYR1Ex30NM_000540.2:c.4443C>Tp.Asn1481= | p.N1481=NM_000540.2:c.4443C>T, NM_001042723.1:c.4443C>TBenign03/12/2013 
76RYR1Ex33NM_000540.2:c.4711A>Gp.Ile1571Val | p.I1571VLRG_766t1:c.4711A>G, NM_000540.2:c.4711A>G, NM_001042723.1:c.4711A>GVOUS02/15/2018
77RYR1Ex33NM_000540.2:c.4719G>Ap.Pro1573= | p.P1573=NM_000540.2:c.4719G>A, NM_001042723.1:c.4719G>ABenign04/30/2014 
78RYR1Ex33NM_000540.2:c.4878C>Tp.Ala1626= | p.A1626=NM_000540.2:c.4878C>T, NM_001042723.1:c.4878C>TVOUS01/16/2014
79RYR1Ex34NM_000540.2:c.4980C>Tp.Arg1660= | p.R1660=LRG_766t1:c.4980C>T, NM_000540.2:c.4980C>T, NM_001042723.1:c.4980C>TVOUS08/31/2016
80RYR1Ex34NM_000540.2:c.4999C>Tp.Arg1667Cys | p.R1667CLRG_766t1:c.4999C>T, NM_000540.2:c.4999C>T, NM_001042723.1:c.4999C>TLikely benign07/17/2015 
81RYR1Ex34NM_000540.2:c.5009G>Ap.Arg1670His | p.R1670HLRG_766t1:c.5009G>A, NM_000540.2:c.5009G>A, NM_001042723.1:c.5009G>AVOUS02/08/2017
82RYR1Ex34NM_000540.2:c.5020G>Ap.Ala1674Thr | p.A1674TLRG_766t1:c.5020G>A, NM_000540.2:c.5020G>A, NM_001042723.1:c.5020G>AVOUS10/13/2017
83RYR1Ex34NM_000540.2:c.5036G>Ap.Arg1679His | p.R1679HNM_000540.2:c.5036G>A, NM_001042723.1:c.5036G>AVOUS06/24/2015
84RYR1Ex34NM_000540.2:c.5112C>Tp.Gly1704= | p.G1704=NM_000540.2:c.5112C>T, NM_001042723.1:c.5112C>TBenign03/25/2013 
85RYR1Ex34NM_000540.2:c.5120G>Ap.Arg1707His | p.R1707HLRG_766t1:c.5120G>A, NM_000540.2:c.5120G>A, NM_001042723.1:c.5120G>AVOUS09/02/2016
86RYR1Ex34NM_000540.2:c.5183C>Tp.Ser1728Phe | p.S1728FLRG_766t1:c.5183C>T, NM_000540.2:c.5183C>T, NM_001042723.1:c.5183C>TVOUS07/08/2019
87RYR1Ex34NM_000540.2:c.5235G>Ap.Thr1745= | p.T1745=LRG_766t1:c.5235G>A, NM_000540.2:c.5235G>A, NM_001042723.1:c.5235G>AVOUS02/09/2017
88RYR1Ex34NM_000540.2:c.5309C>Tp.Ser1770Leu | p.S1770LNM_000540.2:c.5309C>T, NM_001042723.1:c.5309C>TVOUS07/30/2013
89RYR1Ex34NM_000540.2:c.5334G>Tp.Ser1778= | p.S1778=NM_000540.2:c.5334G>T, NM_001042723.1:c.5334G>TBenign03/25/2013 
90RYR1Ex34NM_000540.2:c.5336C>Tp.Pro1779Leu | p.P1779LNM_000540.2:c.5336C>T, NM_001042723.1:c.5336C>TVOUS04/28/2015
91RYR1Ex34NM_000540.2:c.5364T>Gp.Ala1788= | p.A1788=NM_000540.2:c.5364T>G, NM_001042723.1:c.5364T>GVOUS11/17/2014
92RYR1Ex34NM_000540.2:c.5484C>Tp.Asp1828= | p.D1828=LRG_766t1:c.5484C>T, NM_000540.2:c.5484C>T, NM_001042723.1:c.5484C>TVOUS11/29/2016
93RYR1Ex34NM_000540.2:c.5488G>Ap.Val1830Ile | p.V1830INM_000540.2:c.5488G>A, NM_001042723.1:c.5488G>AVOUS10/06/2015
94RYR1Ex34NM_000540.2:c.5493G>Tp.Gly1831= | p.G1831=Benign05/07/2013 
95RYR1Ex35NM_000540.2:c.5565C>Tp.Gly1855= | p.G1855=NM_000540.2:c.5565C>T, NM_001042723.1:c.5565C>TBenign07/30/2015 
96RYR1Ex35NM_000540.2:c.5622A>Gp.Glu1874= | p.E1874=NM_000540.2:c.5622A>G, NM_001042723.1:c.5622A>GBenign10/08/2015 
97RYR1Ex35NM_000540.2:c.5634G>Cp.Glu1878Asp | p.E1878DNM_000540.2:c.5634G>C, NM_001042723.1:c.5634G>CBenign07/31/2013 
98RYR1Ex35NM_000540.2:c.5637C>Tp.Asp1879= | p.D1879=NM_000540.2:c.5637C>T, NM_001042723.1:c.5637C>TVOUS10/17/2013
99RYR1Ex35NM_000540.2:c.5671_5673delGAGNM_000540.2:c.5671_5673delGAG, NM_001042723.1:c.5671_5673delGAGLikely benign02/18/2015 
100RYR1Ex35NM_000540.2:c.5736G>Ap.Glu1912= | p.E1912=NM_000540.2:c.5736G>A, NM_001042723.1:c.5736G>AVOUS09/09/2014
101RYR1Ex37NM_000540.2:c.6039A>Gp.Lys2013= | p.K2013=NM_000540.2:c.6039A>G, NM_001042723.1:c.6039A>GBenign07/31/2013 
102RYR1Ex38NM_000540.2:c.6150G>Ap.Glu2050= | p.E2050=NM_000540.2:c.6150G>A, NM_001042723.1:c.6150G>AVOUS02/05/2014
103RYR1Ex38NM_000540.2:c.6178G>Tp.Gly2060Cys | p.G2060CNM_000540.2:c.6178G>T, NM_001042723.1:c.6178G>TBenign07/31/2013 
104RYR1Ex38NM_000540.2:c.6274+1G>ALRG_766t1:c.6274+1G>A, NM_000540.2:c.6274+1G>A, NM_001042723.1:c.6274+1G>APathogenic10/06/2017 
105RYR1Ex39NM_000540.2:c.6359T>Cp.Met2120Thr | p.M2120TVOUS08/20/2012
106RYR1Ex39NM_000540.2:c.6384C>Tp.Tyr2128= | p.Y2128=NM_000540.2:c.6384C>T, NM_001042723.1:c.6384C>TBenign07/31/2013 
107RYR1Ex39NM_000540.2:c.6406C>Tp.Arg2136Cys | p.R2136CLRG_766t1:c.6406C>T, NM_000540.2:c.6406C>T, NM_001042723.1:c.6406C>TVOUS07/15/2016
108RYR1Ex39NM_000540.2:c.6498C>Tp.Leu2166= | p.L2166=NM_000540.2:c.6498C>T, NM_001042723.1:c.6498C>TBenign07/10/2014 
109RYR1Ex40NM_000540.2:c.6564C>Gp.Asn2188Lys | p.N2188KLRG_766t1:c.6564C>G, NM_000540.2:c.6564C>G, NM_001042723.1:c.6564C>GVOUS10/15/2013
110RYR1Ex40NM_000540.2:c.6599C>Tp.Ala2200Val | p.A2200VLRG_766t1:c.6599C>T, NM_000540.2:c.6599C>T, NM_001042723.1:c.6599C>TVOUS03/10/2020
111RYR1Ex40NM_000540.2:c.6617C>Tp.Thr2206Met | p.T2206MLRG_766t1:c.6617C>T, NM_000540.2:c.6617C>T, NM_001042723.1:c.6617C>TPathogenic05/26/2020 
112RYR1Ex40NM_000540.2:c.6640G>Ap.Val2214Ile | p.V2214INM_000540.2:c.6640G>A, NM_001042723.1:c.6640G>AVOUS11/15/2014
113RYR1Ex40NM_000540.2:c.6645C>Tp.Leu2215= | p.L2215=NM_000540.2:c.6645C>T, NM_001042723.1:c.6645C>TVOUS06/11/2015
114RYR1Ex40NM_000540.2:c.6654C>Tp.Gly2218= | p.G2218=LRG_766t1:c.6654C>T, NM_000540.2:c.6654C>T, NM_001042723.1:c.6654C>TVOUS10/27/2015
115RYR1Ex41NM_000540.2:c.6721C>Tp.Arg2241* | p.R2241XLRG_766t1:c.6721C>T, NM_000540.2:c.6721C>T, NM_001042723.1:c.6721C>TPathogenic02/19/2015 
116RYR1Ex43NM_000540.2:c.6904C>Tp.Leu2302= | p.L2302=NM_000540.2:c.6904C>T, NM_001042723.1:c.6904C>TVOUS06/10/2015
117RYR1Ex43NM_000540.2:c.7025A>Gp.Asn2342Ser | p.N2342SNM_000540.2:c.7025A>G, NM_001042723.1:c.7025A>GVOUS03/21/2014
118RYR1Ex44NM_000540.2:c.7089C>Tp.Cys2363= | p.C2363=NM_000540.2:c.7089C>T, NM_001042723.1:c.7089C>TBenign05/07/2013 
119RYR1Ex44NM_000540.2:c.7098C>Tp.Pro2366= | p.P2366=NM_000540.2:c.7098C>T, NM_001042723.1:c.7098C>TBenign05/07/2013 
120RYR1Ex44NM_000540.2:c.7209C>Tp.Arg2403= | p.R2403=NM_000540.2:c.7209C>T, NM_001042723.1:c.7209C>TBenign11/06/2014 
121RYR1Ex45NM_000540.2:c.7260C>Tp.His2420= | p.H2420=NM_000540.2:c.7260C>T, NM_001042723.1:c.7260C>TBenign02/17/2014 
122RYR1Ex45NM_000540.2:c.7281C>Tp.Ala2427= | p.A2427=NM_000540.2:c.7281C>T, NM_001042723.1:c.7281C>TBenign04/22/2014 
123RYR1Ex45NM_000540.2:c.7300G>Ap.Gly2434Arg | p.G2434RLRG_766t1:c.7300G>A, NM_000540.2:c.7300G>A, NM_001042723.1:c.7300G>APathogenic02/13/2020 
124RYR1Ex45NM_000540.2:c.7323+20C>ANM_000540.2:c.7323+20C>A, NM_001042723.1:c.7323+20C>ABenign05/07/2013 
125RYR1Ex46NM_000540.2:c.7360C>Tp.Arg2454Cys | p.R2454CLRG_766t1:c.7360C>T, NM_000540.2:c.7360C>T, NM_001042723.1:c.7360C>TLikely pathogenic04/29/2014 
126RYR1Ex46NM_000540.2:c.7372C>Tp.Arg2458Cys | p.R2458CLRG_766t1:c.7372C>T, NM_000540.2:c.7372C>T, NM_001042723.1:c.7372C>TLikely pathogenic11/12/2018 
127RYR1Ex46NM_000540.2:c.7373G>Ap.Arg2458His | p.R2458HLRG_766t1:c.7373G>A, NM_000540.2:c.7373G>A, NM_001042723.1:c.7373G>APathogenic10/18/2013 
128RYR1Ex46NM_000540.2:c.7433C>Ap.Thr2478Asn | p.T2478NLRG_766t1:c.7433C>A, NM_000540.2:c.7433C>A, NM_001042723.1:c.7433C>AVOUS01/13/2017
129RYR1Ex47NM_000540.2:c.7463_7475delCAAAGATGTCAGCNM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_001042723.1:c.7463_7475delCAAAGATGTCAGCPathogenic07/29/2014 
130RYR1Ex47NM_000540.2:c.7500G>Ap.Ala2500= | p.A2500=NM_000540.2:c.7500G>A, NM_001042723.1:c.7500G>ABenign07/14/2014 
131RYR1Ex47NM_000540.2:c.7522C>Tp.Arg2508Cys | p.R2508CLRG_766t1:c.7522C>T, NM_000540.2:c.7522C>T, NM_001042723.1:c.7522C>TLikely pathogenic04/30/2015 
132RYR1Ex47NM_000540.2:c.7527G>Ap.Val2509= | p.V2509=NM_000540.2:c.7527G>A, NM_001042723.1:c.7527G>ABenign07/14/2014 
133RYR1Ex47NM_000540.2:c.7584C>Tp.Pro2528= | p.P2528=LRG_766t1:c.7584C>T, NM_000540.2:c.7584C>T, NM_001042723.1:c.7584C>TBenign04/22/2014 
134RYR1Ex47NM_000540.2:c.7608G>Ap.Leu2536= | p.L2536=LRG_766t1:c.7608G>A, NM_000540.2:c.7608G>A, NM_001042723.1:c.7608G>AVOUS08/04/2016
135RYR1Ex47NM_000540.2:c.7614+10C>GLRG_766t1:c.7614+10C>G, NM_000540.2:c.7614+10C>G, NM_001042723.1:c.7614+10C>GBenign06/06/2014 
136RYR1Ex48NM_000540.2:c.7615-5C>TNM_000540.2:c.7615-5C>T, NM_001042723.1:c.7615-5C>TVOUS12/09/2014
137RYR1Ex48NM_000540.2:c.7737G>Ap.Val2579= | p.V2579=NM_000540.2:c.7737G>A, NM_001042723.1:c.7737G>ABenign08/09/2013 
138RYR1Ex48NM_000540.2:c.7771C>Gp.Arg2591Gly | p.R2591GNM_000540.2:c.7771C>G, NM_001042723.1:c.7771C>GVOUS08/09/2013
139RYR1Ex48NM_000540.2:c.7798C>Tp.Arg2600Cys | p.R2600CLRG_766t1:c.7798C>T, NM_000540.2:c.7798C>T, NM_001042723.1:c.7798C>TVOUS01/20/2017
140RYR1Ex48NM_000540.2:c.7835+5A>GLRG_766t1:c.7835+5A>G, NM_000540.2:c.7835+5A>G, NM_001042723.1:c.7835+5A>GBenign06/06/2014 
141RYR1Ex48NM_000540.2:c.7835+7C>TNM_000540.2:c.7835+7C>T, NM_001042723.1:c.7835+7C>TBenign08/09/2013 
142RYR1Ex49NM_000540.2:c.7863C>Tp.His2621= | p.H2621=NM_000540.2:c.7863C>T, NM_001042723.1:c.7863C>TBenign08/09/2013 
143RYR1Ex49NM_000540.2:c.7872C>Tp.Arg2624= | p.R2624=NM_000540.2:c.7872C>T, NM_001042723.1:c.7872C>TBenign06/06/2014 
144RYR1Ex49NM_000540.2:c.7923C>Gp.Leu2641= | p.L2641=NM_000540.2:c.7923C>G, NM_001042723.1:c.7923C>GVOUS12/03/2014
145RYR1Ex50NM_000540.2:c.7977G>Ap.Thr2659= | p.T2659=LRG_766t1:c.7977G>A, NM_000540.2:c.7977G>A, NM_001042723.1:c.7977G>ABenign05/20/2016 
146RYR1Ex51NM_000540.2:c.8073C>Tp.Tyr2691= | p.Y2691=NM_000540.2:c.8073C>T, NM_001042723.1:c.8073C>TVOUS11/17/2014
147RYR1Ex51NM_000540.2:c.8118T>Cp.Ile2706= | p.I2706=NM_000540.2:c.8118T>C, NM_001042723.1:c.8118T>CBenign06/06/2014 
148RYR1Ex51NM_000540.2:c.8190T>Cp.Asp2730= | p.D2730=NM_000540.2:c.8190T>C, NM_001042723.1:c.8190T>CBenign06/06/2014 
149RYR1Ex52NM_000540.2:c.8305G>Ap.Asp2769Asn | p.D2769NNM_000540.2:c.8305G>A, NM_001042723.1:c.8305G>AVOUS12/18/2013
150RYR1Ex53NM_000540.2:c.8327C>Tp.Ser2776Phe | p.S2776FNM_000540.2:c.8327C>T, NM_001042723.1:c.8327C>TVOUS04/07/2015
151RYR1Ex53NM_000540.2:c.8337G>Ap.Glu2779= | p.E2779=NM_000540.2:c.8337G>A, NM_001042723.1:c.8337G>ABenign06/06/2014 
152RYR1Ex53NM_000540.2:c.8360C>Gp.Thr2787Ser | p.T2787SNM_000540.2:c.8360C>G, NM_001042723.1:c.8360C>GBenign07/30/2015 
153RYR1Ex53NM_000540.2:c.8376G>Ap.Arg2792= | p.R2792=NM_000540.2:c.8376G>A, NM_001042723.1:c.8376G>ABenign01/02/2014 
154RYR1Ex54NM_000540.2:c.8505A>Tp.Glu2835Asp | p.E2835DLRG_766t1:c.8505A>T, NM_000540.2:c.8505A>T, NM_001042723.1:c.8505A>TVOUS11/17/2014
155RYR1Ex55NM_000540.2:c.8589T>Cp.Ser2863= | p.S2863=NM_000540.2:c.8589T>C, NM_001042723.1:c.8589T>CBenign06/06/2014 
156RYR1Ex55NM_000540.2:c.8616+7G>ALRG_766t1:c.8616+7G>A, NM_000540.2:c.8616+7G>A, NM_001042723.1:c.8616+7G>ALikely benign07/10/2015 
157RYR1Ex57NM_000540.2:c.8693-10G>CNM_000540.2:c.8693-10G>C, NM_001042723.1:c.8693-10G>CBenign06/06/2014 
158RYR1Ex57NM_000540.2:c.8733C>Ap.Leu2911= | p.L2911=NM_000540.2:c.8733C>A, NM_001042723.1:c.8733C>AVOUS07/24/2015
159RYR1Ex57NM_000540.2:c.8816+17T>ANM_000540.2:c.8816+17T>A, NM_001042723.1:c.8816+17T>ABenign06/06/2014 
160RYR1Ex58NM_000540.2:c.8827G>Ap.Asp2943Asn | p.D2943NNM_000540.2:c.8827G>A, NM_001042723.1:c.8827G>ABenign07/31/2013 
161RYR1Ex58NM_000540.2:c.8929_8932+4delCTGGGTACinsAAGCGGPathogenic08/23/2016 
162RYR1Ex59NM_000540.2:c.8949T>Cp.Ser2983= | p.S2983=NM_000540.2:c.8949T>C, NM_001042723.1:c.8949T>CBenign07/31/2013 
163RYR1Ex62NM_000540.2:c.9186A>Gp.Pro3062= | p.P3062=NM_000540.2:c.9186A>G, NM_001042723.1:c.9186A>GBenign06/06/2014 
164RYR1Ex63NM_000540.2:c.9242T>Cp.Met3081Thr | p.M3081TNM_000540.2:c.9242T>C, NM_001042723.1:c.9242T>CVOUS12/23/2015
165RYR1Ex63NM_000540.2:c.9262G>Ap.Val3088Met | p.V3088MLRG_766t1:c.9262G>A, NM_000540.2:c.9262G>A, NM_001042723.1:c.9262G>AVOUS01/23/2017
166RYR1Ex63NM_000540.2:c.9262G>Cp.Val3088Leu | p.V3088LVOUS03/01/2013
167RYR1Ex63NM_000540.2:c.9354G>Ap.Ala3118= | p.A3118=NM_000540.2:c.9354G>A, NM_001042723.1:c.9354G>AVOUS07/14/2015
168RYR1Ex63NM_000540.2:c.9355C>Tp.Arg3119Cys | p.R3119CNM_000540.2:c.9355C>T, NM_001042723.1:c.9355C>TVOUS06/11/2015
169RYR1Ex63NM_000540.2:c.9385C>Tp.Leu3129Phe | p.L3129FLRG_766t1:c.9385C>T, NM_000540.2:c.9385C>T, NM_001042723.1:c.9385C>TVOUS02/09/2017
170RYR1Ex63NM_000540.2:c.9414G>Ap.Pro3138= | p.P3138=NM_000540.2:c.9414G>A, NM_001042723.1:c.9414G>ABenign07/10/2014 
171RYR1Ex63NM_000540.2:c.9456C>Tp.Phe3152= | p.F3152=NM_000540.2:c.9456C>T, NM_001042723.1:c.9456C>TVOUS04/17/2014
172RYR1Ex65NM_000540.2:c.9555-13C>TNM_000540.2:c.9555-13C>T, NM_001042723.1:c.9555-13C>TBenign04/02/2014 
173RYR1Ex65NM_000540.2:c.9555-9G>ANM_000540.2:c.9555-9G>A, NM_001042723.1:c.9555-9G>ALikely benign08/27/2015 
174RYR1Ex65NM_000540.2:c.9624G>Tp.Pro3208= | p.P3208=NM_000540.2:c.9624G>T, NM_001042723.1:c.9624G>TVOUS10/01/2015
175RYR1Ex65NM_000540.2:c.9685+16C>TNM_000540.2:c.9685+16C>T, NM_001042723.1:c.9685+16C>TVOUS06/06/2014
176RYR1Ex66NM_000540.2:c.9690G>Ap.Leu3230= | p.L3230=NM_000540.2:c.9690G>A, NM_001042723.1:c.9690G>ABenign07/31/2013 
177RYR1Ex66NM_000540.2:c.9713A>Gp.Glu3238Gly | p.E3238GNM_000540.2:c.9713A>G, NM_001042723.1:c.9713A>GVOUS09/21/2015
178RYR1Ex66NM_000540.2:c.9723C>Tp.Pro3241= | p.P3241=NM_000540.2:c.9723C>T, NM_001042723.1:c.9723C>TVOUS04/10/2014
179RYR1Ex67NM_000540.2:c.10032C>Tp.Pro3344= | p.P3344=LRG_766t1:c.10032C>T, NM_000540.2:c.10032C>T, NM_001042723.1:c.10032C>TVOUS05/15/2018
180RYR1Ex67NM_000540.2:c.10097G>Ap.Arg3366His | p.R3366HLRG_766t1:c.10097G>A, NM_000540.2:c.10097G>A, NM_001042723.1:c.10097G>AVOUS06/03/2016
181RYR1Ex67NM_000540.2:c.10119G>Ap.Val3373= | p.V3373=LRG_766t1:c.10119G>A, NM_000540.2:c.10119G>A, NM_001042723.1:c.10119G>AVOUS06/03/2015
182RYR1Ex67NM_000540.2:c.10188C>Tp.Asp3396= | p.D3396=LRG_766t1:c.10188C>T, NM_000540.2:c.10188C>T, NM_001042723.1:c.10188C>TBenign11/12/2013 
183RYR1Ex67NM_000540.2:c.10204T>Gp.Cys3402Gly | p.C3402GNM_000540.2:c.10204T>G, NM_001042723.1:c.10204T>GVOUS10/19/2015
184RYR1Ex67NM_000540.2:c.10218C>Tp.Tyr3406= | p.Y3406=NM_000540.2:c.10218C>T, NM_001042723.1:c.10218C>TBenign07/14/2014 
185RYR1Ex67NM_000540.2:c.10259+7G>ANM_000540.2:c.10259+7G>A, NM_001042723.1:c.10259+7G>ABenign11/25/2013 
186RYR1Ex68NM_000540.2:c.10292C>Tp.Ala3431Val | p.A3431VLRG_766t1:c.10292C>T, NM_000540.2:c.10292C>T, NM_001042723.1:c.10292C>TVOUS07/27/2017
187RYR1Ex69NM_000540.2:c.10348-6C>GLRG_766t1:c.10348-6C>G, NM_000540.2:c.10348-6C>G, NM_001042723.1:c.10348-6C>GPathogenic08/15/2017 
188RYR1Ex71NM_000540.2:c.10504C>Tp.Arg3502Trp | p.R3502WNM_000540.2:c.10504C>T, NM_001042723.1:c.10489C>TVOUS11/21/2014
189RYR1Ex71NM_000540.2:c.10616G>Ap.Arg3539His | p.R3539HLRG_766t1:c.10616G>A, NM_000540.2:c.10616G>A, NM_001042723.1:c.10601G>AVOUS08/01/2016
190RYR1Ex72NM_000540.2:c.10648C>Tp.Arg3550Trp | p.R3550WLRG_766t1:c.10648C>T, NM_000540.2:c.10648C>T, NM_001042723.1:c.10633C>TVOUS06/22/2015
191RYR1Ex73NM_000540.2:c.10687-10C>TLRG_766t1:c.10687-10C>T, NM_000540.2:c.10687-10C>T, NM_001042723.1:c.10672-10C>TBenign07/14/2014 
192RYR1Ex73NM_000540.2:c.10687-7C>TNM_000540.2:c.10687-7C>T, NM_001042723.1:c.10672-7C>TBenign05/05/2013 
193RYR1Ex73NM_000540.2:c.10747G>Cp.Glu3583Gln | p.E3583QNM_000540.2:c.10747G>C, NM_001042723.1:c.10732G>CBenign01/27/2014 
194RYR1Ex74NM_000540.2:c.10917G>Ap.Thr3639= | p.T3639=LRG_766t1:c.10917G>A, NM_000540.2:c.10917G>A, NM_001042723.1:c.10902G>AVOUS01/14/2020
195RYR1Ex75NM_000540.2:c.10941C>Gp.His3647Gln | p.H3647QNM_000540.2:c.10941C>G, NM_001042723.1:c.10926C>GBenign07/31/2013 
196RYR1Ex75NM_000540.2:c.11034+20G>TLRG_766t1:c.11034+20G>T, NM_000540.2:c.11034+20G>T, NM_001042723.1:c.11019+20G>TBenign05/07/2013 
197RYR1Ex76NM_000540.2:c.11141+7A>GNM_000540.2:c.11141+7A>G, NM_001042723.1:c.11126+7A>GBenign11/10/2014 
198RYR1Ex79NM_000540.2:c.11260-19T>GNM_000540.2:c.11260-19T>G, NM_001042723.1:c.11245-19T>GBenign04/22/2014 
199RYR1Ex79NM_000540.2:c.11266C>Gp.Gln3756Glu | p.Q3756ENM_000540.2:c.11266C>G, NM_001042723.1:c.11251C>GBenign04/22/2014 
200RYR1Ex80NM_000540.2:c.11360-9T>ANM_000540.2:c.11360-9T>A, NM_001042723.1:c.11345-9T>ALikely benign10/31/2014 
201RYR1Ex85NM_000540.2:c.11754T>Ap.Thr3918= | p.T3918=NM_000540.2:c.11754T>A, NM_001042723.1:c.11739T>ABenign04/22/2014 
202RYR1Ex86NM_000540.2:c.11798A>Gp.Tyr3933Cys | p.Y3933CLRG_766t1:c.11798A>G, NM_000540.2:c.11798A>G, NM_001042723.1:c.11783A>GVOUS03/01/2018
203RYR1Ex86NM_000540.2:c.11811G>Ap.Ser3937= | p.S3937=NM_000540.2:c.11811G>A, NM_001042723.1:c.11796G>AVOUS12/12/2014
204RYR1Ex87NM_000540.2:c.11908-14A>GNM_000540.2:c.11908-14A>G, NM_001042723.1:c.11893-14A>GBenign04/22/2014 
205RYR1Ex87NM_000540.2:c.11941C>Tp.His3981Tyr | p.H3981YNM_000540.2:c.11941C>T, NM_001042723.1:c.11926C>TBenign05/07/2013 
206RYR1Ex88NM_000540.2:c.12083C>Tp.Ser4028Leu | p.S4028LNM_000540.2:c.12083C>T, NM_001042723.1:c.12068C>TVOUS09/25/2015
207RYR1Ex89NM_000540.2:c.12121C>Tp.Arg4041Trp | p.R4041WNM_000540.2:c.12121C>T, NM_001042723.1:c.12106C>TVOUS04/15/2015
208RYR1Ex89NM_000540.2:c.12237C>Tp.Tyr4079= | p.Y4079=LRG_766t1:c.12237C>T, NM_000540.2:c.12237C>T, NM_001042723.1:c.12222C>TVOUS10/06/2020
209RYR1Ex90NM_000540.2:c.12283-7C>TNM_000540.2:c.12283-7C>T, NM_001042723.1:c.12268-7C>TBenign02/05/2014 
210RYR1Ex90NM_000540.2:c.12315_12328delAGAAATCCAGTTCCp.Glu4106Alafs*8 | p.E4106AfsX8LRG_766t1:c.12315_12328delAGAAATCCAGTTCC, NM_000540.2:c.12315_12328delAGAAATCCAGTTCC, NM_001042723.1:c.12300_12313delAGAAATCCAGTTCCPathogenic06/22/2015 
211RYR1Ex90NM_000540.2:c.12499G>Tp.Glu4167* | p.E4167XLRG_766t1:c.12499G>T, NM_000540.2:c.12499G>T, NM_001042723.1:c.12484G>TPathogenic07/08/2016 
212RYR1Ex90NM_000540.2:c.12612G>Ap.Trp4204* | p.W4204XNM_000540.2:c.12612G>A, NM_001042723.1:c.12597G>APathogenic08/15/2014 
213RYR1Ex91NM_000540.2:c.12625-1G>TNM_000540.2:c.12625-1G>T, NM_001042723.1:c.12610-1G>TPathogenic05/18/2015 
214RYR1Ex91NM_000540.2:c.12629A>Gp.Lys4210Arg | p.K4210RNM_000540.2:c.12629A>G, NM_001042723.1:c.12614A>GVOUS09/12/2013
215RYR1Ex91NM_000540.2:c.12741C>Tp.Ala4247= | p.A4247=LRG_766t1:c.12741C>T, NM_000540.2:c.12741C>T, NM_001042723.1:c.12726C>TBenign03/12/2013 
216RYR1Ex91NM_000540.2:c.12847G>Ap.Glu4283Lys | p.E4283KLRG_766t1:c.12847G>A, NM_000540.2:c.12847G>A, NM_001042723.1:c.12832G>ALikely benign01/12/2018 
217RYR1Ex91NM_000540.2:c.12860_12869delCCACGGCGGCinsTNM_000540.2:c.12860_12869delinsT, NM_001042723.1:c.12845_12854delinsTVOUS07/11/2014
218RYR1Ex91NM_000540.2:c.12861_12869dupCACGGCGGCp.Thr4288_Ala4290dup | p.T4288_A4290dupLRG_766t1:c.12861_12869dupCACGGCGGC, LRG_766t1:c.12869_12870insCACGGCGGC, NM_000540.2:c.12861_12869dupCACGGCGGC, NM_000540.2:c.12869_12870insCACGGCGGC, NM_001042723.1:c.12846_12854dupCACGGCGGC, NM_001042723.1:c.12854_12855insCACGGCGGCVOUS09/25/2018
219RYR1Ex91NM_000540.2:c.12861_12869delCACGGCGGCLRG_766t1:c.12861_12869delCACGGCGGC, NM_000540.2:c.12861_12869delCACGGCGGC, NM_001042723.1:c.12846_12854delCACGGCGGCVOUS01/11/2016
220RYR1Ex91NM_000540.2:c.12879G>Cp.Ala4293= | p.A4293=LRG_766t1:c.12879G>C, NM_000540.2:c.12879G>C, NM_001042723.1:c.12864G>CBenign02/17/2020 
221RYR1Ex91NM_000540.2:c.12880A>Gp.Thr4294Ala | p.T4294ALRG_766t1:c.12880A>G, NM_000540.2:c.12880A>G, NM_001042723.1:c.12865A>GLikely benign03/10/2020 
222RYR1Ex91NM_000540.2:c.12881C>Tp.Thr4294Met | p.T4294MLRG_766t1:c.12881C>T, NM_000540.2:c.12881C>T, NM_001042723.1:c.12866C>TVOUS09/25/2018
223RYR1Ex91NM_000540.2:c.12884C>Tp.Ala4295Val | p.A4295VNM_000540.2:c.12884C>T, NM_001042723.1:c.12869C>TVOUS05/26/2015
224RYR1Ex91NM_000540.2:c.12956G>Ap.Arg4319Gln | p.R4319QNM_000540.2:c.12956G>A, NM_001042723.1:c.12941G>AVOUS07/10/2014
225RYR1Ex91NM_000540.2:c.12990C>Gp.Thr4330= | p.T4330=LRG_766t1:c.12990C>G, NM_000540.2:c.12990C>G, NM_001042723.1:c.12975C>GVOUS09/22/2016
226RYR1Ex91NM_000540.2:c.12990C>Tp.Thr4330= | p.T4330=LRG_766t1:c.12990C>T, NM_000540.2:c.12990C>T, NM_001042723.1:c.12975C>TBenign09/26/2017 
227RYR1Ex91NM_000540.2:c.13044G>Ap.Ala4348= | p.A4348=LRG_766t1:c.13044G>A, NM_000540.2:c.13044G>A, NM_001042723.1:c.13029G>AVOUS06/02/2014
228RYR1Ex91NM_000540.2:c.13090G>Ap.Gly4364Ser | p.G4364SLRG_766t1:c.13090G>A, NM_000540.2:c.13090G>A, NM_001042723.1:c.13075G>AVOUS01/22/2018
229RYR1Ex91NM_000540.2:c.13142C>Gp.Ala4381Gly | p.A4381GNM_000540.2:c.13142C>G, NM_001042723.1:c.13127C>GVOUS01/06/2015
230RYR1Ex91NM_000540.2:c.13244_13264dupCCGCGGAGGGCGCTGGAGACGLRG_766t1:c.13264_13265insCCGCGGAGGGCGCTGGAGACG, NM_000540.2:c.13264_13265insCCGCGGAGGGCGCTGGAGACG, NM_001042723.1:c.13249_13250insCCGCGGAGGGCGCTGGAGACGVOUS05/19/2016
231RYR1Ex91NM_000540.2:c.13271A>Cp.Glu4424Ala | p.E4424ANM_000540.2:c.13271A>C, NM_001042723.1:c.13256A>CVOUS05/19/2015
232RYR1Ex91NM_000540.2:c.13317C>Tp.Ala4439= | p.A4439=LRG_766t1:c.13317C>T, NM_000540.2:c.13317C>T, NM_001042723.1:c.13302C>TBenign05/19/2016 
233RYR1Ex91NM_000540.2:c.13350G>Ap.Gly4450= | p.G4450=LRG_766t1:c.13350G>A, NM_000540.2:c.13350G>A, NM_001042723.1:c.13335G>AVOUS06/22/2017
234RYR1Ex91NM_000540.2:c.13369A>Tp.Met4457Leu | p.M4457LLRG_766t1:c.13369A>T, NM_000540.2:c.13369A>T, NM_001042723.1:c.13354A>TVOUS04/28/2016
235RYR1Ex92NM_000540.2:c.13464G>Ap.Pro4488= | p.P4488=NM_000540.2:c.13464G>A, NM_001042723.1:c.13449G>ABenign04/29/2014 
236RYR1Ex92NM_000540.2:c.13498G>Ap.Glu4500Lys | p.E4500KLRG_766t1:c.13498G>A, NM_000540.2:c.13498G>A, NM_001042723.1:c.13483G>AVOUS07/03/2019
237RYR1Ex92NM_000540.2:c.13502C>Tp.Pro4501Leu | p.P4501LLRG_766t1:c.13502C>T, NM_000540.2:c.13502C>T, NM_001042723.1:c.13487C>TBenign06/08/2016 
238RYR1Ex92NM_000540.2:c.13503G>Ap.Pro4501= | p.P4501=NM_000540.2:c.13503G>A, NM_001042723.1:c.13488G>ABenign04/02/2014 
239RYR1Ex92NM_000540.2:c.13513G>Cp.Asp4505His | p.D4505HLRG_766t1:c.13513G>C, NM_000540.2:c.13513G>C, NM_001042723.1:c.13498G>CVOUS07/22/2016
240RYR1Ex93NM_000540.2:c.13547A>Gp.Glu4516Gly | p.E4516GLRG_766t1:c.13547A>G, NM_000540.2:c.13547A>G, NM_001042723.1:c.13532A>GVOUS08/18/2016
241RYR1Ex93NM_000540.2:c.13565C>Tp.Pro4522Leu | p.P4522LNM_000540.2:c.13565C>T, NM_001042723.1:c.13550C>TVOUS02/24/2016
242RYR1Ex94NM_000540.2:c.13671C>Gp.Ser4557= | p.S4557=NM_000540.2:c.13671C>G, NM_001042723.1:c.13656C>GBenign11/12/2013 
243RYR1Ex94NM_000540.2:c.13673G>Ap.Arg4558Gln | p.R4558QLRG_766t1:c.13673G>A, NM_000540.2:c.13673G>A, NM_001042723.1:c.13658G>AVOUS01/06/2017
244RYR1Ex94NM_000540.2:c.13680T>Cp.Phe4560= | p.F4560=NM_000540.2:c.13680T>C, NM_001042723.1:c.13665T>CVOUS09/13/2014
245RYR1Ex94NM_000540.2:c.13690C>Tp.Arg4564Trp | p.R4564WLRG_766t1:c.13690C>T, NM_000540.2:c.13690C>T, NM_001042723.1:c.13675C>TVOUS04/03/2020
246RYR1Ex95NM_000540.2:c.13851A>Gp.Gly4617= | p.G4617=NM_000540.2:c.13851A>G, NM_001042723.1:c.13836A>GVOUS09/05/2014
247RYR1Ex95NM_000540.2:c.13924C>Gp.Pro4642Ala | p.P4642ALRG_766t1:c.13924C>G, NM_000540.2:c.13924C>G, NM_001042723.1:c.13909C>GVOUS05/09/2017
248RYR1Ex95NM_000540.2:c.13932G>Tp.Leu4644= | p.L4644=LRG_766t1:c.13932G>T, NM_000540.2:c.13932G>T, NM_001042723.1:c.13917G>TVOUS08/27/2020
249RYR1Ex96NM_000540.2:c.14040delGinsTCp.Lys4681Glnfs*5 | p.K4681QfsX5LRG_766t1:c.14040delinsTC, NM_000540.2:c.14040delinsTC, NM_001042723.1:c.14025delinsTCPathogenic07/09/2019 
250RYR1Ex96NM_000540.2:c.14061G>Ap.Leu4687= | p.L4687=NM_000540.2:c.14061G>A, NM_001042723.1:c.14046G>ALikely benign02/05/2015 
251RYR1Ex97NM_000540.2:c.14130-8C>GNM_000540.2:c.14130-8C>G, NM_001042723.1:c.14115-8C>GBenign07/10/2014 
252RYR1Ex98NM_000540.2:c.14203C>Tp.Arg4735Trp | p.R4735WLRG_766t1:c.14203C>T, NM_000540.2:c.14203C>T, NM_001042723.1:c.14188C>TVOUS12/13/2016
253RYR1Ex98NM_000540.2:c.14256A>Cp.Thr4752= | p.T4752=NM_000540.2:c.14256A>C, NM_001042723.1:c.14241A>CBenign07/15/2014 
254RYR1Ex98NM_000540.2:c.14270G>Ap.Arg4757His | p.R4757HLRG_766t1:c.14270G>A, NM_000540.2:c.14270G>A, NM_001042723.1:c.14255G>AVOUS01/20/2016
255RYR1Ex99NM_000540.2:c.14344G>Ap.Gly4782Arg | p.G4782RNM_000540.2:c.14344G>A, NM_001042723.1:c.14329G>AVOUS11/30/2015
256RYR1Ex100NM_000540.2:c.14416A>Gp.Asn4806Asp | p.N4806DNM_000540.2:c.14416A>G, NM_001042723.1:c.14401A>GVOUS10/19/2015
257RYR1Ex100NM_000540.2:c.14480T>Ap.Ile4827Asn | p.I4827NNM_000540.2:c.14480T>A, NM_001042723.1:c.14465T>AVOUS04/24/2014
258RYR1Ex100NM_000540.2:c.14505G>Ap.Gly4835= | p.G4835=NM_000540.2:c.14505G>A, NM_001042723.1:c.14490G>ALikely benign05/19/2015 
259RYR1Ex101NM_000540.2:c.14524G>Ap.Val4842Met | p.V4842MLRG_766t1:c.14524G>A, NM_000540.2:c.14524G>A, NM_001042723.1:c.14509G>AVOUS08/15/2017
260RYR1Ex101NM_000540.2:c.14555A>Gp.Tyr4852Cys | p.Y4852CNM_000540.2:c.14555A>G, NM_001042723.1:c.14540A>GVOUS11/09/2015
261RYR1Ex101NM_000540.2:c.14589C>Tp.Phe4863= | p.F4863=NM_000540.2:c.14589C>T, NM_001042723.1:c.14574C>TLikely benign11/15/2014 
262RYR1Ex101NM_000540.2:c.14639T>Ap.Met4880Lys | p.M4880KNM_000540.2:c.14639T>A, NM_001042723.1:c.14624T>AVOUS12/28/2015
263RYR1Ex102NM_000540.2:c.14672G>Ap.Gly4891Asp | p.G4891DLRG_766t1:c.14672G>A, NM_000540.2:c.14672G>A, NM_001042600.1:c.*2780C>T, NM_001042723.1:c.14657G>A, NM_007181.4:c.*2842C>TVOUS09/06/2018
264RYR1Ex102NM_000540.2:c.14680G>Cp.Ala4894Pro | p.A4894PNM_000540.2:c.14680G>C, NM_001042600.1:c.*2772C>G, NM_001042723.1:c.14665G>C, NM_007181.4:c.*2834C>GVOUS03/23/2015
265RYR1Ex102NM_000540.2:c.14717C>Gp.Ala4906Gly | p.A4906GNM_000540.2:c.14717C>G, NM_001042600.1:c.*2735G>C, NM_001042723.1:c.14702C>G, NM_007181.4:c.*2797G>CVOUS12/17/2014
266RYR1Ex102NM_000540.2:c.14731G>Ap.Glu4911Lys | p.E4911KLRG_766t1:c.14731G>A, NM_000540.2:c.14731G>A, NM_001042600.1:c.*2721C>T, NM_001042723.1:c.14716G>A, NM_007181.4:c.*2783C>TVOUS07/15/2016
267RYR1Ex103NM_000540.2:c.14817C>Tp.Asp4939= | p.D4939=LRG_766t1:c.14817C>T, NM_000540.2:c.14817C>T, NM_001042600.1:c.*1797G>A, NM_001042723.1:c.14802C>T, NM_007181.4:c.*1859G>AVOUS10/11/2016
268RYR1Ex103NM_000540.2:c.14818G>Ap.Ala4940Thr | p.A4940TLRG_766t1:c.14818G>A, NM_000540.2:c.14818G>A, NM_001042600.1:c.*1796C>T, NM_001042723.1:c.14803G>A, NM_007181.4:c.*1858C>TLikely pathogenic08/31/2017 
269RYR1Ex103NM_000540.2:c.14833C>Tp.Arg4945* | p.R4945XLRG_766t1:c.14833C>T, NM_000540.2:c.14833C>T, NM_001042600.1:c.*1781G>A, NM_001042723.1:c.14818C>T, NM_007181.4:c.*1843G>ALikely pathogenic02/22/2017 
270RYR1Ex104NM_000540.2:c.14918C>Tp.Pro4973Leu | p.P4973LLRG_766t1:c.14918C>T, NM_000540.2:c.14918C>T, NM_001042600.1:c.*1608G>A, NM_001042723.1:c.14903C>T, NM_007181.4:c.*1670G>ALikely pathogenic12/19/2016 
271RYR1Ex104NM_000540.2:c.14919G>Ap.Pro4973= | p.P4973=LRG_766t1:c.14919G>A, NM_000540.2:c.14919G>A, NM_001042600.1:c.*1607C>T, NM_001042723.1:c.14904G>A, NM_007181.4:c.*1669C>TVOUS08/27/2020
272RYR1Ex104NM_000540.2:c.14939C>Tp.Thr4980Met | p.T4980MVOUS08/21/2012
273RYR1Ex106NM_000540.2:c.*7C>GNM_000540.2:c.*7C>G, NM_001042600.1:c.*321G>C, NM_001042723.1:c.*7C>G, NM_007181.4:c.*383G>CVOUS03/12/2013

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.