Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1POLGEx2NM_002693.2:c.20G>Tp.Arg7Met | p.R7MLRG_765t1:c.20G>T, NM_001126131.1:c.20G>T, NM_002693.2:c.20G>T, XM_002343400.1:c.*1688G>T, XR_109216.1:n.-1536C>A, XR_109217.1:n.-1600C>A, XR_109217.2:n.-1600C>AVOUS11/06/2019
2POLGEx2NM_002693.2:c.24G>Cp.Lys8Asn | p.K8NLRG_765t1:c.24G>C, NM_001126131.1:c.24G>C, NM_002693.2:c.24G>C, XM_002343400.1:c.*1692G>C, XR_109216.1:n.-1540C>G, XR_109217.1:n.-1604C>G, XR_109217.2:n.-1604C>GVOUS08/02/2016
3POLGEx2NM_002693.2:c.32G>Ap.Gly11Asp | p.G11DLRG_765t1:c.32G>A, NM_001126131.1:c.32G>A, NM_002693.2:c.32G>A, XM_002343400.1:c.*1700G>A, XR_109216.1:n.-1548C>T, XR_109217.1:n.-1612C>T, XR_109217.2:n.-1612C>TVOUS05/28/2020
4POLGEx2NM_002693.2:c.33C>Tp.Gly11= | p.G11=LRG_765t1:c.33C>T, NM_001126131.1:c.33C>T, NM_002693.2:c.33C>T, XM_002343400.1:c.*1701C>T, XR_109216.1:n.-1549G>A, XR_109217.1:n.-1613G>A, XR_109217.2:n.-1613G>AVOUS03/06/2019
5POLGEx2NM_002693.2:c.42C>Gp.Val14= | p.V14=LRG_765t1:c.42C>G, NM_001126131.1:c.42C>G, NM_002693.2:c.42C>G, XM_002343400.1:c.*1710C>G, XR_109216.1:n.-1558G>C, XR_109217.1:n.-1622G>C, XR_109217.2:n.-1622G>CVOUS04/17/2019
6POLGEx2NM_002693.2:c.63T>Cp.Ala21= | p.A21=LRG_765t1:c.63T>C, NM_001126131.1:c.63T>C, NM_002693.2:c.63T>C, XM_002343400.1:c.*1731T>C, XR_109216.1:n.-1579A>G, XR_109217.1:n.-1643A>G, XR_109217.2:n.-1643A>GVOUS07/26/2019
7POLGEx2NM_002693.2:c.67G>Cp.Gly23Arg | p.G23RLRG_765t1:c.67G>C, NM_001126131.1:c.67G>C, NM_002693.2:c.67G>C, XM_002343400.1:c.*1735G>C, XR_109216.1:n.-1583C>G, XR_109217.1:n.-1647C>G, XR_109217.2:n.-1647C>GVOUS12/28/2016
8POLGEx2NM_002693.2:c.-80C>TLRG_765t1:c.-80C>T, NM_001126131.1:c.-80C>T, NM_002693.2:c.-80C>T, XM_002343400.1:c.*1589C>T, XR_109216.1:n.-1437G>A, XR_109217.1:n.-1501G>A, XR_109217.2:n.-1501G>ALikely benign12/14/2019 
9POLGEx2NM_002693.2:c.86C>Gp.Ser29Cys | p.S29CLRG_765t1:c.86C>G, NM_001126131.1:c.86C>G, NM_002693.2:c.86C>G, XM_002343400.1:c.*1754C>G, XR_109216.1:n.-1602G>C, XR_109217.1:n.-1666G>C, XR_109217.2:n.-1666G>CVOUS03/14/2019
10POLGEx2NM_002693.2:c.87C>Tp.Ser29= | p.S29=LRG_765t1:c.87C>T, NM_001126131.1:c.87C>T, NM_002693.2:c.87C>T, XM_002343400.1:c.*1755C>T, XR_109216.1:n.-1603G>A, XR_109217.1:n.-1667G>A, XR_109217.2:n.-1667G>AVOUS08/11/2020
11POLGEx2NM_002693.2:c.114G>Tp.Gly38= | p.G38=LRG_765t1:c.114G>T, NM_001126131.1:c.114G>T, NM_002693.2:c.114G>T, XM_002343400.1:c.*1782G>T, XR_109216.1:n.-1630C>A, XR_109217.1:n.-1694C>A, XR_109217.2:n.-1694C>AVOUS10/12/2020
12POLGEx2NM_002693.2:c.116A>Gp.Gln39Arg | p.Q39RLRG_765t1:c.116A>G, NM_001126131.1:c.116A>G, NM_002693.2:c.116A>G, XM_002343400.1:c.*1784A>G, XR_109216.1:n.-1632T>C, XR_109217.1:n.-1696T>C, XR_109217.2:n.-1696T>CVOUS06/14/2017
13POLGEx2NM_002693.2:c.125_139dupGGCAGCAGCAGCAGCp.Arg42_Gln46dup | p.R42_Q46dupLRG_765t1:c.125_139dupGGCAGCAGCAGCAGC, NM_001126131.1:c.125_139dupGGCAGCAGCAGCAGC, NM_002693.2:c.125_139dupGGCAGCAGCAGCAGC, XM_002343400.1:c.*1793_*1807dupGGCAGCAGCAGCAGC, XR_109216.1:n.-1655_-1641dupGCTGCTGCTGCTGCC, XR_109217.1:n.-1719_-1705dupGCTGCTGCTGCTGCC, XR_109217.2:n.-1719_-1705dupGCTGCTGCTGCTGCCVOUS08/14/2020
14POLGEx2NM_002693.2:c.125_139delGGCAGCAGCAGCAGCp.Arg42_Gln46del | p.R42_Q46delLRG_765t1:c.125_139delGGCAGCAGCAGCAGC, NM_001126131.1:c.125_139delGGCAGCAGCAGCAGC, NM_002693.2:c.125_139delGGCAGCAGCAGCAGC, XM_002343400.1:c.*1793_*1807delGGCAGCAGCAGCAGC, XR_109216.1:n.-1655_-1641delGCTGCTGCTGCTGCC, XR_109217.1:n.-1719_-1705delGCTGCTGCTGCTGCC, XR_109217.2:n.-1719_-1705delGCTGCTGCTGCTGCCVOUS10/27/2017
15POLGEx2NM_002693.2:c.125_127dupGGCp.Arg42dup | p.R42dupLRG_765t1:c.125_127dupGGC, LRG_765t1:c.127_128insGGC, NM_001126131.1:c.125_127dupGGC, NM_001126131.1:c.127_128insGGC, NM_002693.2:c.125_127dupGGC, NM_002693.2:c.127_128insGGC, XM_002343400.1:c.*1793_*1795dupGGC, XM_002343400.1:c.*1795_*1796insGGC, XR_109216.1:n.-1643_-1641dupGCC, XR_109216.1:n.-1644_-1643insGCC, XR_109217.1:n.-1707_-1705dupGCC, XR_109217.1:n.-1708_-1707insGCC, XR_109217.2:n.-1707_-1705dupGCC, XR_109217.2:n.-1708_-1707insGCCVOUS07/28/2020
16POLGEx2NM_002693.2:c.127_128insGGCAGCp.Arg42_Gln43insArgGln | p.R42_Q43insRQLRG_765t1:c.127_128insGGCAGC, NM_001126131.1:c.127_128insGGCAGC, NM_002693.2:c.127_128insGGCAGC, XM_002343400.1:c.*1795_*1796insGGCAGC, XR_109216.1:n.-1644_-1643insGCTGCC, XR_109217.1:n.-1708_-1707insGCTGCC, XR_109217.2:n.-1708_-1707insGCTGCCVOUS04/24/2020
17POLGEx2NM_002693.2:c.128A>Gp.Gln43Arg | p.Q43RLRG_765t1:c.128A>G, NM_001126131.1:c.128A>G, NM_002693.2:c.128A>G, XM_002343400.1:c.*1796A>G, XR_109216.1:n.-1644T>C, XR_109217.1:n.-1708T>C, XR_109217.2:n.-1708T>CBenign11/11/2014 
18POLGEx2NM_002693.2:c.128A>Tp.Gln43Leu | p.Q43LLRG_765t1:c.128A>T, NM_001126131.1:c.128A>T, NM_002693.2:c.128A>T, XM_002343400.1:c.*1796A>T, XR_109216.1:n.-1644T>A, XR_109217.1:n.-1708T>A, XR_109217.2:n.-1708T>AVOUS06/20/2018
19POLGEx2NM_002693.2:c.129G>Ap.Gln43= | p.Q43=LRG_765t1:c.129G>A, NM_001126131.1:c.129G>A, NM_002693.2:c.129G>A, XM_002343400.1:c.*1797G>A, XR_109216.1:n.-1645C>T, XR_109217.1:n.-1709C>T, XR_109217.2:n.-1709C>TVOUS07/02/2020
20POLGEx2NM_002693.2:c.131A>Gp.Gln44Arg | p.Q44RLRG_765t1:c.131A>G, NM_001126131.1:c.131A>G, NM_002693.2:c.131A>G, XM_002343400.1:c.*1799A>G, XR_109216.1:n.-1647T>C, XR_109217.1:n.-1711T>C, XR_109217.2:n.-1711T>CVOUS02/05/2020
21POLGEx2NM_002693.2:c.134A>Gp.Gln45Arg | p.Q45RLRG_765t1:c.134A>G, NM_001126131.1:c.134A>G, NM_002693.2:c.134A>G, XM_002343400.1:c.*1802A>G, XR_109216.1:n.-1650T>C, XR_109217.1:n.-1714T>C, XR_109217.2:n.-1714T>CLikely benign05/27/2015 
22POLGEx2NM_002693.2:c.137A>Gp.Gln46Arg | p.Q46RLRG_765t1:c.137A>G, NM_001126131.1:c.137A>G, NM_002693.2:c.137A>G, XM_002343400.1:c.*1805A>G, XR_109216.1:n.-1653T>C, XR_109217.1:n.-1717T>C, XR_109217.2:n.-1717T>CVOUS09/26/2016
23POLGEx2NM_002693.2:c.138_158delGCAGCAGCAGCAGCAGCAGCAp.Gln49_Gln55del | p.Q49_Q55delLRG_765t1:c.138_158delGCAGCAGCAGCAGCAGCAGCA, NM_001126131.1:c.138_158delGCAGCAGCAGCAGCAGCAGCA, NM_002693.2:c.138_158delGCAGCAGCAGCAGCAGCAGCA, XM_002343400.1:c.*1806_*1826delGCAGCAGCAGCAGCAGCAGCA, XR_109216.1:n.-1674_-1654delTGCTGCTGCTGCTGCTGCTGC, XR_109217.1:n.-1738_-1718delTGCTGCTGCTGCTGCTGCTGC, XR_109217.2:n.-1738_-1718delTGCTGCTGCTGCTGCTGCTGCLikely benign08/28/2019 
24POLGEx2NM_002693.2:c.138_158dupGCAGCAGCAGCAGCAGCAGCAp.Gln49_Gln55dup | p.Q49_Q55dupLRG_765t1:c.138_158dupGCAGCAGCAGCAGCAGCAGCA, NM_001126131.1:c.138_158dupGCAGCAGCAGCAGCAGCAGCA, NM_002693.2:c.138_158dupGCAGCAGCAGCAGCAGCAGCA, XM_002343400.1:c.*1806_*1826dupGCAGCAGCAGCAGCAGCAGCA, XR_109216.1:n.-1674_-1654dupTGCTGCTGCTGCTGCTGCTGC, XR_109217.1:n.-1738_-1718dupTGCTGCTGCTGCTGCTGCTGC, XR_109217.2:n.-1738_-1718dupTGCTGCTGCTGCTGCTGCTGCLikely benign03/18/2020 
25POLGEx2NM_002693.2:c.141_158delGCAGCAGCAGCAGCAGCAp.Gln50_Gln55del | p.Q50_Q55delLRG_765t1:c.141_158delGCAGCAGCAGCAGCAGCA, NM_001126131.1:c.141_158delGCAGCAGCAGCAGCAGCA, NM_002693.2:c.141_158delGCAGCAGCAGCAGCAGCA, XM_002343400.1:c.*1809_*1826delGCAGCAGCAGCAGCAGCA, XR_109216.1:n.-1674_-1657delTGCTGCTGCTGCTGCTGC, XR_109217.1:n.-1738_-1721delTGCTGCTGCTGCTGCTGC, XR_109217.2:n.-1738_-1721delTGCTGCTGCTGCTGCTGCLikely benign04/17/2017 
26POLGEx2NM_002693.2:c.144_158delGCAGCAGCAGCAGCAp.Gln51_Gln55del | p.Q51_Q55delLRG_765t1:c.144_158delGCAGCAGCAGCAGCA, NM_001126131.1:c.144_158delGCAGCAGCAGCAGCA, NM_002693.2:c.144_158delGCAGCAGCAGCAGCA, XM_002343400.1:c.*1812_*1826delGCAGCAGCAGCAGCA, XR_109216.1:n.-1674_-1660delTGCTGCTGCTGCTGC, XR_109217.1:n.-1738_-1724delTGCTGCTGCTGCTGC, XR_109217.2:n.-1738_-1724delTGCTGCTGCTGCTGCLikely benign12/18/2019 
27POLGEx2NM_002693.2:c.144_158dupGCAGCAGCAGCAGCAp.Gln51_Gln55dup | p.Q51_Q55dupLRG_765t1:c.144_158dupGCAGCAGCAGCAGCA, NM_001126131.1:c.144_158dupGCAGCAGCAGCAGCA, NM_002693.2:c.144_158dupGCAGCAGCAGCAGCA, XM_002343400.1:c.*1812_*1826dupGCAGCAGCAGCAGCA, XR_109216.1:n.-1674_-1660dupTGCTGCTGCTGCTGC, XR_109217.1:n.-1738_-1724dupTGCTGCTGCTGCTGC, XR_109217.2:n.-1738_-1724dupTGCTGCTGCTGCTGCVOUS11/16/2020
28POLGEx2NM_002693.2:c.147_158delGCAGCAGCAGCAp.Gln52_Gln55del | p.Q52_Q55delLRG_765t1:c.147_158delGCAGCAGCAGCA, NM_001126131.1:c.147_158delGCAGCAGCAGCA, NM_002693.2:c.147_158delGCAGCAGCAGCA, XM_002343400.1:c.*1815_*1826delGCAGCAGCAGCA, XR_109216.1:n.-1674_-1663delTGCTGCTGCTGC, XR_109217.1:n.-1738_-1727delTGCTGCTGCTGC, XR_109217.2:n.-1738_-1727delTGCTGCTGCTGCLikely benign04/27/2016 
29POLGEx2NM_002693.2:c.147_158dupGCAGCAGCAGCAp.Gln52_Gln55dup | p.Q52_Q55dupLRG_765t1:c.147_158dupGCAGCAGCAGCA, NM_001126131.1:c.147_158dupGCAGCAGCAGCA, NM_002693.2:c.147_158dupGCAGCAGCAGCA, XM_002343400.1:c.*1815_*1826dupGCAGCAGCAGCA, XR_109216.1:n.-1674_-1663dupTGCTGCTGCTGC, XR_109217.1:n.-1738_-1727dupTGCTGCTGCTGC, XR_109217.2:n.-1738_-1727dupTGCTGCTGCTGCLikely benign01/06/2020 
30POLGEx2NM_002693.2:c.148C>Ap.Gln50Lys | p.Q50KLRG_765t1:c.148C>A, NM_001126131.1:c.148C>A, NM_002693.2:c.148C>A, XM_002343400.1:c.*1816C>A, XR_109216.1:n.-1664G>T, XR_109217.1:n.-1728G>T, XR_109217.2:n.-1728G>TVOUS11/05/2020
31POLGEx2NM_002693.2:c.150_158delGCAGCAGCALRG_765t1:c.150_158delGCAGCAGCA, NM_001126131.1:c.150_158delGCAGCAGCA, NM_002693.2:c.150_158delGCAGCAGCA, XM_002343400.1:c.*1818_*1826delGCAGCAGCA, XR_109216.1:n.-1674_-1666delTGCTGCTGC, XR_109217.1:n.-1738_-1730delTGCTGCTGC, XR_109217.2:n.-1738_-1730delTGCTGCTGCLikely benign10/12/2016 
32POLGEx2NM_002693.2:c.150_158dupGCAGCAGCAp.Gln53_Gln55dup | p.Q53_Q55dupLRG_765t1:c.150_158dupGCAGCAGCA, NM_001126131.1:c.150_158dupGCAGCAGCA, NM_002693.2:c.150_158dupGCAGCAGCA, XM_002343400.1:c.*1818_*1826dupGCAGCAGCA, XR_109216.1:n.-1674_-1666dupTGCTGCTGC, XR_109217.1:n.-1738_-1730dupTGCTGCTGC, XR_109217.2:n.-1738_-1730dupTGCTGCTGCBenign06/28/2019 
33POLGEx2NM_002693.2:c.153_158dupGCAGCAp.Gln54_Gln55dup | p.Q54_Q55dupLRG_765t1:c.153_158dupGCAGCA, LRG_765t1:c.158_159insGCAGCA, NM_001126131.1:c.152_153insGCAGCA, NM_001126131.1:c.153_158dup, NM_001126131.1:c.153_158dupGCAGCA, NM_001126131.1:c.158_159insGCAGCA, NM_002693.2:c.152_153insGCAGCA, NM_002693.2:c.153_158dup, NM_002693.2:c.153_158dupGCAGCA, NM_002693.2:c.158_159insGCAGCA, XM_002343400.1:c.*1820_*1821insGCAGCA, XM_002343400.1:c.*1821_*1826dup, XM_002343400.1:c.*1821_*1826dupGCAGCA, XM_002343400.1:c.*1826_*1827insGCAGCA, XR_109216.1:n.-1669_-1668insTGCTGC, XR_109216.1:n.-1674_-1669dup, XR_109216.1:n.-1674_-1669dupTGCTGC, XR_109216.1:n.-1675_-1674insTGCTGC, XR_109217.1:n.-1733_-1732insTGCTGC, XR_109217.1:n.-1738_-1733dup, XR_109217.1:n.-1738_-1733dupTGCTGC, XR_109217.1:n.-1739_-1738insTGCTGC, XR_109217.2:n.-1733_-1732insTGCTGC, XR_109217.2:n.-1738_-1733dup, XR_109217.2:n.-1738_-1733dupTGCTGC, XR_109217.2:n.-1739_-1738insTGCTGCBenign02/02/2016 
34POLGEx2NM_002693.2:c.153_158delGCAGCALRG_765t1:c.153_158delGCAGCA, NM_001126131.1:c.153_158delGCAGCA, NM_002693.2:c.153_158delGCAGCA, XM_002343400.1:c.*1821_*1826delGCAGCA, XR_109216.1:n.-1674_-1669delTGCTGC, XR_109217.1:n.-1738_-1733delTGCTGC, XR_109217.2:n.-1738_-1733delTGCTGCBenign01/29/2015 
35POLGEx2NM_002693.2:c.154C>Ap.Gln52Lys | p.Q52KLRG_765t1:c.154C>A, NM_001126131.1:c.154C>A, NM_002693.2:c.154C>A, XM_002343400.1:c.*1822C>A, XR_109216.1:n.-1670G>T, XR_109217.1:n.-1734G>T, XR_109217.2:n.-1734G>TVOUS01/11/2021
36POLGEx2NM_002693.2:c.155_166delAGCAACAGCAGCLRG_765t1:c.155_166delAGCAACAGCAGC, NM_001126131.1:c.155_166delAGCAACAGCAGC, NM_002693.2:c.155_166delAGCAACAGCAGC, XM_002343400.1:c.*1823_*1834delAGCAACAGCAGC, XR_109216.1:n.-1682_-1671delGCTGCTGTTGCT, XR_109217.1:n.-1746_-1735delGCTGCTGTTGCT, XR_109217.2:n.-1746_-1735delGCTGCTGTTGCTVOUS12/14/2016
37POLGEx2NM_002693.2:c.156_158delGCANM_001126131.1:c.156_158delGCA, NM_002693.2:c.156_158delGCA, XM_002343400.1:c.*1824_*1826delGCA, XR_109216.1:n.-1674_-1672delTGC, XR_109217.1:n.-1738_-1736delTGC, XR_109217.2:n.-1738_-1736delTGCBenign03/12/2014 
38POLGEx2NM_002693.2:c.156_158dupGCAp.Gln55dup | p.Q55dupLRG_765t1:c.156_158dupGCA, LRG_765t1:c.158_159insGCA, NM_001126131.1:c.155_156insGCA, NM_001126131.1:c.156_158dup, NM_001126131.1:c.156_158dupGCA, NM_001126131.1:c.158_159insGCA, NM_002693.2:c.155_156insGCA, NM_002693.2:c.156_158dup, NM_002693.2:c.156_158dupGCA, NM_002693.2:c.158_159insGCA, XM_002343400.1:c.*1823_*1824insGCA, XM_002343400.1:c.*1824_*1826dup, XM_002343400.1:c.*1824_*1826dupGCA, XM_002343400.1:c.*1826_*1827insGCA, XR_109216.1:n.-1672_-1671insTGC, XR_109216.1:n.-1674_-1672dup, XR_109216.1:n.-1674_-1672dupTGC, XR_109216.1:n.-1675_-1674insTGC, XR_109217.1:n.-1736_-1735insTGC, XR_109217.1:n.-1738_-1736dup, XR_109217.1:n.-1738_-1736dupTGC, XR_109217.1:n.-1739_-1738insTGC, XR_109217.2:n.-1736_-1735insTGC, XR_109217.2:n.-1738_-1736dup, XR_109217.2:n.-1738_-1736dupTGC, XR_109217.2:n.-1739_-1738insTGCBenign03/18/2020 
39POLGEx2NM_002693.2:c.158_166delAACAGCAGCp.Gln53_Gln55del | p.Q53_Q55delLRG_765t1:c.158_166delAACAGCAGC, NM_001126131.1:c.158_166delAACAGCAGC, NM_002693.2:c.158_166delAACAGCAGC, XM_002343400.1:c.*1826_*1834delAACAGCAGC, XR_109216.1:n.-1682_-1674delGCTGCTGTT, XR_109217.1:n.-1746_-1738delGCTGCTGTT, XR_109217.2:n.-1746_-1738delGCTGCTGTTLikely benign04/10/2017 
40POLGEx2NM_002693.2:c.-159-6_-159-4delCTTLRG_765t1:c.-159-6_-159-4delCTT, NM_001126131.1:c.-159-6_-159-4delCTT, NM_002693.2:c.-159-6_-159-4delCTT, XM_002343400.1:c.*1504_*1506delCTT, XR_109216.1:n.-1354_-1352delAAG, XR_109217.1:n.-1418_-1416delAAG, XR_109217.2:n.-1418_-1416delAAGVOUS11/13/2019
41POLGEx2NM_002693.2:c.159A>Gp.Gln53= | p.Q53=LRG_765t1:c.159A>G, NM_001126131.1:c.159A>G, NM_002693.2:c.159A>G, XM_002343400.1:c.*1827A>G, XR_109216.1:n.-1675T>C, XR_109217.1:n.-1739T>C, XR_109217.2:n.-1739T>CBenign11/20/2017 
42POLGEx2NM_002693.2:c.160C>Tp.Gln54* | p.Q54XLRG_765t1:c.160C>T, NM_001126131.1:c.160C>T, NM_002693.2:c.160C>T, XM_002343400.1:c.*1828C>T, XR_109216.1:n.-1676G>A, XR_109217.1:n.-1740G>A, XR_109217.2:n.-1740G>APathogenic09/12/2018 
43POLGEx2NM_002693.2:c.177G>Tp.Pro59= | p.P59=LRG_765t1:c.177G>T, NM_001126131.1:c.177G>T, NM_002693.2:c.177G>T, XM_002343400.1:c.*1845G>T, XR_109216.1:n.-1693C>A, XR_109217.1:n.-1757C>A, XR_109217.2:n.-1757C>AVOUS11/13/2018
44POLGEx2NM_002693.2:c.180A>Gp.Gln60= | p.Q60=LRG_765t1:c.180A>G, NM_001126131.1:c.180A>G, NM_002693.2:c.180A>G, XM_002343400.1:c.*1848A>G, XR_109216.1:n.-1696T>C, XR_109217.1:n.-1760T>C, XR_109217.2:n.-1760T>CVOUS02/27/2017
45POLGEx2NM_002693.2:c.186A>Gp.Leu62= | p.L62=LRG_765t1:c.186A>G, NM_001126131.1:c.186A>G, NM_002693.2:c.186A>G, XM_002343400.1:c.*1854A>G, XR_109216.1:n.-1702T>C, XR_109217.1:n.-1766T>C, XR_109217.2:n.-1766T>CVOUS11/02/2016
46POLGEx2NM_002693.2:c.215A>Gp.Asn72Ser | p.N72SLRG_765t1:c.215A>G, NM_001126131.1:c.215A>G, NM_002693.2:c.215A>G, XM_002343400.1:c.*1883A>G, XR_109216.1:n.-1731T>C, XR_109217.1:n.-1795T>C, XR_109217.2:n.-1795T>CVOUS07/29/2019
47POLGEx2NM_002693.2:c.237C>Gp.Leu79= | p.L79=LRG_765t1:c.237C>G, NM_001126131.1:c.237C>G, NM_002693.2:c.237C>G, XM_002343400.1:c.*1905C>G, XR_109216.1:n.-1753G>C, XR_109217.1:n.-1817G>C, XR_109217.2:n.-1817G>CVOUS08/24/2017
48POLGEx2NM_002693.2:c.264C>Gp.Phe88Leu | p.F88LLRG_765t1:c.264C>G, NM_001126131.1:c.264C>G, NM_002693.2:c.264C>G, XM_002343400.1:c.*1932C>G, XR_109216.1:n.-1780G>C, XR_109217.1:n.-1844G>C, XR_109217.2:n.-1844G>CVOUS09/28/2018
49POLGEx2NM_002693.2:c.264C>Tp.Phe88= | p.F88=LRG_765t1:c.264C>T, NM_001126131.1:c.264C>T, NM_002693.2:c.264C>T, XM_002343400.1:c.*1932C>T, XR_109216.1:n.-1780G>A, XR_109217.1:n.-1844G>A, XR_109217.2:n.-1844G>ALikely benign11/29/2016 
50POLGEx2NM_002693.2:c.266G>Ap.Gly89Glu | p.G89ELRG_765t1:c.266G>A, NM_001126131.1:c.266G>A, NM_002693.2:c.266G>A, XM_002343400.1:c.*1934G>A, XR_109216.1:n.-1782C>T, XR_109217.1:n.-1846C>T, XR_109217.2:n.-1846C>TVOUS06/06/2019
51POLGEx2NM_002693.2:c.282G>Ap.Met94Ile | p.M94ILRG_765t1:c.282G>A, NM_001126131.1:c.282G>A, NM_002693.2:c.282G>A, XM_002343400.1:c.*1950G>A, XR_109216.1:n.-1798C>T, XR_109217.1:n.-1862C>T, XR_109217.2:n.-1862C>TVOUS07/17/2019
52POLGEx2NM_002693.2:c.304C>Tp.Arg102Cys | p.R102CLRG_765t1:c.304C>T, NM_001126131.1:c.304C>T, NM_002693.2:c.304C>T, XM_002343400.1:c.*1972C>T, XR_109216.1:n.-1820G>A, XR_109217.1:n.-1884G>A, XR_109217.2:n.-1884G>AVOUS04/18/2019
53POLGEx2NM_002693.2:c.328C>Tp.His110Tyr | p.H110YLRG_765t1:c.328C>T, NM_001126131.1:c.328C>T, NM_002693.2:c.328C>T, XM_002343400.1:c.*1996C>T, XR_109216.1:n.-1844G>A, XR_109217.1:n.-1908G>A, XR_109217.2:n.-1908G>AVOUS03/19/2021
54POLGEx2NM_002693.2:c.330C>Tp.His110= | p.H110=LRG_765t1:c.330C>T, NM_001126131.1:c.330C>T, NM_002693.2:c.330C>T, XM_002343400.1:c.*1998C>T, XR_109216.1:n.-1846G>A, XR_109217.1:n.-1910G>A, XR_109217.2:n.-1910G>AVOUS11/27/2018
55POLGEx2NM_002693.2:c.331G>Cp.Gly111Arg | p.G111RLRG_765t1:c.331G>C, NM_001126131.1:c.331G>C, NM_002693.2:c.331G>C, XM_002343400.1:c.*1999G>C, XR_109216.1:n.-1847C>G, XR_109217.1:n.-1911C>G, XR_109217.2:n.-1911C>GVOUS07/08/2019
56POLGEx2NM_002693.2:c.347C>Ap.Pro116Gln | p.P116QLRG_765t1:c.347C>A, NM_001126131.1:c.347C>A, NM_002693.2:c.347C>A, XM_002343400.1:c.*2015C>A, XR_109216.1:n.-1863G>T, XR_109217.1:n.-1927G>T, XR_109217.2:n.-1927G>TVOUS12/28/2016
57POLGEx2NM_002693.2:c.360G>Tp.Leu120Phe | p.L120FLRG_765t1:c.360G>T, NM_001126131.1:c.360G>T, NM_002693.2:c.360G>T, XM_002343400.1:c.*2028G>T, XR_109216.1:n.-1876C>A, XR_109217.1:n.-1940C>A, XR_109217.2:n.-1940C>AVOUS05/31/2016
58POLGEx2NM_002693.2:c.388C>Tp.Leu130Phe | p.L130FLRG_765t1:c.388C>T, NM_001126131.1:c.388C>T, NM_002693.2:c.388C>T, XM_002343400.1:c.*2056C>T, XR_109216.1:n.-1904G>A, XR_109217.1:n.-1968G>A, XR_109217.2:n.-1968G>AVOUS05/29/2020
59POLGEx2NM_002693.2:c.391T>Cp.Tyr131His | p.Y131HLRG_765t1:c.391T>C, NM_001126131.1:c.391T>C, NM_002693.2:c.391T>C, XM_002343400.1:c.*2059T>C, XR_109216.1:n.-1907A>G, XR_109217.1:n.-1971A>G, XR_109217.2:n.-1971A>GVOUS02/20/2020
60POLGEx2NM_002693.2:c.408C>Gp.Asp136Glu | p.D136ELRG_765t1:c.408C>G, NM_001126131.1:c.408C>G, NM_002693.2:c.408C>G, XM_002343400.1:c.*2076C>G, XR_109216.1:n.-1924G>C, XR_109217.1:n.-1988G>C, XR_109217.2:n.-1988G>CVOUS02/15/2021
61POLGEx2NM_002693.2:c.418C>Tp.Arg140Cys | p.R140CLRG_765t1:c.418C>T, NM_001126131.1:c.418C>T, NM_002693.2:c.418C>T, XM_002343400.1:c.*2086C>T, XR_109216.1:n.-1934G>A, XR_109217.1:n.-1998G>A, XR_109217.2:n.-1998G>AVOUS08/10/2017
62POLGEx2NM_002693.2:c.423C>Tp.Leu141= | p.L141=LRG_765t1:c.423C>T, NM_001126131.1:c.423C>T, NM_002693.2:c.423C>T, XM_002343400.1:c.*2091C>T, XR_109216.1:n.-1939G>A, XR_109217.1:n.-2003G>A, XR_109217.2:n.-2003G>AVOUS06/27/2018
63POLGEx2NM_002693.2:c.428C>Tp.Ala143Val | p.A143VLRG_765t1:c.428C>T, NM_001126131.1:c.428C>T, NM_002693.2:c.428C>T, XM_002343400.1:c.*2096C>T, XR_109216.1:n.-1944G>A, XR_109217.1:n.-2008G>A, XR_109217.2:n.-2008G>APathogenic10/07/2019 
64POLGEx2NM_002693.2:c.460G>Ap.Ala154Thr | p.A154TLRG_765t1:c.460G>A, NM_001126131.1:c.460G>A, NM_002693.2:c.460G>A, XM_002343400.1:c.*2128G>A, XR_109216.1:n.-1976C>T, XR_109217.1:n.-2040C>T, XR_109217.2:n.-2040C>TVOUS09/11/2020
65POLGEx2NM_002693.2:c.468G>Ap.Leu156= | p.L156=LRG_765t1:c.468G>A, NM_001126131.1:c.468G>A, NM_002693.2:c.468G>A, XM_002343400.1:c.*2136G>A, XR_109216.1:n.-1984C>T, XR_109217.1:n.-2048C>T, XR_109217.2:n.-2048C>TVOUS01/16/2018
66POLGEx2NM_002693.2:c.488C>Tp.Pro163Leu | p.P163LLRG_765t1:c.488C>T, NM_001126131.1:c.488C>T, NM_002693.2:c.488C>T, XM_002343400.1:c.*2156C>T, XR_109216.1:n.-2004G>A, XR_109217.1:n.-2068G>A, XR_109217.2:n.-2068G>AVOUS12/10/2018
67POLGEx2NM_002693.2:c.501G>Ap.Pro167= | p.P167=LRG_765t1:c.501G>A, NM_001126131.1:c.501G>A, NM_002693.2:c.501G>A, XM_002343400.1:c.*2169G>A, XR_109216.1:n.-2017C>T, XR_109217.1:n.-2081C>T, XR_109217.2:n.-2081C>TVOUS09/23/2016
68POLGEx2NM_002693.2:c.510_515dupCTGGGCp.Trp171_Ala172dup | p.W171_A172dupLRG_765t1:c.510_515dupCTGGGC, NM_001126131.1:c.510_515dupCTGGGC, NM_002693.2:c.510_515dupCTGGGC, XM_002343400.1:c.*2178_*2183dupCTGGGC, XR_109216.1:n.-2031_-2026dupGCCCAG, XR_109217.1:n.-2095_-2090dupGCCCAG, XR_109217.2:n.-2095_-2090dupGCCCAGVOUS01/29/2021
69POLGEx2NM_002693.2:c.522C>Gp.Gly174= | p.G174=LRG_765t1:c.522C>G, NM_001126131.1:c.522C>G, NM_002693.2:c.522C>G, XM_002343400.1:c.*2190C>G, XR_109216.1:n.-2038G>C, XR_109217.1:n.-2102G>C, XR_109217.2:n.-2102G>CVOUS01/24/2017
70POLGEx2NM_002693.2:c.547G>Cp.Glu183Gln | p.E183QLRG_765t1:c.547G>C, NM_001126131.1:c.547G>C, NM_002693.2:c.547G>C, XM_002343400.1:c.*2215G>C, XR_109216.1:n.-2063C>G, XR_109217.1:n.-2127C>G, XR_109217.2:n.-2127C>GVOUS03/23/2017
71POLGEx2NM_002693.2:c.578G>Ap.Arg193Gln | p.R193QLRG_765t1:c.578G>A, NM_001126131.1:c.578G>A, NM_002693.2:c.578G>A, XM_002343400.1:c.*2246G>A, XR_109216.1:n.-2094C>T, XR_109217.1:n.-2158C>T, XR_109217.2:n.-2158C>TVOUS09/10/2020
72POLGEx2NM_002693.2:c.581C>Tp.Ala194Val | p.A194VLRG_765t1:c.581C>T, NM_001126131.1:c.581C>T, NM_002693.2:c.581C>T, XM_002343400.1:c.*2249C>T, XR_109216.1:n.-2097G>A, XR_109217.1:n.-2161G>A, XR_109217.2:n.-2161G>AVOUS06/16/2017
73POLGEx2NM_002693.2:c.584T>Cp.Leu195Pro | p.L195PNM_001126131.1:c.584T>C, NM_002693.2:c.584T>C, XM_002343400.1:c.*2252T>C, XR_109216.1:n.-2100A>G, XR_109217.1:n.-2164A>G, XR_109217.2:n.-2164A>GVOUS12/17/2014
74POLGEx2NM_002693.2:c.603C>Tp.Val201= | p.V201=LRG_765t1:c.603C>T, NM_001126131.1:c.603C>T, NM_002693.2:c.603C>T, XM_002343400.1:c.*2271C>T, XR_109216.1:n.-2119G>A, XR_109217.1:n.-2183G>A, XR_109217.2:n.-2183G>AVOUS07/16/2019
75POLGEx2NM_002693.2:c.653C>Tp.Ser218Leu | p.S218LLRG_765t1:c.653C>T, NM_001126131.1:c.653C>T, NM_002693.2:c.653C>T, XM_002343400.1:c.*2321C>T, XR_109216.1:n.-2169G>A, XR_109217.1:n.-2233G>A, XR_109217.2:n.-2233G>AVOUS12/27/2018
76POLGEx2NM_002693.2:c.656C>Tp.Ala219Val | p.A219VLRG_765t1:c.656C>T, NM_001126131.1:c.656C>T, NM_002693.2:c.656C>T, XM_002343400.1:c.*2324C>T, XR_109216.1:n.-2172G>A, XR_109217.1:n.-2236G>A, XR_109217.2:n.-2236G>AVOUS09/20/2017
77POLGEx2NM_002693.2:c.659G>Cp.Trp220Ser | p.W220SLRG_765t1:c.659G>C, NM_001126131.1:c.659G>C, NM_002693.2:c.659G>C, XM_002343400.1:c.*2327G>C, XR_109216.1:n.-2175C>G, XR_109217.1:n.-2239C>G, XR_109217.2:n.-2239C>GVOUS12/13/2019
78POLGEx2NM_002693.2:c.659+9G>AVOUS11/23/2019
79POLGEx3NM_002693.2:c.678G>Cp.Gln226His | p.Q226HLRG_765t1:c.678G>C, NM_001126131.1:c.678G>C, NM_002693.2:c.678G>C, XM_002343400.1:c.*5165G>CVOUS04/13/2020
80POLGEx3NM_002693.2:c.719C>Tp.Ser240Leu | p.S240LLRG_765t1:c.719C>T, NM_001126131.1:c.719C>T, NM_002693.2:c.719C>T, XM_002343400.1:c.*5206C>TVOUS06/05/2019
81POLGEx3NM_002693.2:c.722C>Tp.Pro241Leu | p.P241LLRG_765t1:c.722C>T, NM_001126131.1:c.722C>T, NM_002693.2:c.722C>T, XM_002343400.1:c.*5209C>TVOUS05/30/2019
82POLGEx3NM_002693.2:c.739C>Gp.Leu247Val | p.L247VLRG_765t1:c.739C>G, NM_001126131.1:c.739C>G, NM_002693.2:c.739C>G, XM_002343400.1:c.*5226C>GVOUS07/11/2017
83POLGEx3NM_002693.2:c.744G>Cp.Glu248Asp | p.E248DLRG_765t1:c.744G>C, NM_001126131.1:c.744G>C, NM_002693.2:c.744G>C, XM_002343400.1:c.*5231G>CVOUS04/14/2020
84POLGEx3NM_002693.2:c.752C>Tp.Thr251Ile | p.T251ILRG_765t1:c.752C>T, NM_001126131.1:c.752C>T, NM_002693.2:c.752C>T, XM_002343400.1:c.*5239C>TPathogenic01/13/2021 
85POLGEx3NM_002693.2:c.798G>Tp.Val266= | p.V266=LRG_765t1:c.798G>T, NM_001126131.1:c.798G>T, NM_002693.2:c.798G>T, XM_002343400.1:c.*5285G>TVOUS02/12/2021
86POLGEx3NM_002693.2:c.803G>Cp.Gly268Ala | p.G268Ac.1085G>C (p.G268A), LRG_765t1:c.803G>C, NM_001126131.1:c.803G>C, NM_002693.2:c.803G>C, XM_002343400.1:c.*5290G>CLikely benign01/30/2015 
87POLGEx3NM_002693.2:c.809A>Gp.Asn270Ser | p.N270SLRG_765t1:c.809A>G, NM_001126131.1:c.809A>G, NM_002693.2:c.809A>G, XM_002343400.1:c.*5296A>GVOUS09/11/2019
88POLGEx3NM_002693.2:c.830A>Tp.His277Leu | p.H277LLRG_765t1:c.830A>T, NM_001126131.1:c.830A>T, NM_002693.2:c.830A>T, XM_002343400.1:c.*5317A>TVOUS03/20/2019
89POLGEx3NM_002693.2:c.855G>Cp.Gln285His | p.Q285HLRG_765t1:c.855G>C, NM_001126131.1:c.855G>C, NM_002693.2:c.855G>C, XM_002343400.1:c.*5342G>CVOUS01/24/2018
90POLGEx4NM_002693.2:c.856-5_856-3dupCTCLRG_765t1:c.856-5_856-3dupCTC, NM_001126131.1:c.856-5_856-3dupCTC, NM_002693.2:c.856-5_856-3dupCTCLikely benign02/20/2020 
91POLGEx4NM_002693.2:c.856-5_856-3delCTCNM_001126131.1:c.856-5_856-3delCTC, NM_002693.2:c.856-5_856-3delCTCBenign08/27/2015 
92POLGEx4NM_002693.2:c.924G>Tp.Gln308His | p.Q308HLRG_765t1:c.924G>T, NM_001126131.1:c.924G>T, NM_002693.2:c.924G>TVOUS12/02/2020
93POLGEx4NM_002693.2:c.925C>Tp.Arg309Cys | p.R309CLRG_765t1:c.925C>T, NM_001126131.1:c.925C>T, NM_002693.2:c.925C>TPathogenic03/15/2018 
94POLGEx4NM_002693.2:c.927C>Tp.Arg309= | p.R309=LRG_765t1:c.927C>T, NM_001126131.1:c.927C>T, NM_002693.2:c.927C>TVOUS08/18/2020
95POLGEx4NM_002693.2:c.948G>Ap.Lys316= | p.K316=LRG_765t1:c.948G>A, NM_001126131.1:c.948G>A, NM_002693.2:c.948G>ABenign06/17/2015 
96POLGEx4NM_002693.2:c.970C>Tp.Pro324Ser | p.P324SLRG_765t1:c.970C>T, NM_001126131.1:c.970C>T, NM_002693.2:c.970C>TVOUS03/12/2019
97POLGEx4NM_002693.2:c.975C>Gp.Pro325= | p.P325=LRG_765t1:c.975C>G, NM_001126131.1:c.975C>G, NM_002693.2:c.975C>GVOUS10/09/2020
98POLGEx4NM_002693.2:c.975C>Ap.Pro325= | p.P325=LRG_765t1:c.975C>A, NM_001126131.1:c.975C>A, NM_002693.2:c.975C>AVOUS05/30/2017
99POLGEx4NM_002693.2:c.983A>Gp.Gln328Arg | p.Q328RLRG_765t1:c.983A>G, NM_001126131.1:c.983A>G, NM_002693.2:c.983A>GVOUS04/18/2016
100POLGEx4NM_002693.2:c.1001G>Ap.Arg334Lys | p.R334KLRG_765t1:c.1001G>A, NM_001126131.1:c.1001G>A, NM_002693.2:c.1001G>AVOUS04/09/2020
101POLGEx4NM_002693.2:c.1023+3G>ALRG_765t1:c.1023+3G>A, NM_001126131.1:c.1023+3G>A, NM_002693.2:c.1023+3G>AVOUS01/27/2017
102POLGEx5NM_002693.2:c.1024-1G>CLRG_765t1:c.1024-1G>C, NM_001126131.1:c.1024-1G>C, NM_002693.2:c.1024-1G>CPathogenic12/20/2017 
103POLGEx5NM_002693.2:c.1066C>Tp.Leu356= | p.L356=LRG_765t1:c.1066C>T, NM_001126131.1:c.1066C>T, NM_002693.2:c.1066C>TVOUS12/22/2020
104POLGEx5NM_002693.2:c.1073delAp.Glu358Glyfs*7 | p.E358GfsX7LRG_765t1:c.1073delA, NM_001126131.1:c.1073delA, NM_002693.2:c.1073delAPathogenic03/13/2018 
105POLGEx5NM_002693.2:c.1097G>Cp.Gly366Ala | p.G366ALRG_765t1:c.1097G>C, NM_001126131.1:c.1097G>C, NM_002693.2:c.1097G>CVOUS09/22/2016
106POLGEx5NM_002693.2:c.1126C>Tp.Leu376= | p.L376=LRG_765t1:c.1126C>T, NM_001126131.1:c.1126C>T, NM_002693.2:c.1126C>TBenign11/24/2015 
107POLGEx5NM_002693.2:c.1156C>Tp.Arg386Cys | p.R386CLRG_765t1:c.1156C>T, NM_001126131.1:c.1156C>T, NM_002693.2:c.1156C>TVOUS01/29/2018
108POLGEx5NM_002693.2:c.1157G>Cp.Arg386Pro | p.R386PLRG_765t1:c.1157G>C, NM_001126131.1:c.1157G>C, NM_002693.2:c.1157G>CVOUS03/21/2019
109POLGEx5NM_002693.2:c.1164C>Tp.Asn388= | p.N388=LRG_765t1:c.1164C>T, NM_001126131.1:c.1164C>T, NM_002693.2:c.1164C>TVOUS04/19/2018
110POLGEx5NM_002693.2:c.1170+6G>TVOUS09/16/2020
111POLGEx6NM_002693.2:c.1171-9T>CLRG_765t1:c.1171-9T>C, NM_001126131.1:c.1171-9T>C, NM_002693.2:c.1171-9T>CVOUS07/26/2016
112POLGEx6NM_002693.2:c.1174C>Gp.Leu392Val | p.L392VLRG_765t1:c.1174C>G, NM_001126131.1:c.1174C>G, NM_002693.2:c.1174C>GLikely benign04/10/2018 
113POLGEx6NM_002693.2:c.1214A>Tp.Glu405Val | p.E405VLRG_765t1:c.1214A>T, NM_001126131.1:c.1214A>T, NM_002693.2:c.1214A>TVOUS10/25/2017
114POLGEx6NM_002693.2:c.1229_1231delAGCp.Gln410del | p.Q410delLRG_765t1:c.1229_1231delAGC, NM_001126131.1:c.1229_1231delAGC, NM_002693.2:c.1229_1231delAGCVOUS02/03/2020
115POLGEx6NM_002693.2:c.1244T>Gp.Leu415Trp | p.L415WLRG_765t1:c.1244T>G, NM_001126131.1:c.1244T>G, NM_002693.2:c.1244T>GVOUS06/18/2020
116POLGEx6NM_002693.2:c.1250+5G>TLRG_765t1:c.1250+5G>T, NM_001126131.1:c.1250+5G>T, NM_002693.2:c.1250+5G>TVOUS04/08/2019
117POLGEx7NM_002693.2:c.1251-6T>CVOUS11/23/2019
118POLGEx7NM_002693.2:c.1251G>Ap.Arg417= | p.R417=LRG_765t1:c.1251G>A, NM_001126131.1:c.1251G>A, NM_002693.2:c.1251G>AVOUS10/02/2017
119POLGEx7NM_002693.2:c.1269T>Ap.Thr423= | p.T423=LRG_765t1:c.1269T>A, NM_001126131.1:c.1269T>A, NM_002693.2:c.1269T>AVOUS09/07/2016
120POLGEx7NM_002693.2:c.1275C>Tp.Ala425= | p.A425=LRG_765t1:c.1275C>T, NM_001126131.1:c.1275C>T, NM_002693.2:c.1275C>TVOUS09/17/2020
121POLGEx7NM_002693.2:c.1276G>Ap.Gly426Ser | p.G426SLRG_765t1:c.1276G>A, NM_001126131.1:c.1276G>A, NM_002693.2:c.1276G>AVOUS03/26/2019
122POLGEx7NM_002693.2:c.1279A>Gp.Met427Val | p.M427VLRG_765t1:c.1279A>G, NM_001126131.1:c.1279A>G, NM_002693.2:c.1279A>GVOUS06/06/2019
123POLGEx7NM_002693.2:c.1283T>Cp.Leu428Pro | p.L428PLRG_765t1:c.1283T>C, NM_001126131.1:c.1283T>C, NM_002693.2:c.1283T>CVOUS03/27/2020
124POLGEx7NM_002693.2:c.1293T>Cp.Gly431= | p.G431=LRG_765t1:c.1293T>C, NM_001126131.1:c.1293T>C, NM_002693.2:c.1293T>CVOUS05/08/2020
125POLGEx7NM_002693.2:c.1306C>Gp.Pro436Ala | p.P436ALRG_765t1:c.1306C>G, NM_001126131.1:c.1306C>G, NM_002693.2:c.1306C>GVOUS12/03/2019
126POLGEx7NM_002693.2:c.1321T>Gp.Trp441Gly | p.W441GLRG_765t1:c.1321T>G, NM_001126131.1:c.1321T>G, NM_002693.2:c.1321T>GVOUS12/14/2017
127POLGEx7NM_002693.2:c.1324G>Ap.Glu442Lys | p.E442KLRG_765t1:c.1324G>A, NM_001126131.1:c.1324G>A, NM_002693.2:c.1324G>AVOUS07/21/2020
128POLGEx7NM_002693.2:c.1356T>Cp.Tyr452= | p.Y452=LRG_765t1:c.1356T>C, NM_001126131.1:c.1356T>C, NM_002693.2:c.1356T>CVOUS09/05/2019
129POLGEx7NM_002693.2:c.1368G>Ap.Gln456= | p.Q456=LRG_765t1:c.1368G>A, NM_001126131.1:c.1368G>A, NM_002693.2:c.1368G>AVOUS03/13/2017
130POLGEx7NM_002693.2:c.1369C>Ap.Arg457= | p.R457=LRG_765t1:c.1369C>A, NM_001126131.1:c.1369C>A, NM_002693.2:c.1369C>AVOUS02/04/2020
131POLGEx7NM_002693.2:c.1386G>Ap.Ser462= | p.S462=LRG_765t1:c.1386G>A, NM_001126131.1:c.1386G>A, NM_002693.2:c.1386G>AVOUS12/29/2020
132POLGEx7NM_002693.2:c.1389G>Ap.Leu463= | p.L463=LRG_765t1:c.1389G>A, NM_001126131.1:c.1389G>A, NM_002693.2:c.1389G>AVOUS07/23/2019
133POLGEx7NM_002693.2:c.1399G>Ap.Ala467Thr | p.A467TLRG_765t1:c.1399G>A, NM_001126131.1:c.1399G>A, NM_002693.2:c.1399G>APathogenic01/31/2020 
134POLGEx7NM_002693.2:c.1402A>Gp.Asn468Asp | p.N468DLRG_765t1:c.1402A>G, NM_001126131.1:c.1402A>G, NM_002693.2:c.1402A>GVOUS01/28/2021
135POLGEx7NM_002693.2:c.1415A>Cp.Gln472Pro | p.Q472PLRG_765t1:c.1415A>C, NM_001126131.1:c.1415A>C, NM_002693.2:c.1415A>CVOUS11/20/2018
136POLGEx7NM_002693.2:c.1420C>Ap.Leu474Ile | p.L474ILRG_765t1:c.1420C>A, NM_001126131.1:c.1420C>A, NM_002693.2:c.1420C>AVOUS06/28/2017
137POLGEx7NM_002693.2:c.1433+1G>APathogenic03/02/2021 
138POLGEx7NM_002693.2:c.1433+5C>TVOUS01/21/2021
139POLGEx8NM_002693.2:c.1449C>Gp.Pro483= | p.P483=LRG_765t1:c.1449C>G, NM_001126131.1:c.1449C>G, NM_002693.2:c.1449C>GVOUS03/01/2021
140POLGEx8NM_002693.2:c.1462C>Tp.Leu488= | p.L488=LRG_765t1:c.1462C>T, NM_001126131.1:c.1462C>T, NM_002693.2:c.1462C>TVOUS12/06/2020
141POLGEx8NM_002693.2:c.1523C>Gp.Ala508Gly | p.A508GLRG_765t1:c.1523C>G, NM_001126131.1:c.1523C>G, NM_002693.2:c.1523C>GVOUS11/04/2019
142POLGEx8NM_002693.2:c.1543A>Cp.Ile515Leu | p.I515LLRG_765t1:c.1543A>C, NM_001126131.1:c.1543A>C, NM_002693.2:c.1543A>CVOUS06/20/2019
143POLGEx8NM_002693.2:c.1545C>Tp.Ile515= | p.I515=LRG_765t1:c.1545C>T, NM_001126131.1:c.1545C>T, NM_002693.2:c.1545C>TVOUS05/02/2017
144POLGEx8NM_002693.2:c.1550G>Tp.Gly517Val | p.G517VLRG_765t1:c.1550G>T, NM_001126131.1:c.1550G>T, NM_002693.2:c.1550G>TBenign09/26/2014 
145POLGEx8NM_002693.2:c.1570C>Gp.Pro524Ala | p.P524ALRG_765t1:c.1570C>G, NM_001126131.1:c.1570C>G, NM_002693.2:c.1570C>GVOUS05/02/2018
146POLGEx8NM_002693.2:c.1580A>Tp.Gln527Leu | p.Q527LLRG_765t1:c.1580A>T, NM_001126131.1:c.1580A>T, NM_002693.2:c.1580A>TVOUS09/13/2017
147POLGEx9NM_002693.2:c.1586-8C>GVOUS07/17/2019
148POLGEx9NM_002693.2:c.1586-5delCNM_001126131.1:c.1586-5delC, NM_002693.2:c.1586-5delCBenign07/25/2014 
149POLGEx9NM_002693.2:c.1590C>Tp.Leu530= | p.L530=LRG_765t1:c.1590C>T, NM_001126131.1:c.1590C>T, NM_002693.2:c.1590C>TVOUS04/16/2019
150POLGEx9NM_002693.2:c.1591G>Ap.Gly531Ser | p.G531SLRG_765t1:c.1591G>A, NM_001126131.1:c.1591G>A, NM_002693.2:c.1591G>AVOUS07/14/2019
151POLGEx9NM_002693.2:c.1612_1613delGAinsTTp.Glu538Leu | p.E538LLRG_765t1:c.1612_1613delinsTT, NM_001126131.1:c.1612_1613delinsTT, NM_002693.2:c.1612_1613delinsTTVOUS07/21/2020
152POLGEx9NM_002693.2:c.1612G>Tp.Glu538* | p.E538XLRG_765t1:c.1612G>T, NM_001126131.1:c.1612G>T, NM_002693.2:c.1612G>TPathogenic07/20/2020 
153POLGEx9NM_002693.2:c.1613A>Tp.Glu538Val | p.E538VLRG_765t1:c.1613A>T, NM_001126131.1:c.1613A>T, NM_002693.2:c.1613A>TVOUS07/20/2020
154POLGEx9NM_002693.2:c.1613A>Cp.Glu538Ala | p.E538ALRG_765t1:c.1613A>C, NM_001126131.1:c.1613A>C, NM_002693.2:c.1613A>CVOUS06/18/2020
155POLGEx9NM_002693.2:c.1620A>Gp.Gln540= | p.Q540=LRG_765t1:c.1620A>G, NM_001126131.1:c.1620A>G, NM_002693.2:c.1620A>GVOUS12/07/2018
156POLGEx9NM_002693.2:c.1626T>Cp.Asp542= | p.D542=LRG_765t1:c.1626T>C, NM_001126131.1:c.1626T>C, NM_002693.2:c.1626T>CVOUS08/29/2017
157POLGEx9NM_002693.2:c.1636C>Gp.Arg546Gly | p.R546GLRG_765t1:c.1636C>G, NM_001126131.1:c.1636C>G, NM_002693.2:c.1636C>GVOUS06/28/2019
158POLGEx9NM_002693.2:c.1637G>Ap.Arg546His | p.R546HLRG_765t1:c.1637G>A, NM_001126131.1:c.1637G>A, NM_002693.2:c.1637G>AVOUS01/23/2017
159POLGEx9NM_002693.2:c.1639G>Ap.Ala547Thr | p.A547TLRG_765t1:c.1639G>A, NM_001126131.1:c.1639G>A, NM_002693.2:c.1639G>AVOUS10/11/2017
160POLGEx9NM_002693.2:c.1648C>Gp.Gln550Glu | p.Q550ELRG_765t1:c.1648C>G, NM_001126131.1:c.1648C>G, NM_002693.2:c.1648C>GVOUS01/04/2017
161POLGEx9NM_002693.2:c.1669G>Cp.Glu557Gln | p.E557QLRG_765t1:c.1669G>C, NM_001126131.1:c.1669G>C, NM_002693.2:c.1669G>CVOUS08/22/2017
162POLGEx9NM_002693.2:c.1684C>Tp.Arg562Trp | p.R562WLRG_765t1:c.1684C>T, NM_001126131.1:c.1684C>T, NM_002693.2:c.1684C>TVOUS08/17/2020
163POLGEx9NM_002693.2:c.1712+5G>ALRG_765t1:c.1712+5G>A, NM_001126131.1:c.1712+5G>A, NM_002693.2:c.1712+5G>AVOUS10/02/2017
164POLGEx10NM_002693.2:c.1713-5C>TLRG_765t1:c.1713-5C>T, NM_001126131.1:c.1713-5C>T, NM_002693.2:c.1713-5C>TVOUS10/10/2018
165POLGEx10NM_002693.2:c.1723A>Cp.Lys575Gln | p.K575QLRG_765t1:c.1723A>C, NM_001126131.1:c.1723A>C, NM_002693.2:c.1723A>CVOUS07/07/2017
166POLGEx10NM_002693.2:c.1729T>Cp.Cys577Arg | p.C577RLRG_765t1:c.1729T>C, NM_001126131.1:c.1729T>C, NM_002693.2:c.1729T>CVOUS11/30/2020
167POLGEx10NM_002693.2:c.1736G>Ap.Arg579Gln | p.R579QLRG_765t1:c.1736G>A, NM_001126131.1:c.1736G>A, NM_002693.2:c.1736G>AVOUS09/20/2019
168POLGEx10NM_002693.2:c.1743C>Tp.Asp581= | p.D581=LRG_765t1:c.1743C>T, NM_001126131.1:c.1743C>T, NM_002693.2:c.1743C>TLikely benign06/20/2019 
169POLGEx10NM_002693.2:c.1752A>Cp.Ala584= | p.A584=LRG_765t1:c.1752A>C, NM_001126131.1:c.1752A>C, NM_002693.2:c.1752A>CVOUS08/09/2019
170POLGEx10NM_002693.2:c.1760C>Tp.Pro587Leu | p.P587LLRG_765t1:c.1760C>T, NM_001126131.1:c.1760C>T, NM_002693.2:c.1760C>TPathogenic12/31/2020 
171POLGEx10NM_002693.2:c.1761G>Ap.Pro587= | p.P587=VOUS12/26/2019
172POLGEx10NM_002693.2:c.1763G>Ap.Gly588Asp | p.G588DLRG_765t1:c.1763G>A, NM_001126131.1:c.1763G>A, NM_002693.2:c.1763G>AVOUS01/10/2017
173POLGEx10NM_002693.2:c.1764C>Tp.Gly588= | p.G588=LRG_765t1:c.1764C>T, NM_001126131.1:c.1764C>T, NM_002693.2:c.1764C>TVOUS01/28/2021
174POLGEx10NM_002693.2:c.1782G>Ap.Leu594= | p.L594=LRG_765t1:c.1782G>A, NM_001126131.1:c.1782G>A, NM_002693.2:c.1782G>AVOUS05/19/2017
175POLGEx10NM_002693.2:c.1789C>Tp.Arg597Trp | p.R597WLRG_765t1:c.1789C>T, NM_001126131.1:c.1789C>T, NM_002693.2:c.1789C>TPathogenic12/07/2016 
176POLGEx10NM_002693.2:c.1837C>Tp.His613Tyr | p.H613YNM_001126131.1:c.1837C>T, NM_002693.2:c.1837C>TBenign04/02/2015 
177POLGEx10NM_002693.2:c.1842C>Tp.Tyr614= | p.Y614=LRG_765t1:c.1842C>T, NM_001126131.1:c.1842C>T, NM_002693.2:c.1842C>TVOUS12/09/2020
178POLGEx10NM_002693.2:c.1850G>Ap.Arg617His | p.R617HLRG_765t1:c.1850G>A, NM_001126131.1:c.1850G>A, NM_002693.2:c.1850G>AVOUS01/12/2018
179POLGEx10NM_002693.2:c.1857C>Tp.Gly619= | p.G619=LRG_765t1:c.1857C>T, NM_001126131.1:c.1857C>T, NM_002693.2:c.1857C>TVOUS07/28/2020
180POLGEx10NM_002693.2:c.1880G>Ap.Arg627Gln | p.R627QLRG_765t1:c.1880G>A, NM_001126131.1:c.1880G>A, NM_002693.2:c.1880G>APathogenic02/10/2020 
181POLGEx10NM_002693.2:c.1886A>Cp.Asp629Ala | p.D629ALRG_765t1:c.1886A>C, NM_001126131.1:c.1886A>C, NM_002693.2:c.1886A>CVOUS03/06/2019
182POLGEx10NM_002693.2:c.1890C>Tp.Asn630= | p.N630=LRG_765t1:c.1890C>T, NM_001126131.1:c.1890C>T, NM_002693.2:c.1890C>TLikely benign09/20/2017 
183POLGEx10NM_002693.2:c.1894G>Ap.Ala632Thr | p.A632TLRG_765t1:c.1894G>A, NM_001126131.1:c.1894G>A, NM_002693.2:c.1894G>AVOUS07/03/2018
184POLGEx10NM_002693.2:c.1898A>Cp.Lys633Thr | p.K633TLRG_765t1:c.1898A>C, NM_001126131.1:c.1898A>C, NM_002693.2:c.1898A>CVOUS01/04/2021
185POLGEx10NM_002693.2:c.1904C>Tp.Pro635Leu | p.P635LLRG_765t1:c.1904C>T, NM_001126131.1:c.1904C>T, NM_002693.2:c.1904C>TVOUS06/08/2020
186POLGEx10NM_002693.2:c.1905G>Ap.Pro635= | p.P635=LRG_765t1:c.1905G>A, NM_001126131.1:c.1905G>A, NM_002693.2:c.1905G>AVOUS05/06/2019
187POLGEx10NM_002693.2:c.1905G>Tp.Pro635= | p.P635=LRG_765t1:c.1905G>T, NM_001126131.1:c.1905G>T, NM_002693.2:c.1905G>TVOUS07/20/2017
188POLGEx10NM_002693.2:c.1912A>Gp.Thr638Ala | p.T638ALRG_765t1:c.1912A>G, NM_001126131.1:c.1912A>G, NM_002693.2:c.1912A>GVOUS08/15/2017
189POLGEx10NM_002693.2:c.1929T>Cp.Ala643= | p.A643=LRG_765t1:c.1929T>C, NM_001126131.1:c.1929T>C, NM_002693.2:c.1929T>CVOUS04/20/2018
190POLGEx11NM_002693.2:c.1950-10C>TLRG_765t1:c.1950-10C>T, NM_001126131.1:c.1950-10C>T, NM_002693.2:c.1950-10C>TVOUS01/17/2017
191POLGEx11NM_002693.2:c.1950-9T>CVOUS01/02/2020
192POLGEx11NM_002693.2:c.1950-6G>AVOUS09/28/2019
193POLGEx11NM_002693.2:c.1956C>Tp.Ile652= | p.I652=NM_001126131.1:c.1956C>T, NM_002693.2:c.1956C>TVOUS05/12/2015
194POLGEx11NM_002693.2:c.1977C>Tp.His659= | p.H659=LRG_765t1:c.1977C>T, NM_001126131.1:c.1977C>T, NM_002693.2:c.1977C>TVOUS08/20/2020
195POLGEx11NM_002693.2:c.1980T>Cp.Cys660= | p.C660=LRG_765t1:c.1980T>C, NM_001126131.1:c.1980T>C, NM_002693.2:c.1980T>CVOUS02/10/2018
196POLGEx11NM_002693.2:c.1983C>Tp.Leu661= | p.L661=LRG_765t1:c.1983C>T, NM_001126131.1:c.1983C>T, NM_002693.2:c.1983C>TVOUS10/05/2020
197POLGEx11NM_002693.2:c.1984G>Ap.Glu662Lys | p.E662KNM_001126131.1:c.1984G>A, NM_002693.2:c.1984G>ABenign07/05/2013 
198POLGEx11NM_002693.2:c.1991G>Ap.Gly664Glu | p.G664ELRG_765t1:c.1991G>A, NM_001126131.1:c.1991G>A, NM_002693.2:c.1991G>AVOUS02/12/2020
199POLGEx11NM_002693.2:c.2019C>Tp.Ala673= | p.A673=NM_001126131.1:c.2019C>T, NM_002693.2:c.2019C>TVOUS12/22/2015
200POLGEx11NM_002693.2:c.2021G>Ap.Gly674Asp | p.G674DLRG_765t1:c.2021G>A, NM_001126131.1:c.2021G>A, NM_002693.2:c.2021G>ALikely benign12/26/2019 
201POLGEx11NM_002693.2:c.2026G>Ap.Ala676Thr | p.A676TLRG_765t1:c.2026G>A, NM_001126131.1:c.2026G>A, NM_002693.2:c.2026G>AVOUS02/20/2018
202POLGEx11NM_002693.2:c.2027C>Tp.Ala676Val | p.A676VLRG_765t1:c.2027C>T, NM_001126131.1:c.2027C>T, NM_002693.2:c.2027C>TVOUS05/30/2018
203POLGEx11NM_002693.2:c.2028G>Ap.Ala676= | p.A676=LRG_765t1:c.2028G>A, NM_001126131.1:c.2028G>A, NM_002693.2:c.2028G>AVOUS10/30/2019
204POLGEx11NM_002693.2:c.2040G>Ap.Leu680= | p.L680=LRG_765t1:c.2040G>A, NM_001126131.1:c.2040G>A, NM_002693.2:c.2040G>AVOUS02/04/2019
205POLGEx11NM_002693.2:c.2045C>Gp.Thr682Ser | p.T682SLRG_765t1:c.2045C>G, NM_001126131.1:c.2045C>G, NM_002693.2:c.2045C>GVOUS12/20/2018
206POLGEx11NM_002693.2:c.2050A>Cp.Asn684His | p.N684HVOUS02/10/2021
207POLGEx11NM_002693.2:c.2061A>Gp.Ile687Met | p.I687MLRG_765t1:c.2061A>G, NM_001126131.1:c.2061A>G, NM_002693.2:c.2061A>GVOUS10/05/2020
208POLGEx12NM_002693.2:c.2085T>Gp.Asp695Glu | p.D695ELRG_765t1:c.2085T>G, NM_001126131.1:c.2085T>G, NM_002693.2:c.2085T>GVOUS03/09/2018
209POLGEx12NM_002693.2:c.2125C>Tp.Arg709* | p.R709XLRG_765t1:c.2125C>T, NM_001126131.1:c.2125C>T, NM_002693.2:c.2125C>TPathogenic08/16/2019 
210POLGEx12NM_002693.2:c.2133A>Gp.Ala711= | p.A711=LRG_765t1:c.2133A>G, NM_001126131.1:c.2133A>G, NM_002693.2:c.2133A>GVOUS12/05/2017
211POLGEx12NM_002693.2:c.2145A>Tp.Gln715His | p.Q715HLRG_765t1:c.2145A>T, NM_001126131.1:c.2145A>T, NM_002693.2:c.2145A>TVOUS11/06/2019
212POLGEx12NM_002693.2:c.2146C>Tp.Pro716Ser | p.P716SLRG_765t1:c.2146C>T, NM_001126131.1:c.2146C>T, NM_002693.2:c.2146C>TVOUS03/22/2018
213POLGEx12NM_002693.2:c.2149C>Tp.Leu717= | p.L717=LRG_765t1:c.2149C>T, NM_001126131.1:c.2149C>T, NM_002693.2:c.2149C>TVOUS01/02/2020
214POLGEx12NM_002693.2:c.2152G>Tp.Ala718Ser | p.A718SLRG_765t1:c.2152G>T, NM_001126131.1:c.2152G>T, NM_002693.2:c.2152G>TVOUS10/18/2017
215POLGEx13NM_002693.2:c.2158-10G>ALRG_765t1:c.2158-10G>A, NM_001126131.1:c.2158-10G>A, NM_002693.2:c.2158-10G>AVOUS01/25/2017
216POLGEx13NM_002693.2:c.2164C>Tp.Arg722Cys | p.R722CLRG_765t1:c.2164C>T, NM_001126131.1:c.2164C>T, NM_002693.2:c.2164C>TVOUS08/26/2019
217POLGEx13NM_002693.2:c.2165G>Ap.Arg722His | p.R722HLRG_765t1:c.2165G>A, NM_001126131.1:c.2165G>A, NM_002693.2:c.2165G>ALikely benign11/20/2017 
218POLGEx13NM_002693.2:c.2177A>Gp.Lys726Arg | p.K726RLRG_765t1:c.2177A>G, NM_001126131.1:c.2177A>G, NM_002693.2:c.2177A>GVOUS03/25/2020
219POLGEx13NM_002693.2:c.2202T>Cp.His734= | p.H734=LRG_765t1:c.2202T>C, NM_001126131.1:c.2202T>C, NM_002693.2:c.2202T>CVOUS12/02/2020
220POLGEx13NM_002693.2:c.2207A>Gp.Asn736Ser | p.N736SLRG_765t1:c.2207A>G, NM_001126131.1:c.2207A>G, NM_002693.2:c.2207A>GVOUS02/15/2021
221POLGEx13NM_002693.2:c.2209G>Cp.Gly737Arg | p.G737RLRG_765t1:c.2209G>C, NM_001126131.1:c.2209G>C, NM_002693.2:c.2209G>CPathogenic08/18/2020 
222POLGEx13NM_002693.2:c.2209G>Ap.Gly737Arg | p.G737RLRG_765t1:c.2209G>A, NM_001126131.1:c.2209G>A, NM_002693.2:c.2209G>AVOUS10/16/2017
223POLGEx13NM_002693.2:c.2215T>Cp.Tyr739His | p.Y739HLRG_765t1:c.2215T>C, NM_001126131.1:c.2215T>C, NM_002693.2:c.2215T>CVOUS01/08/2019
224POLGEx13NM_002693.2:c.2217_2230dupCAACGACGTGGACALRG_765t1:c.2217_2230dupCAACGACGTGGACA, NM_001126131.1:c.2217_2230dupCAACGACGTGGACA, NM_002693.2:c.2217_2230dupCAACGACGTGGACAPathogenic01/20/2020 
225POLGEx13NM_002693.2:c.2218A>Gp.Asn740Asp | p.N740DLRG_765t1:c.2218A>G, NM_001126131.1:c.2218A>G, NM_002693.2:c.2218A>GVOUS06/28/2019
226POLGEx13NM_002693.2:c.2220C>Tp.Asn740= | p.N740=LRG_765t1:c.2220C>T, NM_001126131.1:c.2220C>T, NM_002693.2:c.2220C>TVOUS01/03/2020
227POLGEx13NM_002693.2:c.2221G>Ap.Asp741Asn | p.D741NLRG_765t1:c.2221G>A, NM_001126131.1:c.2221G>A, NM_002693.2:c.2221G>AVOUS08/18/2020
228POLGEx13NM_002693.2:c.2243G>Cp.Trp748Ser | p.W748SLRG_765t1:c.2243G>C, NM_001126131.1:c.2243G>C, NM_002693.2:c.2243G>CPathogenic04/13/2020 
229POLGEx13NM_002693.2:c.2246T>Cp.Phe749Ser | p.F749SLRG_765t1:c.2246T>C, NM_001126131.1:c.2246T>C, NM_002693.2:c.2246T>CVOUS10/21/2020
230POLGEx13NM_002693.2:c.2259T>Gp.Pro753= | p.P753=LRG_765t1:c.2259T>G, NM_001126131.1:c.2259T>G, NM_002693.2:c.2259T>GVOUS06/14/2019
231POLGEx13NM_002693.2:c.2264A>Cp.Lys755Thr | p.K755TLRG_765t1:c.2264A>C, NM_001126131.1:c.2264A>C, NM_002693.2:c.2264A>CVOUS05/09/2017
232POLGEx14NM_002693.2:c.2266-8C>TVOUS02/24/2020
233POLGEx14NM_002693.2:c.2277C>Tp.Ser759= | p.S759=LRG_765t1:c.2277C>T, NM_001126131.1:c.2277C>T, NM_002693.2:c.2277C>TVOUS04/12/2018
234POLGEx14NM_002693.2:c.2279G>Ap.Cys760Tyr | p.C760YLRG_765t1:c.2279G>A, NM_001126131.1:c.2279G>A, NM_002693.2:c.2279G>AVOUS12/22/2020
235POLGEx14NM_002693.2:c.2354G>Ap.Gly785Asp | p.G785DLRG_765t1:c.2354G>A, NM_001126131.1:c.2354G>A, NM_002693.2:c.2354G>AVOUS06/05/2020
236POLGEx14NM_002693.2:c.2368C>Tp.Arg790Cys | p.R790CLRG_765t1:c.2368C>T, NM_001126131.1:c.2368C>T, NM_002693.2:c.2368C>TVOUS02/18/2021
237POLGEx14NM_002693.2:c.2369G>Ap.Arg790His | p.R790HLRG_765t1:c.2369G>A, NM_001126131.1:c.2369G>A, NM_002693.2:c.2369G>AVOUS12/29/2020
238POLGEx14NM_002693.2:c.2387A>Gp.Lys796Arg | p.K796RLRG_765t1:c.2387A>G, NM_001126131.1:c.2387A>G, NM_002693.2:c.2387A>GVOUS01/10/2019
239POLGEx15NM_002693.2:c.2468G>Ap.Arg823His | p.R823HLRG_500t1:c.*5515C>T, LRG_765t1:c.2468G>A, NM_001113378.1:c.*5515C>T, NM_001126131.1:c.2468G>A, NM_002693.2:c.2468G>A, NM_018193.2:c.*5515C>TVOUS06/04/2020
240POLGEx15NM_002693.2:c.2473G>Ap.Val825Met | p.V825MLRG_500t1:c.*5510C>T, LRG_765t1:c.2473G>A, NM_001113378.1:c.*5510C>T, NM_001126131.1:c.2473G>A, NM_002693.2:c.2473G>A, NM_018193.2:c.*5510C>TVOUS12/31/2020
241POLGEx16NM_002693.2:c.2481-10A>CLRG_500t1:c.*5404T>G, LRG_765t1:c.2481-10A>C, NM_001113378.1:c.*5404T>G, NM_001126131.1:c.2481-10A>C, NM_002693.2:c.2481-10A>C, NM_018193.2:c.*5404T>GVOUS06/04/2020
242POLGEx16NM_002693.2:c.2481-7C>TLRG_500t1:c.*5401G>A, NM_001113378.1:c.*5401G>A, NM_001126131.1:c.2481-7C>T, NM_002693.2:c.2481-7C>T, NM_018193.2:c.*5401G>ALikely benign03/19/2019 
243POLGEx16NM_002693.2:c.2487C>Tp.Pro829= | p.P829=LRG_500t1:c.*5388G>A, LRG_765t1:c.2487C>T, NM_001113378.1:c.*5388G>A, NM_001126131.1:c.2487C>T, NM_002693.2:c.2487C>T, NM_018193.2:c.*5388G>AVOUS11/27/2018
244POLGEx16NM_002693.2:c.2488G>Ap.Asp830Asn | p.D830NLRG_500t1:c.*5387C>T, LRG_765t1:c.2488G>A, NM_001113378.1:c.*5387C>T, NM_001126131.1:c.2488G>A, NM_002693.2:c.2488G>A, NM_018193.2:c.*5387C>TVOUS02/04/2020
245POLGEx16NM_002693.2:c.2492A>Gp.Tyr831Cys | p.Y831CLRG_500t1:c.*5383T>C, NM_001113378.1:c.*5383T>C, NM_001126131.1:c.2492A>G, NM_002693.2:c.2492A>G, NM_018193.2:c.*5383T>CLikely benign12/23/2014 
246POLGEx16NM_002693.2:c.2496T>Gp.Asp832Glu | p.D832ELRG_500t1:c.*5379A>C, LRG_765t1:c.2496T>G, NM_001113378.1:c.*5379A>C, NM_001126131.1:c.2496T>G, NM_002693.2:c.2496T>G, NM_018193.2:c.*5379A>CVOUS03/06/2019
247POLGEx16NM_002693.2:c.2529A>Gp.Gln843= | p.Q843=LRG_500t1:c.*5346T>C, LRG_765t1:c.2529A>G, NM_001113378.1:c.*5346T>C, NM_001126131.1:c.2529A>G, NM_002693.2:c.2529A>G, NM_018193.2:c.*5346T>CVOUS01/20/2021
248POLGEx16NM_002693.2:c.2541C>Tp.Ala847= | p.A847=LRG_500t1:c.*5334G>A, LRG_765t1:c.2541C>T, NM_001113378.1:c.*5334G>A, NM_001126131.1:c.2541C>T, NM_002693.2:c.2541C>T, NM_018193.2:c.*5334G>AVOUS03/11/2021
249POLGEx16NM_002693.2:c.2542G>Ap.Gly848Ser | p.G848SLRG_500t1:c.*5333C>T, LRG_765t1:c.2542G>A, NM_001113378.1:c.*5333C>T, NM_001126131.1:c.2542G>A, NM_002693.2:c.2542G>A, NM_018193.2:c.*5333C>TPathogenic02/26/2021 
250POLGEx16NM_002693.2:c.2554C>Tp.Arg852Cys | p.R852CLRG_500t1:c.*5321G>A, LRG_765t1:c.2554C>T, NM_001113378.1:c.*5321G>A, NM_001126131.1:c.2554C>T, NM_002693.2:c.2554C>T, NM_018193.2:c.*5321G>APathogenic11/15/2018 
251POLGEx16NM_002693.2:c.2557C>Tp.Arg853Trp | p.R853WLRG_500t1:c.*5318G>A, LRG_765t1:c.2557C>T, NM_001113378.1:c.*5318G>A, NM_001126131.1:c.2557C>T, NM_002693.2:c.2557C>T, NM_018193.2:c.*5318G>APathogenic11/05/2019 
252POLGEx16NM_002693.2:c.2593G>Tp.Ala865Ser | p.A865SLRG_500t1:c.*5282C>A, LRG_765t1:c.2593G>T, NM_001113378.1:c.*5282C>A, NM_001126131.1:c.2593G>T, NM_002693.2:c.2593G>T, NM_018193.2:c.*5282C>AVOUS03/27/2019
253POLGEx16NM_002693.2:c.2596C>Ap.Arg866= | p.R866=LRG_500t1:c.*5279G>T, LRG_765t1:c.2596C>A, NM_001113378.1:c.*5279G>T, NM_001126131.1:c.2596C>A, NM_002693.2:c.2596C>A, NM_018193.2:c.*5279G>TVOUS02/02/2021
254POLGEx16NM_002693.2:c.2596C>Tp.Arg866Trp | p.R866WLRG_500t1:c.*5279G>A, LRG_765t1:c.2596C>T, NM_001113378.1:c.*5279G>A, NM_001126131.1:c.2596C>T, NM_002693.2:c.2596C>T, NM_018193.2:c.*5279G>AVOUS06/08/2017
255POLGEx17NM_002693.2:c.2599-10C>TLRG_500t1:c.*4811G>A, LRG_765t1:c.2599-10C>T, NM_001113378.1:c.*4811G>A, NM_001126131.1:c.2599-10C>T, NM_002693.2:c.2599-10C>T, NM_018193.2:c.*4811G>A, XM_005254946.1:c.*4811G>A, XM_005254947.1:c.*4811G>A, XM_005254948.1:c.*4811G>A, XM_005254949.1:c.*4811G>A, XM_005254950.1:c.*4811G>A, XM_005254951.1:c.*4811G>A, XM_005254952.1:c.*4811G>A, XM_005254953.1:c.*4811G>A, XR_243211.1:n.*4787G>A, XR_243212.1:n.*4787G>AVOUS05/07/2019
256POLGEx17NM_002693.2:c.2601T>Cp.Pro867= | p.P867=LRG_500t1:c.*4799A>G, LRG_765t1:c.2601T>C, NM_001113378.1:c.*4799A>G, NM_001126131.1:c.2601T>C, NM_002693.2:c.2601T>C, NM_018193.2:c.*4799A>G, XM_005254946.1:c.*4799A>G, XM_005254947.1:c.*4799A>G, XM_005254948.1:c.*4799A>G, XM_005254949.1:c.*4799A>G, XM_005254950.1:c.*4799A>G, XM_005254951.1:c.*4799A>G, XM_005254952.1:c.*4799A>G, XM_005254953.1:c.*4799A>G, XR_243211.1:n.*4775A>G, XR_243212.1:n.*4775A>GVOUS08/22/2019
257POLGEx17NM_002693.2:c.2620T>Ap.Leu874Met | p.L874MLRG_500t1:c.*4780A>T, LRG_765t1:c.2620T>A, NM_001113378.1:c.*4780A>T, NM_001126131.1:c.2620T>A, NM_002693.2:c.2620T>A, NM_018193.2:c.*4780A>T, XM_005254946.1:c.*4780A>T, XM_005254947.1:c.*4780A>T, XM_005254948.1:c.*4780A>T, XM_005254949.1:c.*4780A>T, XM_005254950.1:c.*4780A>T, XM_005254951.1:c.*4780A>T, XM_005254952.1:c.*4780A>T, XM_005254953.1:c.*4780A>T, XR_243211.1:n.*4756A>T, XR_243212.1:n.*4756A>TVOUS12/28/2020
258POLGEx17NM_002693.2:c.2632G>Tp.Val878Leu | p.V878LLRG_500t1:c.*4768C>A, LRG_765t1:c.2632G>T, NM_001113378.1:c.*4768C>A, NM_001126131.1:c.2632G>T, NM_002693.2:c.2632G>T, NM_018193.2:c.*4768C>A, XM_005254946.1:c.*4768C>A, XM_005254947.1:c.*4768C>A, XM_005254948.1:c.*4768C>A, XM_005254949.1:c.*4768C>A, XM_005254950.1:c.*4768C>A, XM_005254951.1:c.*4768C>A, XM_005254952.1:c.*4768C>A, XM_005254953.1:c.*4768C>A, XR_243211.1:n.*4744C>A, XR_243212.1:n.*4744C>AVOUS06/10/2016
259POLGEx17NM_002693.2:c.2636A>Gp.Gln879Arg | p.Q879RLRG_500t1:c.*4764T>C, LRG_765t1:c.2636A>G, NM_001113378.1:c.*4764T>C, NM_001126131.1:c.2636A>G, NM_002693.2:c.2636A>G, NM_018193.2:c.*4764T>C, XM_005254946.1:c.*4764T>C, XM_005254947.1:c.*4764T>C, XM_005254948.1:c.*4764T>C, XM_005254949.1:c.*4764T>C, XM_005254950.1:c.*4764T>C, XM_005254951.1:c.*4764T>C, XM_005254952.1:c.*4764T>C, XM_005254953.1:c.*4764T>C, XR_243211.1:n.*4740T>C, XR_243212.1:n.*4740T>CVOUS07/29/2019
260POLGEx17NM_002693.2:c.2642C>Tp.Pro881Leu | p.P881LLRG_500t1:c.*4758G>A, LRG_765t1:c.2642C>T, NM_001113378.1:c.*4758G>A, NM_001126131.1:c.2642C>T, NM_002693.2:c.2642C>T, NM_018193.2:c.*4758G>A, XM_005254946.1:c.*4758G>A, XM_005254947.1:c.*4758G>A, XM_005254948.1:c.*4758G>A, XM_005254949.1:c.*4758G>A, XM_005254950.1:c.*4758G>A, XM_005254951.1:c.*4758G>A, XM_005254952.1:c.*4758G>A, XM_005254953.1:c.*4758G>A, XR_243211.1:n.*4734G>A, XR_243212.1:n.*4734G>AVOUS12/21/2020
261POLGEx17NM_002693.2:c.2653A>Gp.Thr885Ala | p.T885ALRG_500t1:c.*4747T>C, LRG_765t1:c.2653A>G, NM_001113378.1:c.*4747T>C, NM_001126131.1:c.2653A>G, NM_002693.2:c.2653A>G, NM_018193.2:c.*4747T>C, XM_005254946.1:c.*4747T>C, XM_005254947.1:c.*4747T>C, XM_005254948.1:c.*4747T>C, XM_005254949.1:c.*4747T>C, XM_005254950.1:c.*4747T>C, XM_005254951.1:c.*4747T>C, XM_005254952.1:c.*4747T>C, XM_005254953.1:c.*4747T>C, XR_243211.1:n.*4723T>C, XR_243212.1:n.*4723T>CVOUS05/23/2018
262POLGEx17NM_002693.2:c.2704C>Gp.Leu902Val | p.L902VLRG_500t1:c.*4696G>C, LRG_765t1:c.2704C>G, NM_001113378.1:c.*4696G>C, NM_001126131.1:c.2704C>G, NM_002693.2:c.2704C>G, NM_018193.2:c.*4696G>C, XM_005254946.1:c.*4696G>C, XM_005254947.1:c.*4696G>C, XM_005254948.1:c.*4696G>C, XM_005254949.1:c.*4696G>C, XM_005254950.1:c.*4696G>C, XM_005254951.1:c.*4696G>C, XM_005254952.1:c.*4696G>C, XM_005254953.1:c.*4696G>C, XR_243211.1:n.*4672G>C, XR_243212.1:n.*4672G>CVOUS09/22/2020
263POLGEx17NM_002693.2:c.2713G>Ap.Ala905Thr | p.A905TLRG_500t1:c.*4687C>T, LRG_765t1:c.2713G>A, NM_001113378.1:c.*4687C>T, NM_001126131.1:c.2713G>A, NM_002693.2:c.2713G>A, NM_018193.2:c.*4687C>T, XM_005254946.1:c.*4687C>T, XM_005254947.1:c.*4687C>T, XM_005254948.1:c.*4687C>T, XM_005254949.1:c.*4687C>T, XM_005254950.1:c.*4687C>T, XM_005254951.1:c.*4687C>T, XM_005254952.1:c.*4687C>T, XM_005254953.1:c.*4687C>T, XR_243211.1:n.*4663C>T, XR_243212.1:n.*4663C>TVOUS11/07/2018
264POLGEx17NM_002693.2:c.2724C>Tp.Ala908= | p.A908=NM_001113378.1:c.*4676G>A, NM_001126131.1:c.2724C>T, NM_002693.2:c.2724C>T, NM_018193.2:c.*4676G>A, XM_005254946.1:c.*4676G>A, XM_005254947.1:c.*4676G>A, XM_005254948.1:c.*4676G>A, XM_005254949.1:c.*4676G>A, XM_005254950.1:c.*4676G>A, XM_005254951.1:c.*4676G>A, XM_005254952.1:c.*4676G>A, XM_005254953.1:c.*4676G>A, XR_243211.1:n.*4652G>A, XR_243212.1:n.*4652G>AVOUS01/04/2015
265POLGEx17NM_002693.2:c.2733T>Gp.His911Gln | p.H911QLRG_500t1:c.*4667A>C, LRG_765t1:c.2733T>G, NM_001113378.1:c.*4667A>C, NM_001126131.1:c.2733T>G, NM_002693.2:c.2733T>G, NM_018193.2:c.*4667A>C, XM_005254946.1:c.*4667A>C, XM_005254947.1:c.*4667A>C, XM_005254948.1:c.*4667A>C, XM_005254949.1:c.*4667A>C, XM_005254950.1:c.*4667A>C, XM_005254951.1:c.*4667A>C, XM_005254952.1:c.*4667A>C, XM_005254953.1:c.*4667A>C, XR_243211.1:n.*4643A>C, XR_243212.1:n.*4643A>CVOUS12/27/2016
266POLGEx18NM_002693.2:c.2735-7C>GLRG_500t1:c.*4560G>C, LRG_765t1:c.2735-7C>G, NM_001113378.1:c.*4560G>C, NM_001126131.1:c.2735-7C>G, NM_002693.2:c.2735-7C>G, NM_018193.2:c.*4560G>C, XM_005254946.1:c.*4560G>C, XM_005254947.1:c.*4560G>C, XM_005254948.1:c.*4560G>C, XM_005254949.1:c.*4560G>C, XM_005254950.1:c.*4560G>C, XM_005254951.1:c.*4560G>C, XM_005254952.1:c.*4560G>C, XM_005254953.1:c.*4560G>C, XR_243211.1:n.*4536G>C, XR_243212.1:n.*4536G>CLikely benign01/16/2020 
267POLGEx18NM_002693.2:c.2739C>Tp.Cys913= | p.C913=LRG_500t1:c.*4549G>A, LRG_765t1:c.2739C>T, NM_001113378.1:c.*4549G>A, NM_001126131.1:c.2739C>T, NM_002693.2:c.2739C>T, NM_018193.2:c.*4549G>A, XM_005254946.1:c.*4549G>A, XM_005254947.1:c.*4549G>A, XM_005254948.1:c.*4549G>A, XM_005254949.1:c.*4549G>A, XM_005254950.1:c.*4549G>A, XM_005254951.1:c.*4549G>A, XM_005254952.1:c.*4549G>A, XM_005254953.1:c.*4549G>A, XR_243211.1:n.*4525G>A, XR_243212.1:n.*4525G>AVOUS09/27/2016
268POLGEx18NM_002693.2:c.2740A>Cp.Thr914Pro | p.T914PLRG_500t1:c.*4548T>G, LRG_765t1:c.2740A>C, NM_001113378.1:c.*4548T>G, NM_001126131.1:c.2740A>C, NM_002693.2:c.2740A>C, NM_018193.2:c.*4548T>G, XM_005254946.1:c.*4548T>G, XM_005254947.1:c.*4548T>G, XM_005254948.1:c.*4548T>G, XM_005254949.1:c.*4548T>G, XM_005254950.1:c.*4548T>G, XM_005254951.1:c.*4548T>G, XM_005254952.1:c.*4548T>G, XM_005254953.1:c.*4548T>G, XR_243211.1:n.*4524T>G, XR_243212.1:n.*4524T>GPathogenic11/08/2019 
269POLGEx18NM_002693.2:c.2757_2758delGAinsTTp.Met919_Thr920delinsIleSer | p.M919_T920delinsISLRG_500t1:c.*4530_*4531delinsAA, LRG_765t1:c.2757_2758delinsTT, NM_001113378.1:c.*4530_*4531delinsAA, NM_001126131.1:c.2757_2758delinsTT, NM_002693.2:c.2757_2758delinsTT, NM_018193.2:c.*4530_*4531delinsAA, XM_005254946.1:c.*4530_*4531delinsAA, XM_005254947.1:c.*4530_*4531delinsAA, XM_005254948.1:c.*4530_*4531delinsAA, XM_005254949.1:c.*4530_*4531delinsAA, XM_005254950.1:c.*4530_*4531delinsAA, XM_005254951.1:c.*4530_*4531delinsAA, XM_005254952.1:c.*4530_*4531delinsAA, XM_005254953.1:c.*4530_*4531delinsAA, XR_243211.1:n.*4506_*4507delinsAA, XR_243212.1:n.*4506_*4507delinsAAVOUS02/04/2021
270POLGEx18NM_002693.2:c.2788G>Ap.Asp930Asn | p.D930NLRG_500t1:c.*4500C>T, LRG_765t1:c.2788G>A, NM_001113378.1:c.*4500C>T, NM_001126131.1:c.2788G>A, NM_002693.2:c.2788G>A, NM_018193.2:c.*4500C>T, XM_005254946.1:c.*4500C>T, XM_005254947.1:c.*4500C>T, XM_005254948.1:c.*4500C>T, XM_005254949.1:c.*4500C>T, XM_005254950.1:c.*4500C>T, XM_005254951.1:c.*4500C>T, XM_005254952.1:c.*4500C>T, XM_005254953.1:c.*4500C>T, XR_243211.1:n.*4476C>T, XR_243212.1:n.*4476C>TVOUS09/17/2020
271POLGEx18NM_002693.2:c.2799T>Gp.Ser933Arg | p.S933RLRG_500t1:c.*4489A>C, LRG_765t1:c.2799T>G, NM_001113378.1:c.*4489A>C, NM_001126131.1:c.2799T>G, NM_002693.2:c.2799T>G, NM_018193.2:c.*4489A>C, XM_005254946.1:c.*4489A>C, XM_005254947.1:c.*4489A>C, XM_005254948.1:c.*4489A>C, XM_005254949.1:c.*4489A>C, XM_005254950.1:c.*4489A>C, XM_005254951.1:c.*4489A>C, XM_005254952.1:c.*4489A>C, XM_005254953.1:c.*4489A>C, XR_243211.1:n.*4465A>C, XR_243212.1:n.*4465A>CVOUS11/11/2019
272POLGEx18NM_002693.2:c.2808C>Gp.Ala936= | p.A936=LRG_500t1:c.*4480G>C, LRG_765t1:c.2808C>G, NM_001113378.1:c.*4480G>C, NM_001126131.1:c.2808C>G, NM_002693.2:c.2808C>G, NM_018193.2:c.*4480G>C, XM_005254946.1:c.*4480G>C, XM_005254947.1:c.*4480G>C, XM_005254948.1:c.*4480G>C, XM_005254949.1:c.*4480G>C, XM_005254950.1:c.*4480G>C, XM_005254951.1:c.*4480G>C, XM_005254952.1:c.*4480G>C, XM_005254953.1:c.*4480G>C, XR_243211.1:n.*4456G>C, XR_243212.1:n.*4456G>CVOUS04/13/2017
273POLGEx18NM_002693.2:c.2830G>Ap.Glu944Lys | p.E944KLRG_500t1:c.*4458C>T, LRG_765t1:c.2830G>A, NM_001113378.1:c.*4458C>T, NM_001126131.1:c.2830G>A, NM_002693.2:c.2830G>A, NM_018193.2:c.*4458C>T, XM_005254946.1:c.*4458C>T, XM_005254947.1:c.*4458C>T, XM_005254948.1:c.*4458C>T, XM_005254949.1:c.*4458C>T, XM_005254950.1:c.*4458C>T, XM_005254951.1:c.*4458C>T, XM_005254952.1:c.*4458C>T, XM_005254953.1:c.*4458C>T, XR_243211.1:n.*4434C>T, XR_243212.1:n.*4434C>TVOUS06/04/2020
274POLGEx18NM_002693.2:c.2831A>Gp.Glu944Gly | p.E944GLRG_500t1:c.*4457T>C, LRG_765t1:c.2831A>G, NM_001113378.1:c.*4457T>C, NM_001126131.1:c.2831A>G, NM_002693.2:c.2831A>G, NM_018193.2:c.*4457T>C, XM_005254946.1:c.*4457T>C, XM_005254947.1:c.*4457T>C, XM_005254948.1:c.*4457T>C, XM_005254949.1:c.*4457T>C, XM_005254950.1:c.*4457T>C, XM_005254951.1:c.*4457T>C, XM_005254952.1:c.*4457T>C, XM_005254953.1:c.*4457T>C, XR_243211.1:n.*4433T>C, XR_243212.1:n.*4433T>CVOUS03/23/2017
275POLGEx18NM_002693.2:c.2853C>Tp.Tyr951= | p.Y951=NM_001113378.1:c.*4435G>A, NM_001126131.1:c.2853C>T, NM_002693.2:c.2853C>T, NM_018193.2:c.*4435G>A, XM_005254950.1:c.*4435G>ALikely benign06/29/2017 
276POLGEx18NM_002693.2:c.2854G>Ap.Gly952Ser | p.G952SLRG_500t1:c.*4434C>T, LRG_765t1:c.2854G>A, NM_001113378.1:c.*4434C>T, NM_001126131.1:c.2854G>A, NM_002693.2:c.2854G>A, NM_018193.2:c.*4434C>T, XM_005254946.1:c.*4434C>T, XM_005254947.1:c.*4434C>T, XM_005254948.1:c.*4434C>T, XM_005254949.1:c.*4434C>T, XM_005254950.1:c.*4434C>T, XM_005254951.1:c.*4434C>T, XM_005254952.1:c.*4434C>T, XM_005254953.1:c.*4434C>T, XR_243211.1:n.*4410C>T, XR_243212.1:n.*4410C>TVOUS08/27/2019
277POLGEx18NM_002693.2:c.2857C>Tp.Arg953Cys | p.R953CNM_001113378.1:c.*4431G>A, NM_001126131.1:c.2857C>T, NM_002693.2:c.2857C>T, NM_018193.2:c.*4431G>A, XM_005254946.1:c.*4431G>A, XM_005254947.1:c.*4431G>A, XM_005254948.1:c.*4431G>A, XM_005254949.1:c.*4431G>A, XM_005254950.1:c.*4431G>A, XM_005254951.1:c.*4431G>A, XM_005254952.1:c.*4431G>A, XM_005254953.1:c.*4431G>A, XR_243211.1:n.*4407G>A, XR_243212.1:n.*4407G>AVOUS02/06/2015
278POLGEx18NM_002693.2:c.2865T>Cp.Tyr955= | p.Y955=LRG_500t1:c.*4423A>G, LRG_765t1:c.2865T>C, NM_001113378.1:c.*4423A>G, NM_001126131.1:c.2865T>C, NM_002693.2:c.2865T>C, NM_018193.2:c.*4423A>G, XM_005254946.1:c.*4423A>G, XM_005254947.1:c.*4423A>G, XM_005254948.1:c.*4423A>G, XM_005254949.1:c.*4423A>G, XM_005254950.1:c.*4423A>G, XM_005254951.1:c.*4423A>G, XM_005254952.1:c.*4423A>G, XM_005254953.1:c.*4423A>G, XR_243211.1:n.*4399A>G, XR_243212.1:n.*4399A>GVOUS11/07/2017
279POLGEx18NM_002693.2:c.2870C>Tp.Ala957Val | p.A957VLRG_500t1:c.*4418G>A, LRG_765t1:c.2870C>T, NM_001113378.1:c.*4418G>A, NM_001126131.1:c.2870C>T, NM_002693.2:c.2870C>T, NM_018193.2:c.*4418G>A, XM_005254946.1:c.*4418G>A, XM_005254947.1:c.*4418G>A, XM_005254948.1:c.*4418G>A, XM_005254949.1:c.*4418G>A, XM_005254950.1:c.*4418G>A, XM_005254951.1:c.*4418G>A, XM_005254952.1:c.*4418G>A, XM_005254953.1:c.*4418G>A, XR_243211.1:n.*4394G>A, XR_243212.1:n.*4394G>ALikely pathogenic04/04/2016 
280POLGEx18NM_002693.2:c.2878C>Tp.Pro960Ser | p.P960SLRG_500t1:c.*4410G>A, LRG_765t1:c.2878C>T, NM_001113378.1:c.*4410G>A, NM_001126131.1:c.2878C>T, NM_002693.2:c.2878C>T, NM_018193.2:c.*4410G>A, XM_005254946.1:c.*4410G>A, XM_005254947.1:c.*4410G>A, XM_005254948.1:c.*4410G>A, XM_005254949.1:c.*4410G>A, XM_005254950.1:c.*4410G>A, XM_005254951.1:c.*4410G>A, XM_005254952.1:c.*4410G>A, XM_005254953.1:c.*4410G>A, XR_243211.1:n.*4386G>A, XR_243212.1:n.*4386G>AVOUS11/07/2017
281POLGEx18NM_002693.2:c.2880C>Tp.Pro960= | p.P960=LRG_500t1:c.*4408G>A, LRG_765t1:c.2880C>T, NM_001113378.1:c.*4408G>A, NM_001126131.1:c.2880C>T, NM_002693.2:c.2880C>T, NM_018193.2:c.*4408G>A, XM_005254946.1:c.*4408G>A, XM_005254947.1:c.*4408G>A, XM_005254948.1:c.*4408G>A, XM_005254949.1:c.*4408G>A, XM_005254950.1:c.*4408G>A, XM_005254951.1:c.*4408G>A, XM_005254952.1:c.*4408G>A, XM_005254953.1:c.*4408G>A, XR_243211.1:n.*4384G>A, XR_243212.1:n.*4384G>AVOUS06/18/2019
282POLGEx18NM_002693.2:c.2883T>Cp.Phe961= | p.F961=LRG_500t1:c.*4405A>G, LRG_765t1:c.2883T>C, NM_001113378.1:c.*4405A>G, NM_001126131.1:c.2883T>C, NM_002693.2:c.2883T>C, NM_018193.2:c.*4405A>G, XM_005254946.1:c.*4405A>G, XM_005254947.1:c.*4405A>G, XM_005254948.1:c.*4405A>G, XM_005254949.1:c.*4405A>G, XM_005254950.1:c.*4405A>G, XM_005254951.1:c.*4405A>G, XM_005254952.1:c.*4405A>G, XM_005254953.1:c.*4405A>G, XR_243211.1:n.*4381A>G, XR_243212.1:n.*4381A>GVOUS09/05/2019
283POLGEx18NM_002693.2:c.2884G>Ap.Ala962Thr | p.A962TLRG_500t1:c.*4404C>T, LRG_765t1:c.2884G>A, NM_001113378.1:c.*4404C>T, NM_001126131.1:c.2884G>A, NM_002693.2:c.2884G>A, NM_018193.2:c.*4404C>T, XM_005254946.1:c.*4404C>T, XM_005254947.1:c.*4404C>T, XM_005254948.1:c.*4404C>T, XM_005254949.1:c.*4404C>T, XM_005254950.1:c.*4404C>T, XM_005254951.1:c.*4404C>T, XM_005254952.1:c.*4404C>T, XM_005254953.1:c.*4404C>T, XR_243211.1:n.*4380C>T, XR_243212.1:n.*4380C>TVOUS12/20/2017
284POLGEx18NM_002693.2:c.2890C>Tp.Arg964Cys | p.R964CLRG_500t1:c.*4398G>A, LRG_765t1:c.2890C>T, NM_001113378.1:c.*4398G>A, NM_001126131.1:c.2890C>T, NM_002693.2:c.2890C>T, NM_018193.2:c.*4398G>A, XM_005254946.1:c.*4398G>A, XM_005254947.1:c.*4398G>A, XM_005254948.1:c.*4398G>A, XM_005254949.1:c.*4398G>A, XM_005254950.1:c.*4398G>A, XM_005254951.1:c.*4398G>A, XM_005254952.1:c.*4398G>A, XM_005254953.1:c.*4398G>A, XR_243211.1:n.*4374G>A, XR_243212.1:n.*4374G>AVOUS06/30/2020
285POLGEx18NM_002693.2:c.2914C>Tp.Arg972Trp | p.R972WLRG_500t1:c.*4374G>A, LRG_765t1:c.2914C>T, NM_001113378.1:c.*4374G>A, NM_001126131.1:c.2914C>T, NM_002693.2:c.2914C>T, NM_018193.2:c.*4374G>A, XM_005254946.1:c.*4374G>A, XM_005254947.1:c.*4374G>A, XM_005254948.1:c.*4374G>A, XM_005254949.1:c.*4374G>A, XM_005254950.1:c.*4374G>A, XM_005254951.1:c.*4374G>A, XM_005254952.1:c.*4374G>A, XM_005254953.1:c.*4374G>A, XR_243211.1:n.*4350G>A, XR_243212.1:n.*4350G>AVOUS06/19/2020
286POLGEx18NM_002693.2:c.2915G>Ap.Arg972Gln | p.R972QLRG_500t1:c.*4373C>T, LRG_765t1:c.2915G>A, NM_001113378.1:c.*4373C>T, NM_001126131.1:c.2915G>A, NM_002693.2:c.2915G>A, NM_018193.2:c.*4373C>T, XM_005254946.1:c.*4373C>T, XM_005254947.1:c.*4373C>T, XM_005254948.1:c.*4373C>T, XM_005254949.1:c.*4373C>T, XM_005254950.1:c.*4373C>T, XM_005254951.1:c.*4373C>T, XM_005254952.1:c.*4373C>T, XM_005254953.1:c.*4373C>T, XR_243211.1:n.*4349C>T, XR_243212.1:n.*4349C>TVOUS03/04/2021
287POLGEx18NM_002693.2:c.2926_2928delCAGp.Gln976del | p.Q976delLRG_500t1:c.*4360_*4362delCTG, LRG_765t1:c.2926_2928delCAG, NM_001113378.1:c.*4360_*4362delCTG, NM_001126131.1:c.2926_2928delCAG, NM_002693.2:c.2926_2928delCAG, NM_018193.2:c.*4360_*4362delCTG, XM_005254946.1:c.*4360_*4362delCTG, XM_005254947.1:c.*4360_*4362delCTG, XM_005254948.1:c.*4360_*4362delCTG, XM_005254949.1:c.*4360_*4362delCTG, XM_005254950.1:c.*4360_*4362delCTG, XM_005254951.1:c.*4360_*4362delCTG, XM_005254952.1:c.*4360_*4362delCTG, XM_005254953.1:c.*4360_*4362delCTG, XR_243211.1:n.*4336_*4338delCTG, XR_243212.1:n.*4336_*4338delCTGVOUS09/27/2017
288POLGEx18NM_002693.2:c.2943G>Tp.Lys981Asn | p.K981NLRG_500t1:c.*4345C>A, LRG_765t1:c.2943G>T, NM_001113378.1:c.*4345C>A, NM_001126131.1:c.2943G>T, NM_002693.2:c.2943G>T, NM_018193.2:c.*4345C>A, XM_005254946.1:c.*4345C>A, XM_005254947.1:c.*4345C>A, XM_005254948.1:c.*4345C>A, XM_005254949.1:c.*4345C>A, XM_005254950.1:c.*4345C>A, XM_005254951.1:c.*4345C>A, XM_005254952.1:c.*4345C>A, XM_005254953.1:c.*4345C>A, XR_243211.1:n.*4321C>A, XR_243212.1:n.*4321C>AVOUS05/04/2018
289POLGEx18NM_002693.2:c.2977C>Tp.Arg993Cys | p.R993CLRG_500t1:c.*4311G>A, LRG_765t1:c.2977C>T, NM_001113378.1:c.*4311G>A, NM_001126131.1:c.2977C>T, NM_002693.2:c.2977C>T, NM_018193.2:c.*4311G>A, XM_005254946.1:c.*4311G>A, XM_005254947.1:c.*4311G>A, XM_005254948.1:c.*4311G>A, XM_005254949.1:c.*4311G>A, XM_005254950.1:c.*4311G>A, XM_005254951.1:c.*4311G>A, XM_005254952.1:c.*4311G>A, XM_005254953.1:c.*4311G>A, XR_243211.1:n.*4287G>A, XR_243212.1:n.*4287G>AVOUS12/18/2020
290POLGEx18NM_002693.2:c.2981+3G>AVOUS08/27/2020
291POLGEx19NM_002693.2:c.2986C>Tp.Arg996Trp | p.R996WLRG_500t1:c.*2887G>A, LRG_765t1:c.2986C>T, NM_001113378.1:c.*2887G>A, NM_001126131.1:c.2986C>T, NM_002693.2:c.2986C>T, NM_018193.2:c.*2887G>A, XM_005254946.1:c.*2887G>A, XM_005254947.1:c.*2887G>A, XM_005254948.1:c.*2887G>A, XM_005254949.1:c.*2887G>A, XM_005254950.1:c.*2887G>A, XM_005254951.1:c.*2887G>A, XM_005254952.1:c.*2887G>A, XM_005254953.1:c.*2887G>A, XR_243211.1:n.*2863G>A, XR_243212.1:n.*2863G>AVOUS04/12/2016
292POLGEx19NM_002693.2:c.2987G>Ap.Arg996Gln | p.R996QLRG_500t1:c.*2886C>T, LRG_765t1:c.2987G>A, NM_001113378.1:c.*2886C>T, NM_001126131.1:c.2987G>A, NM_002693.2:c.2987G>A, NM_018193.2:c.*2886C>T, XM_005254946.1:c.*2886C>T, XM_005254947.1:c.*2886C>T, XM_005254948.1:c.*2886C>T, XM_005254949.1:c.*2886C>T, XM_005254950.1:c.*2886C>T, XM_005254951.1:c.*2886C>T, XM_005254952.1:c.*2886C>T, XM_005254953.1:c.*2886C>T, XR_243211.1:n.*2862C>T, XR_243212.1:n.*2862C>TVOUS03/29/2019
293POLGEx19NM_002693.2:c.2993C>Tp.Ser998Leu | p.S998LLRG_500t1:c.*2880G>A, LRG_765t1:c.2993C>T, NM_001113378.1:c.*2880G>A, NM_001126131.1:c.2993C>T, NM_002693.2:c.2993C>T, NM_018193.2:c.*2880G>A, XM_005254946.1:c.*2880G>A, XM_005254947.1:c.*2880G>A, XM_005254948.1:c.*2880G>A, XM_005254949.1:c.*2880G>A, XM_005254950.1:c.*2880G>A, XM_005254951.1:c.*2880G>A, XM_005254952.1:c.*2880G>A, XM_005254953.1:c.*2880G>A, XR_243211.1:n.*2856G>A, XR_243212.1:n.*2856G>AVOUS04/30/2019
294POLGEx19NM_002693.2:c.2994G>Cp.Ser998= | p.S998=LRG_500t1:c.*2879C>G, LRG_765t1:c.2994G>C, NM_001113378.1:c.*2879C>G, NM_001126131.1:c.2994G>C, NM_002693.2:c.2994G>C, NM_018193.2:c.*2879C>G, XM_005254946.1:c.*2879C>G, XM_005254947.1:c.*2879C>G, XM_005254948.1:c.*2879C>G, XM_005254949.1:c.*2879C>G, XM_005254950.1:c.*2879C>G, XM_005254951.1:c.*2879C>G, XM_005254952.1:c.*2879C>G, XM_005254953.1:c.*2879C>G, XR_243211.1:n.*2855C>G, XR_243212.1:n.*2855C>GLikely benign04/26/2016 
295POLGEx19NM_002693.2:c.2994G>Tp.Ser998= | p.S998=LRG_500t1:c.*2879C>A, LRG_765t1:c.2994G>T, NM_001113378.1:c.*2879C>A, NM_001126131.1:c.2994G>T, NM_002693.2:c.2994G>T, NM_018193.2:c.*2879C>A, XM_005254946.1:c.*2879C>A, XM_005254947.1:c.*2879C>A, XM_005254948.1:c.*2879C>A, XM_005254949.1:c.*2879C>A, XM_005254950.1:c.*2879C>A, XM_005254951.1:c.*2879C>A, XM_005254952.1:c.*2879C>A, XM_005254953.1:c.*2879C>A, XR_243211.1:n.*2855C>A, XR_243212.1:n.*2855C>AVOUS03/07/2017
296POLGEx19NM_002693.2:c.3006G>Cp.Glu1002Asp | p.E1002DLRG_500t1:c.*2867C>G, LRG_765t1:c.3006G>C, NM_001113378.1:c.*2867C>G, NM_001126131.1:c.3006G>C, NM_002693.2:c.3006G>C, NM_018193.2:c.*2867C>G, XM_005254946.1:c.*2867C>G, XM_005254947.1:c.*2867C>G, XM_005254948.1:c.*2867C>G, XM_005254949.1:c.*2867C>G, XM_005254950.1:c.*2867C>G, XM_005254951.1:c.*2867C>G, XM_005254952.1:c.*2867C>G, XM_005254953.1:c.*2867C>G, XR_243211.1:n.*2843C>G, XR_243212.1:n.*2843C>GVOUS08/21/2019
297POLGEx19NM_002693.2:c.3012G>Tp.Leu1004= | p.L1004=LRG_500t1:c.*2861C>A, LRG_765t1:c.3012G>T, NM_001113378.1:c.*2861C>A, NM_001126131.1:c.3012G>T, NM_002693.2:c.3012G>T, NM_018193.2:c.*2861C>A, XM_005254946.1:c.*2861C>A, XM_005254947.1:c.*2861C>A, XM_005254948.1:c.*2861C>A, XM_005254949.1:c.*2861C>A, XM_005254950.1:c.*2861C>A, XM_005254951.1:c.*2861C>A, XM_005254952.1:c.*2861C>A, XM_005254953.1:c.*2861C>A, XR_243211.1:n.*2837C>A, XR_243212.1:n.*2837C>AVOUS02/12/2019
298POLGEx19NM_002693.2:c.3014T>Gp.Val1005Gly | p.V1005GNM_001113378.1:c.*2859A>C, NM_001126131.1:c.3014T>G, NM_002693.2:c.3014T>G, NM_018193.2:c.*2859A>C, XM_005254946.1:c.*2859A>C, XM_005254947.1:c.*2859A>C, XM_005254948.1:c.*2859A>C, XM_005254949.1:c.*2859A>C, XM_005254950.1:c.*2859A>C, XM_005254951.1:c.*2859A>C, XM_005254952.1:c.*2859A>C, XM_005254953.1:c.*2859A>C, XR_243211.1:n.*2835A>C, XR_243212.1:n.*2835A>CVOUS07/10/2014
299POLGEx19NM_002693.2:c.3024G>Ap.Leu1008= | p.L1008=LRG_500t1:c.*2849C>T, LRG_765t1:c.3024G>A, NM_001113378.1:c.*2849C>T, NM_001126131.1:c.3024G>A, NM_002693.2:c.3024G>A, NM_018193.2:c.*2849C>T, XM_005254946.1:c.*2849C>T, XM_005254947.1:c.*2849C>T, XM_005254948.1:c.*2849C>T, XM_005254949.1:c.*2849C>T, XM_005254950.1:c.*2849C>T, XM_005254951.1:c.*2849C>T, XM_005254952.1:c.*2849C>T, XM_005254953.1:c.*2849C>T, XR_243211.1:n.*2825C>T, XR_243212.1:n.*2825C>TVOUS06/05/2018
300POLGEx19NM_002693.2:c.3046G>Ap.Glu1016Lys | p.E1016KLRG_500t1:c.*2827C>T, LRG_765t1:c.3046G>A, NM_001113378.1:c.*2827C>T, NM_001126131.1:c.3046G>A, NM_002693.2:c.3046G>A, NM_018193.2:c.*2827C>T, XM_005254946.1:c.*2827C>T, XM_005254947.1:c.*2827C>T, XM_005254948.1:c.*2827C>T, XM_005254949.1:c.*2827C>T, XM_005254950.1:c.*2827C>T, XM_005254951.1:c.*2827C>T, XM_005254952.1:c.*2827C>T, XM_005254953.1:c.*2827C>T, XR_243211.1:n.*2803C>T, XR_243212.1:n.*2803C>TVOUS12/30/2020
301POLGEx19NM_002693.2:c.3075G>Ap.Leu1025= | p.L1025=LRG_500t1:c.*2798C>T, LRG_765t1:c.3075G>A, NM_001113378.1:c.*2798C>T, NM_001126131.1:c.3075G>A, NM_002693.2:c.3075G>A, NM_018193.2:c.*2798C>T, XM_005254946.1:c.*2798C>T, XM_005254947.1:c.*2798C>T, XM_005254948.1:c.*2798C>T, XM_005254949.1:c.*2798C>T, XM_005254950.1:c.*2798C>T, XM_005254951.1:c.*2798C>T, XM_005254952.1:c.*2798C>T, XM_005254953.1:c.*2798C>T, XR_243211.1:n.*2774C>T, XR_243212.1:n.*2774C>TVOUS07/09/2019
302POLGEx19NM_002693.2:c.3077G>Ap.Arg1026His | p.R1026HLRG_500t1:c.*2796C>T, LRG_765t1:c.3077G>A, NM_001113378.1:c.*2796C>T, NM_001126131.1:c.3077G>A, NM_002693.2:c.3077G>A, NM_018193.2:c.*2796C>T, XM_005254946.1:c.*2796C>T, XM_005254947.1:c.*2796C>T, XM_005254948.1:c.*2796C>T, XM_005254949.1:c.*2796C>T, XM_005254950.1:c.*2796C>T, XM_005254951.1:c.*2796C>T, XM_005254952.1:c.*2796C>T, XM_005254953.1:c.*2796C>T, XR_243211.1:n.*2772C>T, XR_243212.1:n.*2772C>TVOUS11/05/2019
303POLGEx19NM_002693.2:c.3098C>Tp.Ala1033Val | p.A1033VLRG_500t1:c.*2775G>A, LRG_765t1:c.3098C>T, NM_001113378.1:c.*2775G>A, NM_001126131.1:c.3098C>T, NM_002693.2:c.3098C>T, NM_018193.2:c.*2775G>A, XM_005254946.1:c.*2775G>A, XM_005254947.1:c.*2775G>A, XM_005254948.1:c.*2775G>A, XM_005254949.1:c.*2775G>A, XM_005254950.1:c.*2775G>A, XM_005254951.1:c.*2775G>A, XM_005254952.1:c.*2775G>A, XM_005254953.1:c.*2775G>A, XR_243211.1:n.*2751G>A, XR_243212.1:n.*2751G>AVOUS08/27/2020
304POLGEx19NM_002693.2:c.3101G>Ap.Arg1034Lys | p.R1034KLRG_500t1:c.*2772C>T, LRG_765t1:c.3101G>A, NM_001113378.1:c.*2772C>T, NM_001126131.1:c.3101G>A, NM_002693.2:c.3101G>A, NM_018193.2:c.*2772C>T, XM_005254946.1:c.*2772C>T, XM_005254947.1:c.*2772C>T, XM_005254948.1:c.*2772C>T, XM_005254949.1:c.*2772C>T, XM_005254950.1:c.*2772C>T, XM_005254951.1:c.*2772C>T, XM_005254952.1:c.*2772C>T, XM_005254953.1:c.*2772C>T, XR_243211.1:n.*2748C>T, XR_243212.1:n.*2748C>TVOUS08/26/2019
305POLGEx19NM_002693.2:c.3104+2T>ALRG_500t1:c.*2767A>T, LRG_765t1:c.3104+2T>A, NM_001113378.1:c.*2767A>T, NM_001126131.1:c.3104+2T>A, NM_002693.2:c.3104+2T>A, NM_018193.2:c.*2767A>T, XM_005254946.1:c.*2767A>T, XM_005254947.1:c.*2767A>T, XM_005254948.1:c.*2767A>T, XM_005254949.1:c.*2767A>T, XM_005254950.1:c.*2767A>T, XM_005254951.1:c.*2767A>T, XM_005254952.1:c.*2767A>T, XM_005254953.1:c.*2767A>T, XR_243211.1:n.*2743A>T, XR_243212.1:n.*2743A>TLikely pathogenic08/23/2017 
306POLGEx19NM_002693.2:c.3104+8C>ALRG_500t1:c.*2761G>T, LRG_765t1:c.3104+8C>A, NM_001113378.1:c.*2761G>T, NM_001126131.1:c.3104+8C>A, NM_002693.2:c.3104+8C>A, NM_018193.2:c.*2761G>T, XM_005254946.1:c.*2761G>T, XM_005254947.1:c.*2761G>T, XM_005254948.1:c.*2761G>T, XM_005254949.1:c.*2761G>T, XM_005254950.1:c.*2761G>T, XM_005254951.1:c.*2761G>T, XM_005254952.1:c.*2761G>T, XM_005254953.1:c.*2761G>T, XR_243211.1:n.*2737G>T, XR_243212.1:n.*2737G>TVOUS05/25/2018
307POLGEx20NM_002693.2:c.3105-11T>CBenign03/17/2014 
308POLGEx20NM_002693.2:c.3105-5C>TLRG_500t1:c.*2645G>A, LRG_765t1:c.3105-5C>T, NM_001113378.1:c.*2645G>A, NM_001126131.1:c.3105-5C>T, NM_002693.2:c.3105-5C>T, NM_018193.2:c.*2645G>A, XM_005254946.1:c.*2645G>A, XM_005254947.1:c.*2645G>A, XM_005254948.1:c.*2645G>A, XM_005254949.1:c.*2645G>A, XM_005254950.1:c.*2645G>A, XM_005254951.1:c.*2645G>A, XM_005254952.1:c.*2645G>A, XM_005254953.1:c.*2645G>A, XR_243211.1:n.*2621G>A, XR_243212.1:n.*2621G>AVOUS01/04/2019
309POLGEx20NM_002693.2:c.3105G>Ap.Lys1035= | p.K1035=LRG_500t1:c.*2640C>T, LRG_765t1:c.3105G>A, NM_001113378.1:c.*2640C>T, NM_001126131.1:c.3105G>A, NM_002693.2:c.3105G>A, NM_018193.2:c.*2640C>T, XM_005254946.1:c.*2640C>T, XM_005254947.1:c.*2640C>T, XM_005254948.1:c.*2640C>T, XM_005254949.1:c.*2640C>T, XM_005254950.1:c.*2640C>T, XM_005254951.1:c.*2640C>T, XM_005254952.1:c.*2640C>T, XM_005254953.1:c.*2640C>T, XR_243211.1:n.*2616C>T, XR_243212.1:n.*2616C>TVOUS11/27/2017
310POLGEx20NM_002693.2:c.3131T>Cp.Val1044Ala | p.V1044ALRG_500t1:c.*2614A>G, LRG_765t1:c.3131T>C, NM_001113378.1:c.*2614A>G, NM_001126131.1:c.3131T>C, NM_002693.2:c.3131T>C, NM_018193.2:c.*2614A>G, XM_005254946.1:c.*2614A>G, XM_005254947.1:c.*2614A>G, XM_005254948.1:c.*2614A>G, XM_005254949.1:c.*2614A>G, XM_005254950.1:c.*2614A>G, XM_005254951.1:c.*2614A>G, XM_005254952.1:c.*2614A>G, XM_005254953.1:c.*2614A>G, XR_243211.1:n.*2590A>G, XR_243212.1:n.*2590A>GVOUS08/18/2020
311POLGEx20NM_002693.2:c.3139C>Tp.Arg1047Trp | p.R1047WLRG_500t1:c.*2606G>A, LRG_765t1:c.3139C>T, NM_001113378.1:c.*2606G>A, NM_001126131.1:c.3139C>T, NM_002693.2:c.3139C>T, NM_018193.2:c.*2606G>A, XM_005254946.1:c.*2606G>A, XM_005254947.1:c.*2606G>A, XM_005254948.1:c.*2606G>A, XM_005254949.1:c.*2606G>A, XM_005254950.1:c.*2606G>A, XM_005254951.1:c.*2606G>A, XM_005254952.1:c.*2606G>A, XM_005254953.1:c.*2606G>A, XR_243211.1:n.*2582G>A, XR_243212.1:n.*2582G>AVOUS10/08/2020
312POLGEx20NM_002693.2:c.3140G>Ap.Arg1047Gln | p.R1047QLRG_500t1:c.*2605C>T, LRG_765t1:c.3140G>A, NM_001113378.1:c.*2605C>T, NM_001126131.1:c.3140G>A, NM_002693.2:c.3140G>A, NM_018193.2:c.*2605C>T, XM_005254946.1:c.*2605C>T, XM_005254947.1:c.*2605C>T, XM_005254948.1:c.*2605C>T, XM_005254949.1:c.*2605C>T, XM_005254950.1:c.*2605C>T, XM_005254951.1:c.*2605C>T, XM_005254952.1:c.*2605C>T, XM_005254953.1:c.*2605C>T, XR_243211.1:n.*2581C>T, XR_243212.1:n.*2581C>TVOUS11/20/2020
313POLGEx20NM_002693.2:c.3176A>Gp.Asn1059Ser | p.N1059SLRG_500t1:c.*2569T>C, LRG_765t1:c.3176A>G, NM_001113378.1:c.*2569T>C, NM_001126131.1:c.3176A>G, NM_002693.2:c.3176A>G, NM_018193.2:c.*2569T>C, XM_005254946.1:c.*2569T>C, XM_005254947.1:c.*2569T>C, XM_005254948.1:c.*2569T>C, XM_005254949.1:c.*2569T>C, XM_005254950.1:c.*2569T>C, XM_005254951.1:c.*2569T>C, XM_005254952.1:c.*2569T>C, XM_005254953.1:c.*2569T>C, XR_243211.1:n.*2545T>C, XR_243212.1:n.*2545T>CVOUS11/19/2019
314POLGEx20NM_002693.2:c.3188G>Ap.Ser1063Asn | p.S1063NLRG_500t1:c.*2557C>T, LRG_765t1:c.3188G>A, NM_001113378.1:c.*2557C>T, NM_001126131.1:c.3188G>A, NM_002693.2:c.3188G>A, NM_018193.2:c.*2557C>T, XM_005254946.1:c.*2557C>T, XM_005254947.1:c.*2557C>T, XM_005254948.1:c.*2557C>T, XM_005254949.1:c.*2557C>T, XM_005254950.1:c.*2557C>T, XM_005254951.1:c.*2557C>T, XM_005254952.1:c.*2557C>T, XM_005254953.1:c.*2557C>T, XR_243211.1:n.*2533C>T, XR_243212.1:n.*2533C>TVOUS08/10/2020
315POLGEx20NM_002693.2:c.3197C>Tp.Thr1066Met | p.T1066MLRG_500t1:c.*2548G>A, LRG_765t1:c.3197C>T, NM_001113378.1:c.*2548G>A, NM_001126131.1:c.3197C>T, NM_002693.2:c.3197C>T, NM_018193.2:c.*2548G>A, XM_005254946.1:c.*2548G>A, XM_005254947.1:c.*2548G>A, XM_005254948.1:c.*2548G>A, XM_005254949.1:c.*2548G>A, XM_005254950.1:c.*2548G>A, XM_005254951.1:c.*2548G>A, XM_005254952.1:c.*2548G>A, XM_005254953.1:c.*2548G>A, XR_243211.1:n.*2524G>A, XR_243212.1:n.*2524G>AVOUS01/30/2018
316POLGEx20NM_002693.2:c.3198G>Ap.Thr1066= | p.T1066=NM_001113378.1:c.*2547C>T, NM_001126131.1:c.3198G>A, NM_002693.2:c.3198G>A, NM_018193.2:c.*2547C>T, XM_005254946.1:c.*2547C>T, XM_005254947.1:c.*2547C>T, XM_005254948.1:c.*2547C>T, XM_005254949.1:c.*2547C>T, XM_005254950.1:c.*2547C>T, XM_005254951.1:c.*2547C>T, XM_005254952.1:c.*2547C>T, XM_005254953.1:c.*2547C>T, XR_243211.1:n.*2523C>T, XR_243212.1:n.*2523C>TBenign08/06/2015 
317POLGEx20NM_002693.2:c.3212G>Ap.Arg1071His | p.R1071HLRG_500t1:c.*2533C>T, LRG_765t1:c.3212G>A, NM_001113378.1:c.*2533C>T, NM_001126131.1:c.3212G>A, NM_002693.2:c.3212G>A, NM_018193.2:c.*2533C>T, XM_005254946.1:c.*2533C>T, XM_005254947.1:c.*2533C>T, XM_005254948.1:c.*2533C>T, XM_005254949.1:c.*2533C>T, XM_005254950.1:c.*2533C>T, XM_005254951.1:c.*2533C>T, XM_005254952.1:c.*2533C>T, XM_005254953.1:c.*2533C>T, XR_243211.1:n.*2509C>T, XR_243212.1:n.*2509C>TVOUS01/21/2021
318POLGEx20NM_002693.2:c.3215C>Gp.Thr1072Ser | p.T1072SLRG_500t1:c.*2530G>C, LRG_765t1:c.3215C>G, NM_001113378.1:c.*2530G>C, NM_001126131.1:c.3215C>G, NM_002693.2:c.3215C>G, NM_018193.2:c.*2530G>C, XM_005254946.1:c.*2530G>C, XM_005254947.1:c.*2530G>C, XM_005254948.1:c.*2530G>C, XM_005254949.1:c.*2530G>C, XM_005254950.1:c.*2530G>C, XM_005254951.1:c.*2530G>C, XM_005254952.1:c.*2530G>C, XM_005254953.1:c.*2530G>C, XR_243211.1:n.*2506G>C, XR_243212.1:n.*2506G>CVOUS09/05/2019
319POLGEx20NM_002693.2:c.3216C>Gp.Thr1072= | p.T1072=LRG_500t1:c.*2529G>C, LRG_765t1:c.3216C>G, NM_001113378.1:c.*2529G>C, NM_001126131.1:c.3216C>G, NM_002693.2:c.3216C>G, NM_018193.2:c.*2529G>C, XM_005254946.1:c.*2529G>C, XM_005254947.1:c.*2529G>C, XM_005254948.1:c.*2529G>C, XM_005254949.1:c.*2529G>C, XM_005254950.1:c.*2529G>C, XM_005254951.1:c.*2529G>C, XM_005254952.1:c.*2529G>C, XM_005254953.1:c.*2529G>C, XR_243211.1:n.*2505G>C, XR_243212.1:n.*2505G>CVOUS11/01/2017
320POLGEx20NM_002693.2:c.3218C>Tp.Pro1073Leu | p.P1073LLRG_500t1:c.*2527G>A, LRG_765t1:c.3218C>T, NM_001113378.1:c.*2527G>A, NM_001126131.1:c.3218C>T, NM_002693.2:c.3218C>T, NM_018193.2:c.*2527G>A, XM_005254946.1:c.*2527G>A, XM_005254947.1:c.*2527G>A, XM_005254948.1:c.*2527G>A, XM_005254949.1:c.*2527G>A, XM_005254950.1:c.*2527G>A, XM_005254951.1:c.*2527G>A, XM_005254952.1:c.*2527G>A, XM_005254953.1:c.*2527G>A, XR_243211.1:n.*2503G>A, XR_243212.1:n.*2503G>APathogenic03/19/2020 
321POLGEx20NM_002693.2:c.3222G>Tp.Val1074= | p.V1074=LRG_500t1:c.*2523C>A, LRG_765t1:c.3222G>T, NM_001113378.1:c.*2523C>A, NM_001126131.1:c.3222G>T, NM_002693.2:c.3222G>T, NM_018193.2:c.*2523C>A, XM_005254946.1:c.*2523C>A, XM_005254947.1:c.*2523C>A, XM_005254948.1:c.*2523C>A, XM_005254949.1:c.*2523C>A, XM_005254950.1:c.*2523C>A, XM_005254951.1:c.*2523C>A, XM_005254952.1:c.*2523C>A, XM_005254953.1:c.*2523C>A, XR_243211.1:n.*2499C>A, XR_243212.1:n.*2499C>AVOUS08/14/2018
322POLGEx20NM_002693.2:c.3229T>Gp.Cys1077Gly | p.C1077GLRG_500t1:c.*2516A>C, LRG_765t1:c.3229T>G, NM_001113378.1:c.*2516A>C, NM_001126131.1:c.3229T>G, NM_002693.2:c.3229T>G, NM_018193.2:c.*2516A>C, XM_005254946.1:c.*2516A>C, XM_005254947.1:c.*2516A>C, XM_005254948.1:c.*2516A>C, XM_005254949.1:c.*2516A>C, XM_005254950.1:c.*2516A>C, XM_005254951.1:c.*2516A>C, XM_005254952.1:c.*2516A>C, XM_005254953.1:c.*2516A>C, XR_243211.1:n.*2492A>C, XR_243212.1:n.*2492A>CVOUS04/23/2020
323POLGEx20NM_002693.2:c.3258G>Ap.Ser1086= | p.S1086=LRG_500t1:c.*2487C>T, LRG_765t1:c.3258G>A, NM_001113378.1:c.*2487C>T, NM_001126131.1:c.3258G>A, NM_002693.2:c.3258G>A, NM_018193.2:c.*2487C>T, XM_005254946.1:c.*2487C>T, XM_005254947.1:c.*2487C>T, XM_005254948.1:c.*2487C>T, XM_005254949.1:c.*2487C>T, XM_005254950.1:c.*2487C>T, XM_005254951.1:c.*2487C>T, XM_005254952.1:c.*2487C>T, XM_005254953.1:c.*2487C>T, XR_243211.1:n.*2463C>T, XR_243212.1:n.*2463C>TVOUS04/17/2018
324POLGEx21NM_002693.2:c.3278T>Cp.Met1093Thr | p.M1093TLRG_500t1:c.*2286A>G, LRG_765t1:c.3278T>C, NM_001113378.1:c.*2286A>G, NM_001126131.1:c.3278T>C, NM_002693.2:c.3278T>C, NM_018193.2:c.*2286A>G, XM_005254946.1:c.*2286A>G, XM_005254947.1:c.*2286A>G, XM_005254948.1:c.*2286A>G, XM_005254949.1:c.*2286A>G, XM_005254950.1:c.*2286A>G, XM_005254951.1:c.*2286A>G, XM_005254952.1:c.*2286A>G, XM_005254953.1:c.*2286A>G, XR_243211.1:n.*2262A>G, XR_243212.1:n.*2262A>GVOUS02/03/2020
325POLGEx21NM_002693.2:c.3286C>Gp.Arg1096Gly | p.R1096GLRG_500t1:c.*2278G>C, LRG_765t1:c.3286C>G, NM_001113378.1:c.*2278G>C, NM_001126131.1:c.3286C>G, NM_002693.2:c.3286C>G, NM_018193.2:c.*2278G>C, XM_005254946.1:c.*2278G>C, XM_005254947.1:c.*2278G>C, XM_005254948.1:c.*2278G>C, XM_005254949.1:c.*2278G>C, XM_005254950.1:c.*2278G>C, XM_005254951.1:c.*2278G>C, XM_005254952.1:c.*2278G>C, XM_005254953.1:c.*2278G>C, XR_243211.1:n.*2254G>C, XR_243212.1:n.*2254G>CLikely pathogenic02/07/2017 
326POLGEx21NM_002693.2:c.3286C>Tp.Arg1096Cys | p.R1096CLRG_500t1:c.*2278G>A, LRG_765t1:c.3286C>T, NM_001113378.1:c.*2278G>A, NM_001126131.1:c.3286C>T, NM_002693.2:c.3286C>T, NM_018193.2:c.*2278G>A, XM_005254946.1:c.*2278G>A, XM_005254947.1:c.*2278G>A, XM_005254948.1:c.*2278G>A, XM_005254949.1:c.*2278G>A, XM_005254950.1:c.*2278G>A, XM_005254951.1:c.*2278G>A, XM_005254952.1:c.*2278G>A, XM_005254953.1:c.*2278G>A, XR_243211.1:n.*2254G>A, XR_243212.1:n.*2254G>APathogenic02/08/2017 
327POLGEx21NM_002693.2:c.3287G>Ap.Arg1096His | p.R1096HLRG_500t1:c.*2277C>T, LRG_765t1:c.3287G>A, NM_001113378.1:c.*2277C>T, NM_001126131.1:c.3287G>A, NM_002693.2:c.3287G>A, NM_018193.2:c.*2277C>T, XM_005254946.1:c.*2277C>T, XM_005254947.1:c.*2277C>T, XM_005254948.1:c.*2277C>T, XM_005254949.1:c.*2277C>T, XM_005254950.1:c.*2277C>T, XM_005254951.1:c.*2277C>T, XM_005254952.1:c.*2277C>T, XM_005254953.1:c.*2277C>T, XR_243211.1:n.*2253C>T, XR_243212.1:n.*2253C>TVOUS02/21/2019
328POLGEx21NM_002693.2:c.3323A>Tp.Tyr1108Phe | p.Y1108FLRG_500t1:c.*2241T>A, LRG_765t1:c.3323A>T, NM_001113378.1:c.*2241T>A, NM_001126131.1:c.3323A>T, NM_002693.2:c.3323A>T, NM_018193.2:c.*2241T>A, XM_005254946.1:c.*2241T>A, XM_005254947.1:c.*2241T>A, XM_005254948.1:c.*2241T>A, XM_005254949.1:c.*2241T>A, XM_005254950.1:c.*2241T>A, XM_005254951.1:c.*2241T>A, XM_005254952.1:c.*2241T>A, XM_005254953.1:c.*2241T>A, XR_243211.1:n.*2217T>A, XR_243212.1:n.*2217T>AVOUS03/03/2021
329POLGEx21NM_002693.2:c.3358_3361dupTTTGp.Glu1121Valfs*2 | p.E1121VfsX2LRG_500t1:c.*2203_*2206dupCAAA, LRG_765t1:c.3358_3361dupTTTG, NM_001113378.1:c.*2203_*2206dupCAAA, NM_001126131.1:c.3358_3361dupTTTG, NM_002693.2:c.3358_3361dupTTTG, NM_018193.2:c.*2203_*2206dupCAAA, XM_005254946.1:c.*2203_*2206dupCAAA, XM_005254947.1:c.*2203_*2206dupCAAA, XM_005254948.1:c.*2203_*2206dupCAAA, XM_005254949.1:c.*2203_*2206dupCAAA, XM_005254950.1:c.*2203_*2206dupCAAA, XM_005254951.1:c.*2203_*2206dupCAAA, XM_005254952.1:c.*2203_*2206dupCAAA, XM_005254953.1:c.*2203_*2206dupCAAA, XR_243211.1:n.*2179_*2182dupCAAA, XR_243212.1:n.*2179_*2182dupCAAAPathogenic08/18/2020 
330POLGEx21NM_002693.2:c.3382C>Tp.Arg1128Cys | p.R1128CLRG_500t1:c.*2182G>A, LRG_765t1:c.3382C>T, NM_001113378.1:c.*2182G>A, NM_001126131.1:c.3382C>T, NM_002693.2:c.3382C>T, NM_018193.2:c.*2182G>A, XM_005254946.1:c.*2182G>A, XM_005254947.1:c.*2182G>A, XM_005254948.1:c.*2182G>A, XM_005254949.1:c.*2182G>A, XM_005254950.1:c.*2182G>A, XM_005254951.1:c.*2182G>A, XM_005254952.1:c.*2182G>A, XM_005254953.1:c.*2182G>A, XR_243211.1:n.*2158G>A, XR_243212.1:n.*2158G>AVOUS08/22/2019
331POLGEx21NM_002693.2:c.3383G>Ap.Arg1128His | p.R1128HLRG_500t1:c.*2181C>T, LRG_765t1:c.3383G>A, NM_001113378.1:c.*2181C>T, NM_001126131.1:c.3383G>A, NM_002693.2:c.3383G>A, NM_018193.2:c.*2181C>T, XM_005254946.1:c.*2181C>T, XM_005254947.1:c.*2181C>T, XM_005254948.1:c.*2181C>T, XM_005254949.1:c.*2181C>T, XM_005254950.1:c.*2181C>T, XM_005254951.1:c.*2181C>T, XM_005254952.1:c.*2181C>T, XM_005254953.1:c.*2181C>T, XR_243211.1:n.*2157C>T, XR_243212.1:n.*2157C>TVOUS01/11/2019
332POLGEx21NM_002693.2:c.3405C>Tp.Asp1135= | p.D1135=LRG_500t1:c.*2159G>A, LRG_765t1:c.3405C>T, NM_001113378.1:c.*2159G>A, NM_001126131.1:c.3405C>T, NM_002693.2:c.3405C>T, NM_018193.2:c.*2159G>A, XM_005254946.1:c.*2159G>A, XM_005254947.1:c.*2159G>A, XM_005254948.1:c.*2159G>A, XM_005254949.1:c.*2159G>A, XM_005254950.1:c.*2159G>A, XM_005254951.1:c.*2159G>A, XM_005254952.1:c.*2159G>A, XM_005254953.1:c.*2159G>A, XR_243211.1:n.*2135G>A, XR_243212.1:n.*2135G>AVOUS10/16/2018
333POLGEx21NM_002693.2:c.3408G>Cp.Glu1136Asp | p.E1136DLRG_500t1:c.*2156C>G, LRG_765t1:c.3408G>C, NM_001113378.1:c.*2156C>G, NM_001126131.1:c.3408G>C, NM_002693.2:c.3408G>C, NM_018193.2:c.*2156C>G, XM_005254946.1:c.*2156C>G, XM_005254947.1:c.*2156C>G, XM_005254948.1:c.*2156C>G, XM_005254949.1:c.*2156C>G, XM_005254950.1:c.*2156C>G, XM_005254951.1:c.*2156C>G, XM_005254952.1:c.*2156C>G, XM_005254953.1:c.*2156C>G, XR_243211.1:n.*2132C>G, XR_243212.1:n.*2132C>GVOUS10/24/2018
334POLGEx21NM_002693.2:c.3424C>Tp.Arg1142Trp | p.R1142WLRG_500t1:c.*2140G>A, LRG_765t1:c.3424C>T, NM_001113378.1:c.*2140G>A, NM_001126131.1:c.3424C>T, NM_002693.2:c.3424C>T, NM_018193.2:c.*2140G>A, XM_005254946.1:c.*2140G>A, XM_005254947.1:c.*2140G>A, XM_005254948.1:c.*2140G>A, XM_005254949.1:c.*2140G>A, XM_005254950.1:c.*2140G>A, XM_005254951.1:c.*2140G>A, XM_005254952.1:c.*2140G>A, XM_005254953.1:c.*2140G>A, XR_243211.1:n.*2116G>A, XR_243212.1:n.*2116G>AVOUS12/21/2020
335POLGEx21NM_002693.2:c.3425G>Ap.Arg1142Gln | p.R1142QLRG_500t1:c.*2139C>T, LRG_765t1:c.3425G>A, NM_001113378.1:c.*2139C>T, NM_001126131.1:c.3425G>A, NM_002693.2:c.3425G>A, NM_018193.2:c.*2139C>T, XM_005254946.1:c.*2139C>T, XM_005254947.1:c.*2139C>T, XM_005254948.1:c.*2139C>T, XM_005254949.1:c.*2139C>T, XM_005254950.1:c.*2139C>T, XM_005254951.1:c.*2139C>T, XM_005254952.1:c.*2139C>T, XM_005254953.1:c.*2139C>T, XR_243211.1:n.*2115C>T, XR_243212.1:n.*2115C>TVOUS07/28/2020
336POLGEx21NM_002693.2:c.3428A>Gp.Glu1143Gly | p.E1143GNM_001113378.1:c.*2136T>C, NM_001126131.1:c.3428A>G, NM_002693.2:c.3428A>G, NM_018193.2:c.*2136T>CBenign03/14/2014 
337POLGEx21NM_002693.2:c.3436C>Tp.Arg1146Cys | p.R1146CLRG_500t1:c.*2128G>A, LRG_765t1:c.3436C>T, NM_001113378.1:c.*2128G>A, NM_001126131.1:c.3436C>T, NM_002693.2:c.3436C>T, NM_018193.2:c.*2128G>A, XM_005254946.1:c.*2128G>A, XM_005254947.1:c.*2128G>A, XM_005254948.1:c.*2128G>A, XM_005254949.1:c.*2128G>A, XM_005254950.1:c.*2128G>A, XM_005254951.1:c.*2128G>A, XM_005254952.1:c.*2128G>A, XM_005254953.1:c.*2128G>A, XR_243211.1:n.*2104G>A, XR_243212.1:n.*2104G>AVOUS09/03/2020
338POLGEx21NM_002693.2:c.3442C>Tp.Arg1148Cys | p.R1148CLRG_500t1:c.*2122G>A, LRG_765t1:c.3442C>T, NM_001113378.1:c.*2122G>A, NM_001126131.1:c.3442C>T, NM_002693.2:c.3442C>T, NM_018193.2:c.*2122G>A, XM_005254946.1:c.*2122G>A, XM_005254947.1:c.*2122G>A, XM_005254948.1:c.*2122G>A, XM_005254949.1:c.*2122G>A, XM_005254950.1:c.*2122G>A, XM_005254951.1:c.*2122G>A, XM_005254952.1:c.*2122G>A, XM_005254953.1:c.*2122G>A, XR_243211.1:n.*2098G>A, XR_243212.1:n.*2098G>AVOUS10/03/2020
339POLGEx21NM_002693.2:c.3444C>Tp.Arg1148= | p.R1148=LRG_500t1:c.*2120G>A, LRG_765t1:c.3444C>T, NM_001113378.1:c.*2120G>A, NM_001126131.1:c.3444C>T, NM_002693.2:c.3444C>T, NM_018193.2:c.*2120G>A, XM_005254946.1:c.*2120G>A, XM_005254947.1:c.*2120G>A, XM_005254948.1:c.*2120G>A, XM_005254949.1:c.*2120G>A, XM_005254950.1:c.*2120G>A, XM_005254951.1:c.*2120G>A, XM_005254952.1:c.*2120G>A, XM_005254953.1:c.*2120G>A, XR_243211.1:n.*2096G>A, XR_243212.1:n.*2096G>AVOUS06/15/2017
340POLGEx21NM_002693.2:c.3450C>Tp.Ala1150= | p.A1150=LRG_500t1:c.*2114G>A, LRG_765t1:c.3450C>T, NM_001113378.1:c.*2114G>A, NM_001126131.1:c.3450C>T, NM_002693.2:c.3450C>T, NM_018193.2:c.*2114G>A, XM_005254946.1:c.*2114G>A, XM_005254947.1:c.*2114G>A, XM_005254948.1:c.*2114G>A, XM_005254949.1:c.*2114G>A, XM_005254950.1:c.*2114G>A, XM_005254951.1:c.*2114G>A, XM_005254952.1:c.*2114G>A, XM_005254953.1:c.*2114G>A, XR_243211.1:n.*2090G>A, XR_243212.1:n.*2090G>AVOUS06/29/2018
341POLGEx21NM_002693.2:c.3468C>Tp.Thr1156= | p.T1156=LRG_500t1:c.*2096G>A, LRG_765t1:c.3468C>T, NM_001113378.1:c.*2096G>A, NM_001126131.1:c.3468C>T, NM_002693.2:c.3468C>T, NM_018193.2:c.*2096G>A, XM_005254946.1:c.*2096G>A, XM_005254947.1:c.*2096G>A, XM_005254948.1:c.*2096G>A, XM_005254949.1:c.*2096G>A, XM_005254950.1:c.*2096G>A, XM_005254951.1:c.*2096G>A, XM_005254952.1:c.*2096G>A, XM_005254953.1:c.*2096G>A, XR_243211.1:n.*2072G>A, XR_243212.1:n.*2072G>AVOUS10/10/2018
342POLGEx21NM_002693.2:c.3480C>Tp.Thr1160= | p.T1160=LRG_500t1:c.*2084G>A, LRG_765t1:c.3480C>T, NM_001113378.1:c.*2084G>A, NM_001126131.1:c.3480C>T, NM_002693.2:c.3480C>T, NM_018193.2:c.*2084G>A, XM_005254946.1:c.*2084G>A, XM_005254947.1:c.*2084G>A, XM_005254948.1:c.*2084G>A, XM_005254949.1:c.*2084G>A, XM_005254950.1:c.*2084G>A, XM_005254951.1:c.*2084G>A, XM_005254952.1:c.*2084G>A, XM_005254953.1:c.*2084G>A, XR_243211.1:n.*2060G>A, XR_243212.1:n.*2060G>AVOUS05/14/2018
343POLGEx21NM_002693.2:c.3482+6C>TLRG_500t1:c.*2076G>A, LRG_765t1:c.3482+6C>T, NM_001113378.1:c.*2076G>A, NM_001126131.1:c.3482+6C>T, NM_002693.2:c.3482+6C>T, NM_018193.2:c.*2076G>A, XM_005254946.1:c.*2076G>A, XM_005254947.1:c.*2076G>A, XM_005254948.1:c.*2076G>A, XM_005254949.1:c.*2076G>A, XM_005254950.1:c.*2076G>A, XM_005254951.1:c.*2076G>A, XM_005254952.1:c.*2076G>A, XM_005254953.1:c.*2076G>A, XR_243211.1:n.*2052G>A, XR_243212.1:n.*2052G>AVOUS03/11/2019
344POLGEx21NM_002693.2:c.3482+7G>ALRG_500t1:c.*2075C>T, LRG_765t1:c.3482+7G>A, NM_001113378.1:c.*2075C>T, NM_001126131.1:c.3482+7G>A, NM_002693.2:c.3482+7G>A, NM_018193.2:c.*2075C>T, XM_005254946.1:c.*2075C>T, XM_005254947.1:c.*2075C>T, XM_005254948.1:c.*2075C>T, XM_005254949.1:c.*2075C>T, XM_005254950.1:c.*2075C>T, XM_005254951.1:c.*2075C>T, XM_005254952.1:c.*2075C>T, XM_005254953.1:c.*2075C>T, XR_243211.1:n.*2051C>T, XR_243212.1:n.*2051C>TVOUS09/11/2020
345POLGEx22NM_002693.2:c.3483-19T>GLRG_500t1:c.*1096A>C, LRG_765t1:c.3483-19T>G, NM_001113378.1:c.*1096A>C, NM_001126131.1:c.3483-19T>G, NM_002693.2:c.3483-19T>G, NM_018193.2:c.*1096A>C, XM_005254946.1:c.*1096A>C, XM_005254947.1:c.*1096A>C, XM_005254948.1:c.*1096A>C, XM_005254949.1:c.*1096A>C, XM_005254950.1:c.*1096A>C, XM_005254951.1:c.*1096A>C, XM_005254952.1:c.*1096A>C, XM_005254953.1:c.*1096A>C, XR_243211.1:n.*1072A>C, XR_243212.1:n.*1072A>CBenign04/12/2020 
346POLGEx22NM_002693.2:c.3483-12_3498dupGGTCTCTTTCAGGTGCATGTTTGCCTACVOUS01/06/2021
347POLGEx22NM_002693.2:c.3483-8_3483-3dupTCTTTCVOUS06/06/2019
348POLGEx22NM_002693.2:c.3511A>Cp.Asn1171His | p.N1171HLRG_500t1:c.*1049T>G, LRG_765t1:c.3511A>C, NM_001113378.1:c.*1049T>G, NM_001126131.1:c.3511A>C, NM_002693.2:c.3511A>C, NM_018193.2:c.*1049T>G, XM_005254946.1:c.*1049T>G, XM_005254947.1:c.*1049T>G, XM_005254948.1:c.*1049T>G, XM_005254949.1:c.*1049T>G, XM_005254950.1:c.*1049T>G, XM_005254951.1:c.*1049T>G, XM_005254952.1:c.*1049T>G, XM_005254953.1:c.*1049T>G, XR_243211.1:n.*1025T>G, XR_243212.1:n.*1025T>GVOUS01/29/2018
349POLGEx22NM_002693.2:c.3549C>Tp.Val1183= | p.V1183=LRG_500t1:c.*1011G>A, LRG_765t1:c.3549C>T, NM_001113378.1:c.*1011G>A, NM_001126131.1:c.3549C>T, NM_002693.2:c.3549C>T, NM_018193.2:c.*1011G>A, XM_005254946.1:c.*1011G>A, XM_005254947.1:c.*1011G>A, XM_005254948.1:c.*1011G>A, XM_005254949.1:c.*1011G>A, XM_005254950.1:c.*1011G>A, XM_005254951.1:c.*1011G>A, XM_005254952.1:c.*1011G>A, XM_005254953.1:c.*1011G>A, XR_243211.1:n.*987G>A, XR_243212.1:n.*987G>AVOUS12/03/2020
350POLGEx22NM_002693.2:c.3559C>Tp.Arg1187Trp | p.R1187WLRG_500t1:c.*1001G>A, LRG_765t1:c.3559C>T, NM_001113378.1:c.*1001G>A, NM_001126131.1:c.3559C>T, NM_002693.2:c.3559C>T, NM_018193.2:c.*1001G>A, XM_005254946.1:c.*1001G>A, XM_005254947.1:c.*1001G>A, XM_005254948.1:c.*1001G>A, XM_005254949.1:c.*1001G>A, XM_005254950.1:c.*1001G>A, XM_005254951.1:c.*1001G>A, XM_005254952.1:c.*1001G>A, XM_005254953.1:c.*1001G>A, XR_243211.1:n.*977G>A, XR_243212.1:n.*977G>ALikely benign04/26/2016 
351POLGEx22NM_002693.2:c.3560G>Ap.Arg1187Gln | p.R1187QLRG_500t1:c.*1000C>T, LRG_765t1:c.3560G>A, NM_001113378.1:c.*1000C>T, NM_001126131.1:c.3560G>A, NM_002693.2:c.3560G>A, NM_018193.2:c.*1000C>T, XM_005254946.1:c.*1000C>T, XM_005254947.1:c.*1000C>T, XM_005254948.1:c.*1000C>T, XM_005254949.1:c.*1000C>T, XM_005254950.1:c.*1000C>T, XM_005254951.1:c.*1000C>T, XM_005254952.1:c.*1000C>T, XM_005254953.1:c.*1000C>T, XR_243211.1:n.*976C>T, XR_243212.1:n.*976C>TVOUS10/20/2017
352POLGEx22NM_002693.2:c.3609_3612dupAACTp.Gly1205Asnfs*13 | p.G1205NfsX13LRG_500t1:c.*948_*951dupAGTT, LRG_765t1:c.3609_3612dupAACT, NM_001113378.1:c.*947_*948insAGTT, NM_001113378.1:c.*948_*951dupAGTT, NM_001126131.1:c.3609_3612dupAACT, NM_001126131.1:c.3612_3613insAACT, NM_002693.2:c.3609_3612dupAACT, NM_002693.2:c.3612_3613insAACT, NM_018193.2:c.*947_*948insAGTT, NM_018193.2:c.*948_*951dupAGTT, XM_005254946.1:c.*947_*948insAGTT, XM_005254946.1:c.*948_*951dupAGTT, XM_005254947.1:c.*947_*948insAGTT, XM_005254947.1:c.*948_*951dupAGTT, XM_005254948.1:c.*947_*948insAGTT, XM_005254948.1:c.*948_*951dupAGTT, XM_005254949.1:c.*947_*948insAGTT, XM_005254949.1:c.*948_*951dupAGTT, XM_005254950.1:c.*947_*948insAGTT, XM_005254950.1:c.*948_*951dupAGTT, XM_005254951.1:c.*947_*948insAGTT, XM_005254951.1:c.*948_*951dupAGTT, XM_005254952.1:c.*947_*948insAGTT, XM_005254952.1:c.*948_*951dupAGTT, XM_005254953.1:c.*947_*948insAGTT, XM_005254953.1:c.*948_*951dupAGTT, XR_243211.1:n.*923_*924insAGTT, XR_243211.1:n.*924_*927dupAGTT, XR_243212.1:n.*923_*924insAGTT, XR_243212.1:n.Pathogenic04/13/2020 
353POLGEx22NM_002693.2:c.3630C>Tp.Tyr1210= | p.Y1210=LRG_500t1:c.*930G>A, LRG_765t1:c.3630C>T, NM_001113378.1:c.*930G>A, NM_001126131.1:c.3630C>T, NM_002693.2:c.3630C>T, NM_018193.2:c.*930G>A, XM_005254946.1:c.*930G>A, XM_005254947.1:c.*930G>A, XM_005254948.1:c.*930G>A, XM_005254949.1:c.*930G>A, XM_005254950.1:c.*930G>A, XM_005254951.1:c.*930G>A, XM_005254952.1:c.*930G>A, XM_005254953.1:c.*930G>A, XR_243211.1:n.*906G>A, XR_243212.1:n.*906G>AVOUS03/19/2018
354POLGEx22NM_002693.2:c.3639C>Gp.Pro1213= | p.P1213=LRG_500t1:c.*921G>C, LRG_765t1:c.3639C>G, NM_001113378.1:c.*921G>C, NM_001126131.1:c.3639C>G, NM_002693.2:c.3639C>G, NM_018193.2:c.*921G>C, XM_005254946.1:c.*921G>C, XM_005254947.1:c.*921G>C, XM_005254948.1:c.*921G>C, XM_005254949.1:c.*921G>C, XM_005254950.1:c.*921G>C, XM_005254951.1:c.*921G>C, XM_005254952.1:c.*921G>C, XM_005254953.1:c.*921G>C, XR_243211.1:n.*897G>C, XR_243212.1:n.*897G>CVOUS08/17/2020
355POLGEx22NM_002693.2:c.3643+2T>CLRG_500t1:c.*915A>G, LRG_765t1:c.3643+2T>C, NM_001113378.1:c.*915A>G, NM_001126131.1:c.3643+2T>C, NM_002693.2:c.3643+2T>C, NM_018193.2:c.*915A>G, XM_005254946.1:c.*915A>G, XM_005254947.1:c.*915A>G, XM_005254948.1:c.*915A>G, XM_005254949.1:c.*915A>G, XM_005254950.1:c.*915A>G, XM_005254951.1:c.*915A>G, XM_005254952.1:c.*915A>G, XM_005254953.1:c.*915A>G, XR_243211.1:n.*891A>G, XR_243212.1:n.*891A>GPathogenic06/25/2018 
356POLGEx23NM_002693.2:c.3652C>Tp.Leu1218= | p.L1218=LRG_500t1:c.*360G>A, LRG_765t1:c.3652C>T, NM_001113378.1:c.*360G>A, NM_001126131.1:c.3652C>T, NM_002693.2:c.3652C>T, NM_018193.2:c.*360G>A, XM_005254946.1:c.*360G>A, XM_005254947.1:c.*360G>A, XM_005254948.1:c.*360G>A, XM_005254949.1:c.*360G>A, XM_005254950.1:c.*360G>A, XM_005254951.1:c.*360G>A, XM_005254952.1:c.*360G>A, XM_005254953.1:c.*360G>A, XR_243211.1:n.*336G>A, XR_243212.1:n.*336G>AVOUS02/11/2021
357POLGEx23NM_002693.2:c.3667A>Gp.Ile1223Val | p.I1223VLRG_500t1:c.*345T>C, LRG_765t1:c.3667A>G, NM_001113378.1:c.*345T>C, NM_001126131.1:c.3667A>G, NM_002693.2:c.3667A>G, NM_018193.2:c.*345T>C, XM_005254946.1:c.*345T>C, XM_005254947.1:c.*345T>C, XM_005254948.1:c.*345T>C, XM_005254949.1:c.*345T>C, XM_005254950.1:c.*345T>C, XM_005254951.1:c.*345T>C, XM_005254952.1:c.*345T>C, XM_005254953.1:c.*345T>C, XR_243211.1:n.*321T>C, XR_243212.1:n.*321T>CVOUS09/11/2020
358POLGEx23NM_002693.2:c.3671T>Cp.Ile1224Thr | p.I1224TLRG_500t1:c.*341A>G, LRG_765t1:c.3671T>C, NM_001113378.1:c.*341A>G, NM_001126131.1:c.3671T>C, NM_002693.2:c.3671T>C, NM_018193.2:c.*341A>G, XM_005254946.1:c.*341A>G, XM_005254947.1:c.*341A>G, XM_005254948.1:c.*341A>G, XM_005254949.1:c.*341A>G, XM_005254950.1:c.*341A>G, XM_005254951.1:c.*341A>G, XM_005254952.1:c.*341A>G, XM_005254953.1:c.*341A>G, XR_243211.1:n.*317A>G, XR_243212.1:n.*317A>GVOUS10/03/2019
359POLGEx23NM_002693.2:c.3680C>Ap.Thr1227Asn | p.T1227NLRG_500t1:c.*332G>T, LRG_765t1:c.3680C>A, NM_001113378.1:c.*332G>T, NM_001126131.1:c.3680C>A, NM_002693.2:c.3680C>A, NM_018193.2:c.*332G>T, XM_005254946.1:c.*332G>T, XM_005254947.1:c.*332G>T, XM_005254948.1:c.*332G>T, XM_005254949.1:c.*332G>T, XM_005254950.1:c.*332G>T, XM_005254951.1:c.*332G>T, XM_005254952.1:c.*332G>T, XM_005254953.1:c.*332G>T, XR_243211.1:n.*308G>T, XR_243212.1:n.*308G>TVOUS07/24/2018
360POLGEx23NM_002693.2:c.3691T>Cp.Leu1231= | p.L1231=LRG_500t1:c.*321A>G, LRG_765t1:c.3691T>C, NM_001113378.1:c.*321A>G, NM_001126131.1:c.3691T>C, NM_002693.2:c.3691T>C, NM_018193.2:c.*321A>G, XM_005254946.1:c.*321A>G, XM_005254947.1:c.*321A>G, XM_005254948.1:c.*321A>G, XM_005254949.1:c.*321A>G, XM_005254950.1:c.*321A>G, XM_005254951.1:c.*321A>G, XM_005254952.1:c.*321A>G, XM_005254953.1:c.*321A>G, XR_243211.1:n.*297A>G, XR_243212.1:n.*297A>GVOUS12/13/2019
361POLGEx23NM_002693.2:c.3700C>Gp.Arg1234Gly | p.R1234GLRG_500t1:c.*312G>C, LRG_765t1:c.3700C>G, NM_001113378.1:c.*312G>C, NM_001126131.1:c.3700C>G, NM_002693.2:c.3700C>G, NM_018193.2:c.*312G>C, XM_005254946.1:c.*312G>C, XM_005254947.1:c.*312G>C, XM_005254948.1:c.*312G>C, XM_005254949.1:c.*312G>C, XM_005254950.1:c.*312G>C, XM_005254951.1:c.*312G>C, XM_005254952.1:c.*312G>C, XM_005254953.1:c.*312G>C, XR_243211.1:n.*288G>C, XR_243212.1:n.*288G>CVOUS10/23/2019
362POLGEx23NM_002693.2:c.3700C>Ap.Arg1234= | p.R1234=LRG_500t1:c.*312G>T, LRG_765t1:c.3700C>A, NM_001113378.1:c.*312G>T, NM_001126131.1:c.3700C>A, NM_002693.2:c.3700C>A, NM_018193.2:c.*312G>T, XM_005254946.1:c.*312G>T, XM_005254947.1:c.*312G>T, XM_005254948.1:c.*312G>T, XM_005254949.1:c.*312G>T, XM_005254950.1:c.*312G>T, XM_005254951.1:c.*312G>T, XM_005254952.1:c.*312G>T, XM_005254953.1:c.*312G>T, XR_243211.1:n.*288G>T, XR_243212.1:n.*288G>TBenign05/31/2019 
363POLGEx23NM_002693.2:c.3708G>Tp.Gln1236His | p.Q1236HLRG_500t1:c.*304C>A, LRG_765t1:c.3708G>T, NM_001113378.1:c.*304C>A, NM_001126131.1:c.3708G>T, NM_002693.2:c.3708G>T, NM_018193.2:c.*304C>A, XM_005254946.1:c.*304C>A, XM_005254947.1:c.*304C>A, XM_005254948.1:c.*304C>A, XM_005254949.1:c.*304C>A, XM_005254950.1:c.*304C>A, XM_005254951.1:c.*304C>A, XM_005254952.1:c.*304C>A, XM_005254953.1:c.*304C>A, XR_243211.1:n.*280C>A, XR_243212.1:n.*280C>ABenign03/16/2016 
364POLG2Ex1NM_007215.3:c.238A>Cp.Ser80Arg | p.S80RNM_004396.3:c.*3192A>C, NM_007215.2:c.238A>C, NM_007215.3:c.238A>C, NR_039891.1:n.*4035A>C, NR_039891.2:n.*4043A>C, NR_039969.1:n.*4483A>C, XM_005257111.1:c.*3192A>C, XM_005257112.1:c.*3192A>C, XR_243630.1:n.289A>CVOUS07/24/2019
365POLG2Ex1NM_007215.3:c.514G>Tp.Glu172* | p.E172XNM_004396.3:c.*3468G>T, NM_007215.2:c.514G>T, NM_007215.3:c.514G>T, NR_039891.1:n.*4311G>T, NR_039891.2:n.*4319G>T, NR_039969.1:n.*4759G>T, XM_005257111.1:c.*3468G>T, XM_005257112.1:c.*3468G>T, XR_243630.1:n.565G>TVOUS02/06/2017

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.