Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1PAHEx1NM_000277.1:c.1A>Gp.Met1? | p.M1?NM_000277.1:c.1A>GPathogenic09/29/2015 
2PAHEx1NM_000277.1:c.30C>Gp.Gly10= | p.G10=NM_000277.1:c.30C>GVOUS07/17/2019
3PAHEx1NM_000277.1:c.47_48delCTPathogenic04/02/2014 
4PAHEx1NM_000277.1:c.58C>Tp.Gln20* | p.Q20XNM_000277.1:c.58C>TPathogenic** 
5PAHEx1NM_000277.1:c.60+5G>TNM_000277.1:c.60+5G>TPathogenic11/06/2014 
6PAHEx2NM_000277.1:c.116_118delTCTNM_000277.1:c.116_118delTCTPathogenic10/30/2014 
7PAHEx2NM_000277.1:c.117C>Gp.Phe39Leu | p.F39LNM_000277.1:c.117C>GPathogenic08/08/2016 
8PAHEx2NM_000277.1:c.136G>Ap.Gly46Ser | p.G46SNM_000277.1:c.136G>APathogenic** 
9PAHEx2NM_000277.1:c.143T>Cp.Leu48Ser | p.L48SNM_000277.1:c.143T>CPathogenic12/13/2012 
10PAHEx2NM_000277.1:c.158G>Ap.Arg53His | p.R53HNM_000277.1:c.158G>APathogenic** 
11PAHEx2NM_000277.1:c.165delTNM_000277.1:c.165delTPathogenic08/27/2013 
12PAHEx2NM_000277.1:c.165T>Gp.Phe55Leu | p.F55LNM_000277.1:c.165T>GPathogenic08/07/2012 
13PAHEx2NM_000277.1:c.168+5G>CNM_000277.1:c.168+5G>CPathogenic12/22/2015 
14PAHEx2NM_000277.1:c.168+19T>CNM_000277.1:c.168+19T>CBenign05/16/2017 
15PAHEx3NM_000277.1:c.169-22C>TBenign** 
16PAHEx3NM_000277.1:c.169G>Ap.Glu57Lys | p.E57KNM_000277.1:c.169G>AVOUS09/29/2015
17PAHEx3NM_000277.1:c.194T>Cp.Ile65Thr | p.I65TNM_000277.1:c.194T>CPathogenic07/02/2018 
18PAHEx3NM_000277.1:c.204A>Tp.Arg68Ser | p.R68SNM_000277.1:c.204A>TPathogenic11/13/2017 
19PAHEx3NM_000277.1:c.227A>Gp.Glu76Gly | p.E76GNM_000277.1:c.227A>GPathogenic07/03/2017 
20PAHEx3NM_000277.1:c.232G>Ap.Glu78Lys | p.E78KPathogenic** 
21PAHEx3NM_000277.1:c.250G>Tp.Asp84Tyr | p.D84YNM_000277.1:c.250G>TPathogenic07/16/2014 
22PAHEx3NM_000277.1:c.261C>Ap.Ser87Arg | p.S87RNM_000277.1:c.261C>APathogenic** 
23PAHEx3NM_000277.1:c.284_286delTCAp.Ile95del | p.I95delNM_000277.1:c.284_286delTCAPathogenic02/06/2013 
24PAHEx3NM_000277.1:c.310_318delGCCACTGTCNM_000277.1:c.310_318delGCCACTGTCVOUS09/29/2015
25PAHEx3NM_000277.1:c.311C>Ap.Ala104Asp | p.A104DNM_000277.1:c.311C>APathogenic04/07/2016 
26PAHEx3NM_000277.1:c.331C>Tp.Arg111* | p.R111XNM_000277.1:c.331C>TPathogenic08/08/2019 
27PAHEx4NM_000277.1:c.353-48G>ABenign** 
28PAHEx4NM_000277.1:c.353-22C>TBenign** 
29PAHEx4NM_000277.1:c.355C>Tp.Pro119Ser | p.P119SNM_000277.1:c.355C>TLikely pathogenic05/24/2017 
30PAHEx4NM_000277.1:c.356C>Tp.Pro119Leu | p.P119LNM_000277.1:c.356C>TVOUS09/29/2015
31PAHEx4NM_000277.1:c.357delCp.Trp120Glyfs*75 | p.W120GfsX75NM_000277.1:c.357delCPathogenic05/16/2017 
32PAHEx4NM_000277.1:c.434A>Tp.Asp145Val | p.D145VPathogenic** 
33PAHEx4NM_000277.1:c.440C>Tp.Pro147Leu | p.P147LNM_000277.1:c.440C>TPathogenic06/16/2017 
34PAHEx4NM_000277.1:c.441+1G>ANM_000277.1:c.441+1G>APathogenic11/06/2014 
35PAHEx4NM_000277.1:c.441+5G>TNM_000277.1:c.441+5G>TPathogenic07/22/2014 
36PAHEx4NM_000277.1:c.441+26A>GBenign** 
37PAHEx4NM_000277.1:c.441+47C>TBenign** 
38PAHEx5NM_000277.1:c.442-48G>ABenign** 
39PAHEx5NM_000277.1:c.442-5C>GNM_000277.1:c.442-5C>GPathogenic11/23/2016 
40PAHEx5NM_000277.1:c.442-1G>ANM_000277.1:c.442-1G>APathogenic08/08/2014 
41PAHEx5NM_000277.1:c.464G>Cp.Arg155Pro | p.R155PNM_000277.1:c.464G>CVOUS09/29/2015
42PAHEx5NM_000277.1:c.472C>Tp.Arg158Trp | p.R158WNM_000277.1:c.472C>TPathogenic** 
43PAHEx5NM_000277.1:c.473G>Ap.Arg158Gln | p.R158QNM_000277.1:c.473G>APathogenic10/26/2016 
44PAHEx5NM_000277.1:c.500A>Tp.Asn167Ile | p.N167INM_000277.1:c.500A>TVOUS01/04/2017
45PAHEx5NM_000277.1:c.503delANM_000277.1:c.503delAPathogenic09/04/2015 
46PAHEx5NM_000277.1:c.506G>Ap.Arg169His | p.R169HNM_000277.1:c.506G>AVOUS01/02/2018
47PAHEx5NM_000277.1:c.508C>Gp.His170Asp | p.H170DNM_000277.1:c.508C>GPathogenic08/14/2013 
48PAHEx5NM_000277.1:c.509+1G>APathogenic** 
49PAHEx6NM_000277.1:c.510-20_510-18dupATTBenign12/21/2012 
50PAHEx6NM_000277.1:c.520A>Gp.Ile174Val | p.I174VNM_000277.1:c.520A>GVOUS09/29/2015
51PAHEx6NM_000277.1:c.526C>Tp.Arg176* | p.R176XNM_000277.1:c.526C>TPathogenic08/08/2014 
52PAHEx6NM_000277.1:c.527G>Tp.Arg176Leu | p.R176LNM_000277.1:c.527G>TPathogenic07/30/2015 
53PAHEx6NM_000277.1:c.533A>Gp.Glu178Gly | p.E178GNM_000277.1:c.533A>GPathogenic05/17/2017 
54PAHEx6NM_000277.1:c.535T>Ap.Tyr179Asn | p.Y179NNM_000277.1:c.535T>AVOUS09/29/2015
55PAHEx6NM_000277.1:c.561G>Ap.Trp187* | p.W187XPathogenic** 
56PAHEx6NM_000277.1:c.569T>Cp.Val190Ala | p.V190ANM_000277.1:c.569T>CPathogenic** 
57PAHEx6NM_000277.1:c.580_581delCPathogenic** 
58PAHEx6NM_000277.1:c.590T>Gp.Leu197Trp | p.L197WNM_000277.1:c.590T>GVOUS09/29/2015
59PAHEx6NM_000277.1:c.592_613delTATAAAACCCATGCTTGCTATGp.Tyr198Serfs*136 | p.Y198SfsX136NM_000277.1:c.592_613delTATAAAACCCATGCTTGCTATGPathogenic05/10/2019 
60PAHEx6NM_000277.1:c.607T>Ap.Cys203Ser | p.C203SNM_000277.1:c.607T>AVOUS05/10/2021
61PAHEx6NM_000277.1:c.611A>Gp.Tyr204Cys | p.Y204CPathogenic** 
62PAHEx6NM_000277.1:c.638T>Cp.Leu213Pro | p.L213PPathogenic08/14/2012 
63PAHEx6NM_000277.1:c.648C>Gp.Tyr216* | p.Y216XNM_000277.1:c.648C>GPathogenic11/19/2014 
64PAHEx6NM_000277.1:c.653G>Tp.Gly218Val | p.G218VNM_000277.1:c.653G>TPathogenic** 
65PAHEx6NM_000277.1:c.673C>Gp.Pro225Ala | p.P225ANM_000277.1:c.673C>GPathogenic** 
66PAHEx6NM_000277.1:c.696G>Ap.Gln232= | p.Q232=NM_000277.1:c.696G>ABenign02/13/2019 
67PAHEx7NM_000277.1:c.1G>APathogenic** 
68PAHEx7NM_000277.1:c.707-7A>TNM_000277.1:c.707-7A>TBenign02/25/2014 
69PAHEx7NM_000277.1:c.716G>Tp.Gly239Val | p.G239VNM_000277.1:c.716G>TVOUS09/29/2015
70PAHEx7NM_000277.1:c.721C>Tp.Arg241Cys | p.R241CNM_000277.1:c.721C>TPathogenic07/28/2016 
71PAHEx7NM_000277.1:c.722G>Ap.Arg241His | p.R241HNM_000277.1:c.722G>APathogenic** 
72PAHEx7NM_000277.1:c.727C>Tp.Arg243* | p.R243XNM_000277.1:c.727C>TPathogenic06/20/2013 
73PAHEx7NM_000277.1:c.728G>Ap.Arg243Gln | p.R243QNM_000277.1:c.728G>APathogenic02/07/2017 
74PAHEx7NM_000277.1:c.733G>Cp.Val245Leu | p.V245LNM_000277.1:c.733G>CPathogenic07/08/2016 
75PAHEx7NM_000277.1:c.734T>Cp.Val245Ala | p.V245ANM_000277.1:c.734T>CPathogenic07/02/2015 
76PAHEx7NM_000277.1:c.735G>Ap.Val245= | p.V245=NM_000277.1:c.735G>ABenign02/10/2018 
77PAHEx7NM_000277.1:c.737C>Ap.Ala246Asp | p.A246DNM_000277.1:c.737C>APathogenic** 
78PAHEx7NM_000277.1:c.740G>Tp.Gly247Val | p.G247VNM_000277.1:c.740G>TPathogenic11/13/2017 
79PAHEx7NM_000277.1:c.745C>Tp.Leu249Phe | p.L249FNM_000277.1:c.745C>TPathogenic04/30/2014 
80PAHEx7NM_000277.1:c.752C>Tp.Ser251Phe | p.S251FNM_000277.1:c.752C>TVOUS**
81PAHEx7NM_000277.1:c.754C>Tp.Arg252Trp | p.R252WNM_000277.1:c.754C>TPathogenic11/13/2017 
82PAHEx7NM_000277.1:c.755G>Ap.Arg252Gln | p.R252QNM_000277.1:c.755G>APathogenic04/28/2015 
83PAHEx7NM_000277.1:c.781C>Tp.Arg261* | p.R261XNM_000277.1:c.781C>TPathogenic02/23/2015 
84PAHEx7NM_000277.1:c.782G>Ap.Arg261Gln | p.R261QNM_000277.1:c.782G>APathogenic03/31/2019 
85PAHEx7NM_000277.1:c.805A>Cp.Ile269Leu | p.I269LNM_000277.1:c.805A>CPathogenic06/12/2015 
86PAHEx7NM_000277.1:c.806delTp.Ile269Thrfs*72 | p.I269TfsX72NM_000277.1:c.806delTPathogenic06/14/2017 
87PAHEx7NM_000277.1:c.809G>Ap.Arg270Lys | p.R270KNM_000277.1:c.809G>APathogenic01/15/2014 
88PAHEx7NM_000277.1:c.814G>Tp.Gly272* | p.G272XPathogenic** 
89PAHEx7NM_000277.1:c.818C>Tp.Ser273Phe | p.S273FPathogenic** 
90PAHEx7NM_000277.1:c.823C>Tp.Pro275Ser | p.P275SNM_000277.1:c.823C>TPathogenic** 
91PAHEx7NM_000277.1:c.829T>Gp.Tyr277Asp | p.Y277DNM_000277.1:c.829T>GPathogenic05/15/2014 
92PAHEx7NM_000277.1:c.838G>Ap.Glu280Lys | p.E280KNM_000277.1:c.838G>APathogenic03/02/2017 
93PAHEx7NM_000277.1:c.841C>Tp.Pro281Ser | p.P281SNM_000277.1:c.841C>TVOUS09/29/2015
94PAHEx7NM_000277.1:c.842C>Tp.Pro281Leu | p.P281LNM_000277.1:c.842C>TPathogenic01/26/2017 
95PAHEx7NM_000277.1:c.842+3G>CNM_000277.1:c.842+3G>CPathogenic07/20/2018 
96PAHEx7NM_000277.1:c.842+5G>APathogenic** 
97PAHEx8NM_000277.1:c.844G>Ap.Asp282Asn | p.D282NNM_000277.1:c.844G>APathogenic** 
98PAHEx8NM_000277.1:c.847A>Tp.Ile283Phe | p.I283FNM_000277.1:c.847A>TPathogenic10/31/2016 
99PAHEx8NM_000277.1:c.890G>Ap.Arg297His | p.R297HPathogenic12/21/2012 
100PAHEx8NM_000277.1:c.896T>Gp.Phe299Cys | p.F299CNM_000277.1:c.896T>GPathogenic01/08/2015 
101PAHEx8NM_000277.1:c.898G>Tp.Ala300Ser | p.A300SNM_000277.1:c.898G>TPathogenic06/16/2017 
102PAHEx8NM_000277.1:c.912+1G>ANM_000277.1:c.912+1G>APathogenic01/26/2017 
103PAHEx9NM_000277.1:c.913-7A>GNM_000277.1:c.913-7A>GPathogenic11/18/2016 
104PAHEx9NM_000277.1:c.916A>Gp.Ile306Val | p.I306VPathogenic** 
105PAHEx9NM_000277.1:c.926C>Tp.Ala309Val | p.A309VPathogenic08/07/2012 
106PAHEx9NM_000277.1:c.926C>Ap.Ala309Asp | p.A309DPathogenic** 
107PAHEx9NM_000277.1:c.955G>Tp.Glu319* | p.E319XPathogenic01/21/2013 
108PAHEx9NM_000277.1:c.963C>Tp.Leu321= | p.L321=NM_000277.1:c.963C>TBenign** 
109PAHEx9NM_000277.1:c.969+43G>TBenign02/22/2013 
110PAHEx10NM_000277.1:c.970-1G>CNM_000277.1:c.970-1G>CPathogenic01/04/2018 
111PAHEx10NM_000277.1:c.974A>Gp.Tyr325Cys | p.Y325CPathogenic08/14/2012 
112PAHEx10NM_000277.1:c.983C>Tp.Thr328Ile | p.T328INM_000277.1:c.983C>TVOUS09/29/2015
113PAHEx10NM_000277.1:c.1002C>Tp.Cys334= | p.C334=NM_000277.1:c.1002C>TVOUS03/03/2016
114PAHEx10NM_000277.1:c.1003A>Gp.Lys335Glu | p.K335ENM_000277.1:c.1003A>GVOUS09/29/2015
115PAHEx10NM_000277.1:c.1030G>Ap.Gly344Ser | p.G344SPathogenic** 
116PAHEx10NM_000277.1:c.1033G>Tp.Ala345Ser | p.A345SNM_000277.1:c.1033G>TPathogenic** 
117PAHEx10NM_000277.1:c.1042C>Gp.Leu348Val | p.L348VNM_000277.1:c.1042C>GPathogenic05/20/2014 
118PAHEx10NM_000277.1:c.1045T>Cp.Ser349Pro | p.S349PNM_000277.1:c.1045T>CPathogenic01/15/2018 
119PAHEx10NM_000277.1:c.1055delGNM_000277.1:c.1055delGPathogenic06/29/2016 
120PAHEx10NM_000277.1:c.1065+3A>GNM_000277.1:c.1065+3A>GVOUS09/29/2015
121PAHEx11NM_000277.1:c.1066-11G>ANM_000277.1:c.1066-11G>APathogenic02/14/2018 
122PAHEx11NM_000277.1:c.1066-3C>TNM_000277.1:c.1066-3C>TPathogenic11/06/2014 
123PAHEx11NM_000277.1:c.1068C>Ap.Tyr356* | p.Y356XNM_000277.1:c.1068C>APathogenic11/11/2013 
124PAHEx11NM_000277.1:c.1139C>Tp.Thr380Met | p.T380MNM_000277.1:c.1139C>TPathogenic08/08/2016 
125PAHEx11NM_000277.1:c.1155C>Gp.Leu385= | p.L385=NM_000277.1:c.1155C>GBenign02/13/2019 
126PAHEx11NM_000277.1:c.1156T>Cp.Tyr386His | p.Y386HNM_000277.1:c.1156T>CVOUS09/29/2015
127PAHEx11NM_000277.1:c.1162G>Ap.Val388Met | p.V388MNM_000277.1:c.1162G>APathogenic01/10/2017 
128PAHEx11NM_000277.1:c.1166delCPathogenic** 
129PAHEx11NM_000277.1:c.1169A>Gp.Glu390Gly | p.E390GNM_000277.1:c.1169A>GPathogenic10/30/2019 
130PAHEx11NM_000277.1:c.1184C>Ap.Ala395Asp | p.A395DPathogenic** 
131PAHEx11NM_000277.1:c.1197A>Tp.Val399= | p.V399=NM_000277.1:c.1197A>TPathogenic08/08/2019 
132PAHEx11NM_000277.1:c.1198A>Cp.Arg400= | p.R400=NM_000277.1:c.1198A>CVOUS09/29/2015
133PAHEx11NM_000277.1:c.1199G>Cp.Arg400Thr | p.R400TNM_000277.1:c.1199G>CPathogenic06/16/2017 
134PAHEx11NM_000277.1:c.1199+17G>ANM_000277.1:c.1199+17G>ALikely pathogenic04/29/2016 
135PAHEx12NM_000277.1:c.1200-35C>TNM_000277.1:c.1200-35C>TLikely benign09/29/2015 
136PAHEx12NM_000277.1:c.1200-1G>ANM_000277.1:c.1200-1G>APathogenic07/27/2015 
137PAHEx12NM_000277.1:c.1208C>Tp.Ala403Val | p.A403VNM_000277.1:c.1208C>TPathogenic04/26/2017 
138PAHEx12NM_000277.1:c.1210G>Cp.Ala404Pro | p.A404PNM_000277.1:c.1210G>CVOUS12/22/2015
139PAHEx12NM_000277.1:c.1222C>Tp.Arg408Trp | p.R408WNM_000277.1:c.1222C>TPathogenic05/03/2017 
140PAHEx12NM_000277.1:c.1223G>Ap.Arg408Gln | p.R408QNM_000277.1:c.1223G>APathogenic06/29/2017 
141PAHEx12NM_000277.1:c.1238G>Cp.Arg413Pro | p.R413PNM_000277.1:c.1238G>CPathogenic02/07/2017 
142PAHEx12NM_000277.1:c.1241A>Gp.Tyr414Cys | p.Y414CNM_000277.1:c.1241A>GPathogenic02/10/2018 
143PAHEx12NM_000277.1:c.1242C>Tp.Tyr414= | p.Y414=NM_000277.1:c.1242C>TBenign02/18/2015 
144PAHEx12NM_000277.1:c.1243G>Ap.Asp415Asn | p.D415NNM_000277.1:c.1243G>APathogenic11/17/2015 
145PAHEx12NM_000277.1:c.1278T>Cp.Asn426= | p.N426=NM_000277.1:c.1278T>CBenign02/13/2019 
146PAHEx12NM_000277.1:c.1286A>Cp.Gln429Pro | p.Q429PNM_000277.1:c.1286A>CVOUS09/29/2015
147PAHEx12NM_000277.1:c.1315+1G>ANM_000277.1:c.1315+1G>APathogenic05/03/2017 
148PAHEx13NM_000277.1:c.*1_*2delAGPathogenic** 
149PAHEx13NM_000277.1:c.1316-35C>TNM_000277.1:c.1316-35C>TBenign** 
150PAHEx13NM_000277.1:c.1352_1356delTAAAGNM_000277.1:c.1352_1356delTAAAGPathogenic02/02/2015 
151PAHEx13NM_000277.1:c.1357_*2delTAAAGNM_000277.1:c.1357_*2delTAAAGLikely pathogenic04/08/2020 
152PAHEx13NM_000277.1:c.1357_1359delTAAPathogenic** 

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.