Loading Data . . .

EmVClass

EGL's Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by EGL Genetics for that gene.
EGL Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CRB1Ex2NM_201253.2:c.71-12A>TNM_001193640.1:c.71-12A>T, NM_001257965.1:c.-137-12A>T, NM_001257966.1:c.71-12A>T, NM_201253.1:c.71-12A>T, NM_201253.2:c.71-12A>T, NR_047563.1:n.280-12A>T, NR_047564.1:n.280-12A>TBenign09/25/2013 
2CRB1Ex2NM_201253.2:c.351C>Gp.Asn117Lys | p.N117KNM_001193640.1:c.351C>G, NM_001257965.1:c.144C>G, NM_001257966.1:c.351C>G, NM_201253.1:c.351C>G, NM_201253.2:c.351C>G, NR_047563.1:n.560C>G, NR_047564.1:n.560C>GVOUS10/20/2014
3CRB1Ex2NM_201253.2:c.484G>Ap.Val162Met | p.V162MNM_001193640.1:c.484G>A, NM_001257965.1:c.277G>A, NM_001257966.1:c.484G>A, NM_201253.1:c.484G>A, NM_201253.2:c.484G>A, NR_047563.1:n.693G>A, NR_047564.1:n.693G>AVOUS10/16/2013
4CRB1Ex2NM_201253.2:c.498_506delAATTGATGGNM_001193640.1:c.498_506delAATTGATGG, NM_001257965.1:c.291_299delAATTGATGG, NM_001257966.1:c.498_506delAATTGATGG, NM_201253.1:c.498_506delAATTGATGG, NM_201253.2:c.498_506delAATTGATGG, NR_047563.1:n.707_715delAATTGATGG, NR_047564.1:n.707_715delAATTGATGGLikely benign05/02/2014 
5CRB1Ex2NM_201253.2:c.600A>Gp.Thr200= | p.T200=NM_001193640.1:c.600A>G, NM_001257965.1:c.393A>G, NM_001257966.1:c.600A>G, NM_201253.1:c.600A>G, NM_201253.2:c.600A>G, NR_047563.1:n.809A>G, NR_047564.1:n.809A>GBenign12/08/2014 
6CRB1Ex3NM_201253.2:c.799_800delGCinsANM_001193640.1:c.653-12404_653-12403delinsA, NM_001257965.1:c.592_593delinsA, NM_001257966.1:c.799_800delinsA, NM_201253.1:c.799_800delinsA, NM_201253.2:c.799_800delinsA, NR_047563.1:n.1008_1009delinsA, NR_047564.1:n.1008_1009delinsAPathogenic04/27/2016 
7CRB1Ex6NM_201253.2:c.1182C>Ap.Cys394* | p.C394XNM_001193640.1:c.846C>A, NM_001257965.1:c.975C>A, NM_001257966.1:c.1182C>A, NM_201253.1:c.1182C>A, NM_201253.2:c.1182C>A, NR_047563.1:n.1391C>A, NR_047564.1:n.1391C>APathogenic01/20/2016 
8CRB1Ex6NM_201253.2:c.1410A>Gp.Leu470= | p.L470=NM_001193640.1:c.1074A>G, NM_001257965.1:c.1203A>G, NM_001257966.1:c.1410A>G, NM_201253.1:c.1410A>G, NM_201253.2:c.1410A>G, NR_047563.1:n.1619A>G, NR_047564.1:n.1619A>GBenign01/20/2016 
9CRB1Ex6NM_201253.2:c.1470C>Tp.Gly490= | p.G490=NM_001193640.1:c.1134C>T, NM_001257965.1:c.1263C>T, NM_001257966.1:c.1470C>T, NM_201253.1:c.1470C>T, NM_201253.2:c.1470C>T, NR_047563.1:n.1679C>T, NR_047564.1:n.1679C>TVOUS05/20/2016
10CRB1Ex6NM_201253.2:c.1533C>Tp.Ala511= | p.A511=NM_001193640.1:c.1197C>T, NM_001257965.1:c.1326C>T, NM_001257966.1:c.1533C>T, NM_201253.1:c.1533C>T, NM_201253.2:c.1533C>T, NR_047563.1:n.1742C>T, NR_047564.1:n.1742C>TBenign09/15/2016 
11CRB1Ex6NM_201253.2:c.1576C>Tp.Arg526* | p.R526XNM_001193640.1:c.1240C>T, NM_001257965.1:c.1369C>T, NM_001257966.1:c.1576C>T, NM_201253.1:c.1576C>T, NM_201253.2:c.1576C>T, NR_047563.1:n.1785C>T, NR_047564.1:n.1785C>TPathogenic11/07/2014 
12CRB1Ex6NM_201253.2:c.1699T>Cp.Trp567Arg | p.W567RNM_001193640.1:c.1363T>C, NM_001257965.1:c.1492T>C, NM_001257966.1:c.1699T>C, NM_201253.1:c.1699T>C, NM_201253.2:c.1699T>C, NR_047563.1:n.1908T>C, NR_047564.1:n.1908T>CVOUS04/01/2016
13CRB1Ex6NM_201253.2:c.1986A>Gp.Ser662= | p.S662=NM_001193640.1:c.1650A>G, NM_001257965.1:c.1779A>G, NM_001257966.1:c.1986A>G, NM_201253.1:c.1986A>G, NM_201253.2:c.1986A>G, NR_047563.1:n.1987A>G, NR_047564.1:n.2195A>GLikely benign05/26/2016 
14CRB1Ex6NM_201253.2:c.2103C>Gp.Pro701= | p.P701=NM_001193640.1:c.1767C>G, NM_001257965.1:c.1896C>G, NM_001257966.1:c.2103C>G, NM_201253.1:c.2103C>G, NM_201253.2:c.2103C>G, NR_047563.1:n.2104C>G, NR_047564.1:n.2312C>GVOUS09/08/2016
15CRB1Ex7NM_201253.2:c.2195G>Cp.Ser732Thr | p.S732TNM_001193640.1:c.1859G>C, NM_001257965.1:c.1988G>C, NM_001257966.1:c.2128+5564G>C, NM_201253.1:c.2195G>C, NM_201253.2:c.2195G>C, NR_047563.1:n.2196G>C, NR_047564.1:n.2404G>CVOUS08/31/2016
16CRB1Ex7NM_201253.2:c.2222T>Cp.Met741Thr | p.M741TNM_001193640.1:c.1886T>C, NM_001257965.1:c.2015T>C, NM_001257966.1:c.2128+5591T>C, NM_201253.1:c.2222T>C, NM_201253.2:c.2222T>C, NR_047563.1:n.2223T>C, NR_047564.1:n.2431T>CLikely pathogenic04/14/2016 
17CRB1Ex7NM_201253.2:c.2272A>Tp.Ser758Cys | p.S758CNM_001193640.1:c.1936A>T, NM_001257965.1:c.2065A>T, NM_001257966.1:c.2128+5641A>T, NM_201253.1:c.2272A>T, NM_201253.2:c.2272A>T, NR_047563.1:n.2273A>T, NR_047564.1:n.2481A>TVOUS09/08/2016
18CRB1Ex7NM_201253.2:c.2291G>Ap.Arg764His | p.R764HNM_001193640.1:c.1955G>A, NM_001257965.1:c.2084G>A, NM_001257966.1:c.2128+5660G>A, NM_201253.1:c.2291G>A, NM_201253.2:c.2291G>A, NR_047563.1:n.2292G>A, NR_047564.1:n.2500G>AVOUS12/27/2013
19CRB1Ex7NM_201253.2:c.2306G>Ap.Arg769His | p.R769HBenign03/19/2014 
20CRB1Ex7NM_201253.2:c.2401A>Tp.Lys801* | p.K801XNM_001193640.1:c.2065A>T, NM_001257965.1:c.2194A>T, NM_001257966.1:c.2128+5770A>T, NM_201253.1:c.2401A>T, NM_201253.2:c.2401A>T, NR_047563.1:n.2402A>T, NR_047564.1:n.2610A>TPathogenic11/14/2017 
21CRB1Ex7NM_201253.2:c.2462C>Tp.Thr821Met | p.T821MNM_001193640.1:c.2126C>T, NM_001257965.1:c.2255C>T, NM_001257966.1:c.2128+5831C>T, NM_201253.1:c.2462C>T, NM_201253.2:c.2462C>T, NR_047563.1:n.2463C>T, NR_047564.1:n.2671C>TVOUS12/04/2014
22CRB1Ex7NM_201253.2:c.2506C>Ap.Pro836Thr | p.P836TNM_001193640.1:c.2170C>A, NM_001257965.1:c.2299C>A, NM_001257966.1:c.2128+5875C>A, NM_201253.1:c.2506C>A, NM_201253.2:c.2506C>A, NR_047563.1:n.2507C>A, NR_047564.1:n.2715C>AVOUS09/18/2019
23CRB1Ex8NM_201253.2:c.2688T>Ap.Cys896* | p.C896XNM_001193640.1:c.2352T>A, NM_001257965.1:c.2616T>A, NM_001257966.1:c.2129-6140T>A, NM_201253.1:c.2688T>A, NM_201253.2:c.2688T>A, NR_047563.1:n.2689T>A, NR_047564.1:n.2897T>APathogenic09/02/2014 
24CRB1Ex8NM_201253.2:c.2809G>Ap.Ala937Thr | p.A937TNM_001193640.1:c.2473G>A, NM_001257965.1:c.2737G>A, NM_001257966.1:c.2129-6019G>A, NM_201253.1:c.2809G>A, NM_201253.2:c.2809G>A, NR_047563.1:n.2810G>A, NR_047564.1:n.3018G>AVOUS02/11/2016
25CRB1Ex9NM_201253.2:c.2843-10C>TNM_001193640.1:c.2507-10C>T, NM_001257965.1:c.2771-10C>T, NM_001257966.1:c.2129-904C>T, NM_201253.1:c.2843-10C>T, NM_201253.2:c.2843-10C>T, NR_047563.1:n.2844-10C>T, NR_047564.1:n.3052-10C>TVOUS04/18/2019
26CRB1Ex9NM_201253.2:c.2843G>Ap.Cys948Tyr | p.C948YNM_001193640.1:c.2507G>A, NM_001257965.1:c.2771G>A, NM_001257966.1:c.2129-894G>A, NM_201253.1:c.2843G>A, NM_201253.2:c.2843G>A, NR_047563.1:n.2844G>A, NR_047564.1:n.3052G>APathogenic01/04/2019 
27CRB1Ex9NM_201253.2:c.3038A>Cp.Gln1013Pro | p.Q1013PNM_001193640.1:c.2702A>C, NM_001257965.1:c.2966A>C, NM_001257966.1:c.2129-699A>C, NM_201253.1:c.3038A>C, NM_201253.2:c.3038A>C, NR_047563.1:n.3039A>C, NR_047564.1:n.3247A>CVOUS02/05/2016
28CRB1Ex9NM_201253.2:c.3166G>Tp.Asp1056Tyr | p.D1056YNM_001193640.1:c.2830G>T, NM_001257965.1:c.3094G>T, NM_001257966.1:c.2129-571G>T, NM_201253.1:c.3166G>T, NM_201253.2:c.3166G>T, NR_047563.1:n.3167G>T, NR_047564.1:n.3375G>TVOUS01/22/2014
29CRB1Ex9NM_201253.2:c.3211C>Tp.Leu1071Phe | p.L1071FNM_001193640.1:c.2875C>T, NM_001257965.1:c.3139C>T, NM_001257966.1:c.2129-526C>T, NM_201253.1:c.3211C>T, NM_201253.2:c.3211C>T, NR_047563.1:n.3212C>T, NR_047564.1:n.3420C>TVOUS10/15/2013
30CRB1Ex9NM_201253.2:c.3307G>Ap.Gly1103Arg | p.G1103RNM_001193640.1:c.2971G>A, NM_001257965.1:c.3235G>A, NM_001257966.1:c.2129-430G>A, NM_201253.1:c.3307G>A, NM_201253.2:c.3307G>A, NR_047563.1:n.3308G>A, NR_047564.1:n.3516G>APathogenic04/01/2016 
31CRB1Ex9NM_201253.2:c.3317A>Gp.Tyr1106Cys | p.Y1106CNM_001193640.1:c.2981A>G, NM_001257965.1:c.3245A>G, NM_001257966.1:c.2129-420A>G, NM_201253.1:c.3317A>G, NM_201253.2:c.3317A>G, NR_047563.1:n.3318A>G, NR_047564.1:n.3526A>GVOUS02/24/2015
32CRB1Ex9NM_201253.2:c.3383delTNM_001193640.1:c.3047delT, NM_001257965.1:c.3311delT, NM_001257966.1:c.2129-354delT, NM_201253.1:c.3383delT, NM_201253.2:c.3383delT, NR_047563.1:n.3384delT, NR_047564.1:n.3592delTPathogenic08/26/2014 
33CRB1Ex9NM_201253.2:c.3400G>Cp.Val1134Leu | p.V1134LNM_001193640.1:c.3064G>C, NM_001257965.1:c.3328G>C, NM_001257966.1:c.2129-337G>C, NM_201253.1:c.3400G>C, NM_201253.2:c.3400G>C, NR_047563.1:n.3401G>C, NR_047564.1:n.3609G>CVOUS11/01/2016
34CRB1Ex9NM_201253.2:c.3596A>Gp.His1199Arg | p.H1199RNM_001193640.1:c.3260A>G, NM_001257965.1:c.3524A>G, NM_001257966.1:c.2129-141A>G, NM_201253.1:c.3596A>G, NM_201253.2:c.3596A>G, NR_047563.1:n.3597A>G, NR_047564.1:n.3805A>GVOUS01/21/2020
35CRB1Ex10NM_201253.2:c.3878+10A>GNM_001193640.1:c.3542+10A>G, NM_001257965.1:c.3806+10A>G, NM_001257966.1:c.2270+10A>G, NM_201253.1:c.3878+10A>G, NM_201253.2:c.3878+10A>G, NR_047563.1:n.3879+10A>G, NR_047564.1:n.4087+10A>GVOUS02/05/2016
36CRB1Ex11NM_201253.2:c.3893T>Cp.Ile1298Thr | p.I1298TNM_001193640.1:c.3557T>C, NM_001257965.1:c.3821T>C, NM_001257966.1:c.2285T>C, NM_201253.1:c.3893T>C, NM_201253.2:c.3893T>C, NR_047563.1:n.3894T>C, NR_047564.1:n.4102T>CVOUS09/16/2014
37CRB1Ex11NM_201253.2:c.3992G>Ap.Arg1331His | p.R1331HNM_001193640.1:c.3656G>A, NM_001257965.1:c.3920G>A, NM_001257966.1:c.2384G>A, NM_201253.1:c.3992G>A, NM_201253.2:c.3992G>A, NR_047563.1:n.3993G>A, NR_047564.1:n.4201G>ABenign02/16/2015 
38GABRB1Ex1NM_000812.3:c.52A>Gp.Met18Val | p.M18VNM_000812.3:c.52A>G, XM_005248081.1:c.52A>GVOUS10/03/2018
39GABRB1Ex7NM_000812.3:c.687G>Ap.Ala229= | p.A229=NM_000812.3:c.687G>A, XM_005248081.1:c.687G>ABenign02/14/2019 
40GABRB1Ex7NM_000812.3:c.734A>Gp.Tyr245Cys | p.Y245CNM_000812.3:c.734A>G, XM_005248081.1:c.734A>GVOUS10/25/2019
41GABRB1Ex7NM_000812.3:c.835+6A>GNM_000812.3:c.835+6A>G, XM_005248081.1:c.835+6A>GBenign02/14/2019 
42GABRB1Ex9NM_000812.3:c.1263C>Gp.His421Gln | p.H421QNM_000812.3:c.1263C>G, XM_005248081.1:c.1257C>GLikely benign01/18/2019 
43GABRB1Ex9NM_000812.3:c.1329G>Ap.Leu443= | p.L443=Likely benign04/02/2019 
44IL12RB1Ex2NM_005535.1:c.94C>Tp.Gln32* | p.Q32XLRG_72t1:c.94C>T, NM_005535.1:c.94C>T, NM_153701.1:c.94C>T, XM_005259893.1:c.94C>TPathogenic03/02/2016 
45IL12RB1Ex8NM_005535.2:c.710delCp.Pro237Hisfs*5 | p.P237HfsX5LRG_72t1:c.710delC, NM_005535.1:c.710delC, NM_153701.1:c.710delC, XM_005259893.1:c.710delCPathogenic09/12/2019 
46RB1Ex1NM_000321.2:c.16C>Tp.Pro6Ser | p.P6SNM_000321.2:c.16C>T, NR_046414.1:n.-267G>AVOUS01/07/2016
47RB1Ex1NM_000321.2:c.45_53delTGCCGCCGCNM_000321.2:c.45_53delTGCCGCCGC, NR_046414.1:n.-304_-296delGCGGCGGCABenign08/25/2014 
48RB1Ex1NM_000321.2:c.54_79delGGAACCCCCGGCACCGCCGCCGCCGCPathogenic03/19/2014 
49RB1Ex3NM_000321.2:c.297G>Ap.Trp99* | p.W99XNM_000321.2:c.297G>APathogenic11/13/2014 
50RB1Ex3NM_000321.2:c.376delANM_000321.2:c.376delAPathogenic08/14/2015 
51RB1Ex3NM_000321.2:c.380+10C>GNM_000321.2:c.380+10C>GBenign09/10/2013 
52RB1Ex3NM_000321.2:c.380+12T>CNM_000321.2:c.380+12T>CBenign09/06/2013 
53RB1Ex4NM_000321.2:c.396delTNM_000321.2:c.396delTPathogenic01/27/2016 
54RB1Ex8NM_000321.2:c.763C>Tp.Arg255* | p.R255XPathogenic03/24/2014 
55RB1Ex9NM_000321.2:c.929G>Ap.Gly310Glu | p.G310ELRG_517t1:c.929G>A, NM_000321.2:c.929G>AVOUS11/28/2017
56RB1Ex11NM_000321.2:c.1072C>Tp.Arg358* | p.R358XNM_000321.2:c.1072C>TPathogenic09/02/2015 
57RB1Ex12NM_000321.2:c.1191delANM_000321.2:c.1191delAPathogenic03/04/2014 
58RB1Ex14NM_000321.2:c.1363C>Tp.Arg455* | p.R455XLRG_517t1:c.1363C>T, NM_000321.2:c.1363C>TPathogenic11/22/2016 
59RB1Ex15NM_000321.2:c.1390-17T>ANM_000321.2:c.1390-17T>AVOUS07/15/2014
60RB1Ex15NM_000321.2:c.1390-14A>TLRG_517t1:c.1390-14A>T, NM_000321.2:c.1390-14A>TBenign04/04/2016 
61RB1Ex15NM_000321.2:c.1399C>Tp.Arg467* | p.R467XPathogenic03/13/2013 
62RB1Ex15NM_000321.2:c.1402_1412dupTTATCCATTCAp.Gln471Hisfs*11 | p.Q471HfsX11LRG_517t1:c.1402_1412dupTTATCCATTCA, NM_000321.2:c.1402_1412dupTTATCCATTCAPathogenic03/06/2018 
63RB1Ex15NM_000321.2:c.1411_1412insATTATCCATTCNM_000321.2:c.1411_1412insATTATCCATTCPathogenic06/04/2015 
64RB1Ex16NM_000321.2:c.1422-8delTNM_000321.2:c.1422-8delTBenign07/15/2015 
65RB1Ex16NM_000321.2:c.1472T>Cp.Leu491Pro | p.L491PLRG_517t1:c.1472T>C, NM_000321.2:c.1472T>CVOUS04/06/2016
66RB1Ex17NM_000321.2:c.1510C>Tp.Gln504* | p.Q504XNM_000321.2:c.1510C>TPathogenic01/28/2016 
67RB1Ex17NM_000321.2:c.1585dupTNM_000321.2:c.1585dupPathogenic08/30/2013 
68RB1Ex18NM_000321.2:c.1696-1G>ALRG_517t1:c.1696-1G>A, NM_000321.2:c.1696-1G>APathogenic04/28/2017 
69RB1Ex20NM_000321.2:c.1961-12T>CLRG_517t1:c.1961-12T>C, NM_000321.2:c.1961-12T>CBenign04/20/2016 
70RB1Ex20NM_000321.2:c.1966C>Tp.Arg656Trp | p.R656WNM_000321.2:c.1966C>TVOUS05/06/2014
71RB1Ex20NM_000321.2:c.1981C>Tp.Arg661Trp | p.R661WNM_000321.2:c.1981C>TPathogenic11/18/2013 
72RB1Ex20NM_000321.2:c.2067_2079delGAATGAGTATGAAinsCACPathogenic07/25/2013 
73RB1Ex20NM_000321.2:c.2084T>Gp.Met695Arg | p.M695RNM_000321.2:c.2084T>GVOUS04/01/2014
74RB1Ex22NM_000321.2:c.2212-16T>AVOUS03/19/2014
75RB1Ex22NM_000321.2:c.2212-15A>GNM_000321.2:c.2212-15A>GVOUS07/21/2014
76RB1Ex22NM_000321.2:c.2325+5G>ALRG_517t1:c.2325+5G>A, NM_000321.2:c.2325+5G>AVOUS07/15/2015
77RB1Ex23NM_000321.2:c.2359C>Tp.Arg787* | p.R787XLRG_517t1:c.2359C>T, NM_000321.2:c.2359C>TPathogenic05/29/2013 
78RB1Ex23NM_000321.2:c.2370C>Ap.Tyr790* | p.Y790XNM_000321.2:c.2370C>APathogenic07/28/2014 
79RB1Ex23NM_000321.2:c.2488_2489+7delAGGTGTGTGPathogenic02/07/2013 
80RB1Ex23NM_000321.2:c.2489+1G>CLRG_517t1:c.2489+1G>C, NM_000321.2:c.2489+1G>CPathogenic04/20/2016 
81RB1Ex25NM_000321.2:c.2548C>Tp.Gln850* | p.Q850XNM_000321.2:c.2548C>TPathogenic11/25/2015 
82RB1Ex25NM_000321.2:c.2626C>Tp.Arg876Cys | p.R876CLRG_517t1:c.2626C>T, NM_000321.2:c.2626C>TVOUS08/12/2013
83RB1Ex26NM_000321.2:c.2664-10T>ALRG_517t1:c.2664-10T>A, NM_000321.2:c.2664-10T>ABenign07/14/2015 
84SCARB1Ex5NM_005505.4:c.631-53C>TBenign05/30/2019 
85SCARB1Ex5NM_005505.4:c.726+55G>ABenign05/30/2019 
86SCARB1Ex10NM_005505.4:c.1203-4C>ANM_001082959.1:c.1203-4C>A, NM_005505.4:c.1203-4C>A, XM_002343221.1:c.753+787G>T, XM_005253633.1:c.1203-4C>A, XM_005253634.1:c.1080-4C>A, XM_005253635.1:c.1080-4C>A, XM_005253636.1:c.1203-4C>A, XM_005253637.1:c.1092-4C>A, XR_132583.1:n.*4650G>TVOUS11/09/2017

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by EGL Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2020-Q1.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official EGL clinical report and should be approached with caution. Only variants identified at EGL are listed in the EmVClass. If you intend to use EGL's classification for publication purposes please contact the laboratory for permission.