Loading Data . . .

EmVClass

EGL's Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by EGL Genetics for that gene.
EGL Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1NIPBLEx2NM_133433.3:c.42G>Ap.Ala14= | p.A14=NM_015384.4:c.42G>A, NM_133433.3:c.42G>ALikely benign03/18/2014 
2NIPBLEx2NM_133433.3:c.59C>Gp.Thr20Arg | p.T20RNM_015384.4:c.59C>G, NM_133433.3:c.59C>G, XM_005248280.1:c.59C>G, XM_005248281.1:c.-4478C>GVOUS02/14/2020
3NIPBLEx3NM_133433.3:c.126T>Cp.Phe42= | p.F42=VOUS02/25/2014
4NIPBLEx3NM_133433.3:c.133C>Tp.Arg45* | p.R45XNM_015384.4:c.133C>T, NM_133433.3:c.133C>T, XM_005248280.1:c.133C>T, XM_005248281.1:c.-2693C>TPathogenic04/15/2015 
5NIPBLEx3NM_133433.3:c.198C>Gp.Val66= | p.V66=NM_015384.4:c.198C>G, NM_133433.3:c.198C>GLikely benign02/13/2015 
6NIPBLEx4NM_133433.3:c.294C>Tp.Ala98= | p.A98=NM_015384.4:c.294C>T, NM_133433.3:c.294C>TBenign01/16/2014 
7NIPBLEx5NM_133433.3:c.385T>Cp.Ser129Pro | p.S129PNM_015384.4:c.385T>C, NM_133433.3:c.385T>C, XM_005248280.1:c.385T>C, XM_005248281.1:c.25T>CVOUS12/13/2018
8NIPBLEx5NM_133433.3:c.458+7T>CNM_015384.4:c.458+7T>C, NM_133433.3:c.458+7T>C, XM_005248280.1:c.458+7T>C, XM_005248281.1:c.98+7T>CVOUS04/08/2015
9NIPBLEx6NM_133433.3:c.535G>Ap.Ala179Thr | p.A179TNM_015384.4:c.535G>A, NM_133433.3:c.535G>A, XM_005248280.1:c.535G>A, XM_005248281.1:c.175G>ABenign03/25/2015 
10NIPBLEx6NM_133433.3:c.592delCNM_015384.4:c.592delC, NM_133433.3:c.592delC, XM_005248280.1:c.592delC, XM_005248281.1:c.232delCPathogenic04/22/2016 
11NIPBLEx7NM_133433.3:c.615G>Ap.Ser205= | p.S205=NM_015384.4:c.615G>A, NM_133433.3:c.615G>A, XM_005248280.1:c.615G>A, XM_005248281.1:c.255G>A, XM_005248282.1:c.-861G>AVOUS09/13/2016
12NIPBLEx7NM_133433.3:c.697A>Gp.Asn233Asp | p.N233DNM_015384.4:c.697A>G, NM_133433.3:c.697A>GVOUS01/17/2014
13NIPBLEx7NM_133433.3:c.771+1G>ANM_015384.4:c.771+1G>A, NM_133433.3:c.771+1G>A, XM_005248280.1:c.771+1G>A, XM_005248281.1:c.411+1G>A, XM_005248282.1:c.-704G>APathogenic10/05/2015 
14NIPBLEx8NM_133433.3:c.772-8A>GNM_015384.4:c.772-8A>G, NM_133433.3:c.772-8A>GVOUS08/13/2013
15NIPBLEx8NM_133433.3:c.862C>Ap.Pro288Thr | p.P288TNM_015384.4:c.862C>A, NM_133433.3:c.862C>A, XM_005248280.1:c.862C>A, XM_005248281.1:c.502C>A, XM_005248282.1:c.202C>ALikely benign11/25/2015 
16NIPBLEx9NM_133433.3:c.927delTinsACAp.Asp309Glufs*9 | p.D309EfsX9NM_015384.4:c.927delinsACA, NM_133433.3:c.927delinsACA, XM_005248280.1:c.927delinsACA, XM_005248281.1:c.567delinsACA, XM_005248282.1:c.267delinsACAPathogenic04/19/2018 
17NIPBLEx9NM_133433.3:c.1017T>Cp.Ser339= | p.S339=NM_015384.4:c.1017T>C, NM_133433.3:c.1017T>C, XM_005248280.1:c.1017T>C, XM_005248281.1:c.657T>C, XM_005248282.1:c.357T>CVOUS01/12/2016
18NIPBLEx9NM_133433.3:c.1077A>Gp.Thr359= | p.T359=NM_015384.4:c.1077A>G, NM_133433.3:c.1077A>G, XM_005248280.1:c.1077A>G, XM_005248281.1:c.717A>G, XM_005248282.1:c.417A>GVOUS10/09/2015
19NIPBLEx9NM_133433.3:c.1151A>Gp.Asn384Ser | p.N384SNM_015384.4:c.1151A>G, NM_133433.3:c.1151A>G, XM_005248280.1:c.1151A>G, XM_005248281.1:c.791A>G, XM_005248282.1:c.491A>GBenign02/23/2016 
20NIPBLEx9NM_133433.3:c.1221A>Gp.Pro407= | p.P407=NM_015384.4:c.1221A>G, NM_133433.3:c.1221A>G, XM_005248280.1:c.1221A>G, XM_005248281.1:c.861A>G, XM_005248282.1:c.561A>GVOUS07/16/2015
21NIPBLEx9NM_133433.3:c.1392T>Ap.Pro464= | p.P464=NM_015384.4:c.1392T>A, NM_133433.3:c.1392T>A, XM_005248280.1:c.1392T>A, XM_005248281.1:c.1032T>A, XM_005248282.1:c.732T>AVOUS02/17/2015
22NIPBLEx9NM_133433.3:c.1456A>Gp.Ile486Val | p.I486VNM_015384.4:c.1456A>G, NM_133433.3:c.1456A>G, XM_005248280.1:c.1456A>G, XM_005248281.1:c.1096A>G, XM_005248282.1:c.796A>GVOUS08/08/2016
23NIPBLEx9NM_133433.3:c.1495+8_1495+10delAATNM_015384.4:c.1495+8_1495+10delAAT, NM_133433.3:c.1495+8_1495+10delAAT, XM_005248280.1:c.1495+8_1495+10delAAT, XM_005248281.1:c.1135+8_1135+10delAAT, XM_005248282.1:c.835+8_835+10delAATBenign03/16/2015 
24NIPBLEx10NM_133433.3:c.1526C>Gp.Ser509Cys | p.S509CNM_015384.4:c.1526C>G, NM_133433.3:c.1526C>G, XM_005248280.1:c.1526C>G, XM_005248281.1:c.1166C>G, XM_005248282.1:c.866C>G, XM_005248283.1:c.-92C>GLikely benign06/07/2018 
25NIPBLEx10NM_133433.3:c.1582A>Tp.Thr528Ser | p.T528SNM_015384.4:c.1582A>T, NM_133433.3:c.1582A>T, XM_005248280.1:c.1582A>T, XM_005248281.1:c.1222A>T, XM_005248282.1:c.922A>T, XM_005248283.1:c.-36A>TVOUS05/26/2014
26NIPBLEx10NM_133433.3:c.1678G>Tp.Asp560Tyr | p.D560YNM_015384.4:c.1678G>T, NM_133433.3:c.1678G>T, XM_005248280.1:c.1678G>T, XM_005248281.1:c.1318G>T, XM_005248282.1:c.1018G>T, XM_005248283.1:c.61G>TVOUS03/28/2019
27NIPBLEx10NM_133433.3:c.1833T>Ap.Ser611Arg | p.S611RNM_015384.4:c.1833T>A, NM_133433.3:c.1833T>A, XM_005248280.1:c.1833T>A, XM_005248281.1:c.1473T>A, XM_005248282.1:c.1173T>A, XM_005248283.1:c.216T>AVOUS09/10/2014
28NIPBLEx10NM_133433.3:c.1885C>Tp.Arg629* | p.R629XNM_015384.4:c.1885C>T, NM_133433.3:c.1885C>T, XM_005248280.1:c.1885C>T, XM_005248281.1:c.1525C>T, XM_005248282.1:c.1225C>T, XM_005248283.1:c.268C>TPathogenic10/05/2015 
29NIPBLEx10NM_133433.3:c.1965G>Tp.Glu655Asp | p.E655DBenign02/28/2014 
30NIPBLEx10NM_133433.3:c.1985A>Gp.Lys662Arg | p.K662RNM_015384.4:c.1985A>G, NM_133433.3:c.1985A>GLikely benign08/16/2012 
31NIPBLEx10NM_133433.3:c.1988A>Cp.Gln663Pro | p.Q663PVOUS02/28/2014
32NIPBLEx10NM_133433.3:c.2016dupANM_015384.4:c.2016dup, NM_133433.3:c.2016dupPathogenic** 
33NIPBLEx10NM_133433.3:c.2021A>Gp.Asn674Ser | p.N674SNM_015384.4:c.2021A>G, NM_133433.3:c.2021A>GBenign01/02/2014 
34NIPBLEx10NM_133433.3:c.2081A>Gp.Glu694Gly | p.E694GNM_015384.4:c.2081A>G, NM_133433.3:c.2081A>G, XM_005248280.1:c.2081A>G, XM_005248281.1:c.1721A>G, XM_005248282.1:c.1421A>G, XM_005248283.1:c.464A>GVOUS02/16/2016
35NIPBLEx10NM_133433.3:c.2171C>Tp.Thr724Ile | p.T724INM_015384.4:c.2171C>T, NM_133433.3:c.2171C>T, XM_005248280.1:c.2171C>T, XM_005248281.1:c.1811C>T, XM_005248282.1:c.1511C>T, XM_005248283.1:c.554C>TVOUS08/12/2015
36NIPBLEx10NM_133433.3:c.2218_2250delGGTGAGAGCCGCCCTGAAACTCCAAAGCAAAAANM_015384.4:c.2218_2250delGGTGAGAGCCGCCCTGAAACTCCAAAGCAAAAA, NM_133433.3:c.2218_2250delGGTGAGAGCCGCCCTGAAACTCCAAAGCAAAAA, XM_005248280.1:c.2218_2250delGGTGAGAGCCGCCCTGAAACTCCAAAGCAAAAA, XM_005248281.1:c.1858_1890delGGTGAGAGCCGCCCTGAAACTCCAAAGCAAAAA, XM_005248282.1:c.1558_1590delGGTGAGAGCCGCCCTGAAACTCCAAAGCAAAAA, XM_005248283.1:c.601_633delGGTGAGAGCCGCCCTGAAACTCCAAAGCAAAAAVOUS10/25/2016
37NIPBLEx10NM_133433.3:c.2219G>Ap.Gly740Asp | p.G740DNM_015384.4:c.2219G>A, NM_133433.3:c.2219G>A, XM_005248280.1:c.2219G>A, XM_005248281.1:c.1859G>A, XM_005248282.1:c.1559G>A, XM_005248283.1:c.602G>AVOUS02/06/2017
38NIPBLEx10NM_133433.3:c.2256A>Gp.Glu752= | p.E752=NM_015384.4:c.2256A>G, NM_133433.3:c.2256A>G, XM_005248280.1:c.2256A>G, XM_005248281.1:c.1896A>G, XM_005248282.1:c.1596A>G, XM_005248283.1:c.639A>GBenign11/20/2019 
39NIPBLEx10NM_133433.3:c.2294G>Ap.Arg765Lys | p.R765KNM_015384.4:c.2294G>A, NM_133433.3:c.2294G>A, XM_005248280.1:c.2294G>A, XM_005248281.1:c.1934G>A, XM_005248282.1:c.1634G>A, XM_005248283.1:c.677G>ALikely benign04/27/2016 
40NIPBLEx10NM_133433.3:c.2439A>Cp.Ser813= | p.S813=NM_015384.4:c.2439A>C, NM_133433.3:c.2439A>C, XM_005248280.1:c.2439A>C, XM_005248281.1:c.2079A>C, XM_005248282.1:c.1779A>C, XM_005248283.1:c.822A>CVOUS05/12/2016
41NIPBLEx10NM_133433.3:c.2447G>Ap.Arg816His | p.R816HVOUS04/30/2013
42NIPBLEx10NM_133433.3:c.2469A>Gp.Lys823= | p.K823=NM_015384.4:c.2469A>G, NM_133433.3:c.2469A>G, XM_005248280.1:c.2469A>G, XM_005248281.1:c.2109A>G, XM_005248282.1:c.1809A>G, XM_005248283.1:c.852A>GBenign06/04/2014 
43NIPBLEx10NM_133433.3:c.2479_2480delAGPathogenic08/03/2012 
44NIPBLEx10NM_133433.3:c.2602C>Tp.Arg868* | p.R868XNM_015384.4:c.2602C>T, NM_133433.3:c.2602C>T, XM_005248280.1:c.2602C>T, XM_005248281.1:c.2242C>T, XM_005248282.1:c.1942C>T, XM_005248283.1:c.985C>TPathogenic09/07/2012 
45NIPBLEx10NM_133433.3:c.2603G>Ap.Arg868Gln | p.R868QNM_015384.4:c.2603G>A, NM_133433.3:c.2603G>A, XM_005248280.1:c.2603G>A, XM_005248281.1:c.2243G>A, XM_005248282.1:c.1943G>A, XM_005248283.1:c.986G>AVOUS06/25/2018
46NIPBLEx10NM_133433.3:c.2626dupGNM_015384.4:c.2626dup, NM_133433.3:c.2626dupPathogenic05/30/2013 
47NIPBLEx10NM_133433.3:c.2727T>Cp.Gly909= | p.G909=NM_015384.4:c.2727T>C, NM_133433.3:c.2727T>C, XM_005248280.1:c.2727T>C, XM_005248281.1:c.2367T>C, XM_005248282.1:c.2067T>C, XM_005248283.1:c.1110T>CLikely benign04/22/2016 
48NIPBLEx10NM_133433.3:c.2743A>Gp.Ser915Gly | p.S915GNM_015384.4:c.2743A>G, NM_133433.3:c.2743A>G, XM_005248280.1:c.2743A>G, XM_005248281.1:c.2383A>G, XM_005248282.1:c.2083A>G, XM_005248283.1:c.1126A>GVOUS09/04/2014
49NIPBLEx10NM_133433.3:c.2945C>Tp.Pro982Leu | p.P982LNM_015384.4:c.2945C>T, NM_133433.3:c.2945C>T, XM_005248280.1:c.2945C>T, XM_005248281.1:c.2585C>T, XM_005248282.1:c.2285C>T, XM_005248283.1:c.1328C>TVOUS10/30/2015
50NIPBLEx10NM_133433.3:c.3015A>Gp.Leu1005= | p.L1005=NM_015384.4:c.3015A>G, NM_133433.3:c.3015A>G, XM_005248280.1:c.3015A>G, XM_005248281.1:c.2655A>G, XM_005248282.1:c.2355A>G, XM_005248283.1:c.1398A>GBenign06/04/2014 
51NIPBLEx10NM_133433.3:c.3018A>Gp.Gln1006= | p.Q1006=NM_015384.4:c.3018A>G, NM_133433.3:c.3018A>G, XM_005248280.1:c.3018A>G, XM_005248281.1:c.2658A>G, XM_005248282.1:c.2358A>G, XM_005248283.1:c.1401A>GVOUS05/30/2019
52NIPBLEx10NM_133433.3:c.3084dupTp.Lys1029* | p.K1029XNM_015384.4:c.3084dupT, NM_133433.3:c.3084dupT, XM_005248280.1:c.3084dupT, XM_005248281.1:c.2724dupT, XM_005248282.1:c.2424dupT, XM_005248283.1:c.1467dupTPathogenic01/23/2018 
53NIPBLEx12NM_133433.3:c.3429T>Cp.Gly1143= | p.G1143=NM_015384.4:c.3429T>C, NM_133433.3:c.3429T>C, XM_005248280.1:c.3429T>C, XM_005248281.1:c.3069T>C, XM_005248282.1:c.2769T>C, XM_005248283.1:c.1812T>CVOUS12/20/2018
54NIPBLEx12NM_133433.3:c.3481C>Tp.Pro1161Ser | p.P1161SNM_015384.4:c.3481C>T, NM_133433.3:c.3481C>T, XM_005248280.1:c.3481C>T, XM_005248281.1:c.3121C>T, XM_005248282.1:c.2821C>T, XM_005248283.1:c.1864C>TVOUS10/21/2014
55NIPBLEx14NM_133433.3:c.3575-17A>GNM_015384.4:c.3575-17A>G, NM_133433.3:c.3575-17A>GBenign01/02/2014 
56NIPBLEx14NM_133433.3:c.3659C>Tp.Ala1220Val | p.A1220VNM_015384.4:c.3659C>T, NM_133433.3:c.3659C>T, XM_005248280.1:c.3659C>T, XM_005248281.1:c.3299C>T, XM_005248282.1:c.2999C>T, XM_005248283.1:c.2042C>TVOUS01/02/2018
57NIPBLEx16NM_133433.3:c.3855+2T>CNM_015384.4:c.3855+2T>C, NM_133433.3:c.3855+2T>C, XM_005248280.1:c.3855+2T>C, XM_005248281.1:c.3495+2T>C, XM_005248282.1:c.3195+2T>C, XM_005248283.1:c.2238+2T>CPathogenic12/21/2015 
58NIPBLEx17NM_133433.3:c.3897T>Cp.Leu1299= | p.L1299=NM_015384.4:c.3897T>C, NM_133433.3:c.3897T>C, XM_005248280.1:c.3897T>C, XM_005248281.1:c.3537T>C, XM_005248282.1:c.3237T>C, XM_005248283.1:c.2280T>CBenign09/25/2015 
59NIPBLEx17NM_133433.3:c.3938C>Ap.Thr1313Lys | p.T1313KNM_015384.4:c.3938C>A, NM_133433.3:c.3938C>A, XM_005248280.1:c.3938C>A, XM_005248281.1:c.3578C>A, XM_005248282.1:c.3278C>A, XM_005248283.1:c.2321C>AVOUS07/20/2015
60NIPBLEx17NM_133433.3:c.3978T>Cp.Ala1326= | p.A1326=NM_015384.4:c.3978T>C, NM_133433.3:c.3978T>C, XM_005248280.1:c.3978T>C, XM_005248281.1:c.3618T>C, XM_005248282.1:c.3318T>C, XM_005248283.1:c.2361T>CVOUS12/09/2015
61NIPBLEx18NM_133433.3:c.4161T>Cp.Tyr1387= | p.Y1387=NM_015384.4:c.4161T>C, NM_133433.3:c.4161T>C, XM_005248280.1:c.4161T>C, XM_005248281.1:c.3801T>C, XM_005248282.1:c.3501T>C, XM_005248283.1:c.2544T>CVOUS04/09/2015
62NIPBLEx19NM_133433.3:c.4240-14T>GNM_015384.4:c.4240-14T>G, NM_133433.3:c.4240-14T>G, XM_005248280.1:c.4240-14T>G, XM_005248281.1:c.3880-14T>G, XM_005248282.1:c.3580-14T>G, XM_005248283.1:c.2623-14T>GBenign05/26/2016 
63NIPBLEx20NM_133433.3:c.4321G>Tp.Val1441Leu | p.V1441LNM_015384.4:c.4321G>T, NM_133433.3:c.4321G>T, XM_005248280.1:c.4321G>T, XM_005248281.1:c.3961G>T, XM_005248282.1:c.3661G>T, XM_005248283.1:c.2704G>TPathogenic08/18/2016 
64NIPBLEx20NM_133433.3:c.4421+7A>GBenign01/23/2013 
65NIPBLEx21NM_133433.3:c.4429A>Cp.Ser1477Arg | p.S1477RNM_015384.4:c.4429A>C, NM_133433.3:c.4429A>C, XM_005248280.1:c.4429A>C, XM_005248281.1:c.4069A>C, XM_005248282.1:c.3769A>C, XM_005248283.1:c.2812A>CVOUS02/20/2017
66NIPBLEx21NM_133433.3:c.4520C>Tp.Ser1507Leu | p.S1507LNM_015384.4:c.4520C>T, NM_133433.3:c.4520C>T, XM_005248280.1:c.4520C>T, XM_005248281.1:c.4160C>T, XM_005248282.1:c.3860C>T, XM_005248283.1:c.2903C>TVOUS04/01/2015
67NIPBLEx22NM_133433.3:c.4561-9T>ABenign01/23/2013 
68NIPBLEx22NM_133433.3:c.4573G>Ap.Val1525Ile | p.V1525INM_015384.4:c.4573G>A, NM_133433.3:c.4573G>A, XM_005248280.1:c.4573G>A, XM_005248281.1:c.4213G>A, XM_005248282.1:c.3913G>A, XM_005248283.1:c.2956G>AVOUS05/14/2018
69NIPBLEx23NM_133433.3:c.4683G>Cp.Leu1561= | p.L1561=NM_015384.4:c.4683G>C, NM_133433.3:c.4683G>C, XM_005248280.1:c.4683G>C, XM_005248281.1:c.4323G>C, XM_005248282.1:c.4023G>C, XM_005248283.1:c.3066G>CVOUS03/13/2015
70NIPBLEx23NM_133433.3:c.4731A>Gp.Glu1577= | p.E1577=NM_015384.4:c.4731A>G, NM_133433.3:c.4731A>G, XM_005248280.1:c.4731A>G, XM_005248281.1:c.4371A>G, XM_005248282.1:c.4071A>G, XM_005248283.1:c.3114A>GLikely benign07/02/2015 
71NIPBLEx23NM_133433.3:c.4760_4763delTGTTNM_015384.4:c.4760_4763delTGTT, NM_133433.3:c.4760_4763delTGTT, XM_005248280.1:c.4760_4763delTGTT, XM_005248281.1:c.4400_4403delTGTT, XM_005248282.1:c.4100_4103delTGTT, XM_005248283.1:c.3143_3146delTGTTPathogenic12/07/2016 
72NIPBLEx24NM_133433.3:c.4907G>Tp.Arg1636Leu | p.R1636LNM_015384.4:c.4907G>T, NM_133433.3:c.4907G>T, XM_005248280.1:c.4907G>T, XM_005248281.1:c.4547G>T, XM_005248282.1:c.4247G>T, XM_005248283.1:c.3290G>TVOUS10/19/2015
73NIPBLEx26NM_133433.3:c.5101T>Cp.Ser1701Pro | p.S1701PNM_015384.4:c.5101T>C, NM_133433.3:c.5101T>C, XM_005248280.1:c.5101T>C, XM_005248281.1:c.4741T>C, XM_005248282.1:c.4441T>C, XM_005248283.1:c.3484T>CLikely benign01/20/2017 
74NIPBLEx26NM_133433.3:c.5113C>Tp.His1705Tyr | p.H1705YNM_015384.4:c.5113C>T, NM_133433.3:c.5113C>T, XM_005248280.1:c.5113C>T, XM_005248281.1:c.4753C>T, XM_005248282.1:c.4453C>T, XM_005248283.1:c.3496C>TVOUS03/28/2019
75NIPBLEx27NM_133433.3:c.5249A>Gp.Tyr1750Cys | p.Y1750CNM_015384.4:c.5249A>G, NM_133433.3:c.5249A>G, XM_005248280.1:c.5249A>G, XM_005248281.1:c.4889A>G, XM_005248282.1:c.4589A>G, XM_005248283.1:c.3632A>GVOUS05/05/2015
76NIPBLEx29NM_133433.3:c.5440C>Tp.Arg1814* | p.R1814XNM_015384.4:c.5440C>T, NM_133433.3:c.5440C>TPathogenic08/27/2013 
77NIPBLEx29NM_133433.3:c.5511A>Gp.Arg1837= | p.R1837=NM_015384.4:c.5511A>G, NM_133433.3:c.5511A>G, XM_005248280.1:c.5511A>G, XM_005248281.1:c.5151A>G, XM_005248282.1:c.4851A>G, XM_005248283.1:c.3894A>GVOUS07/22/2015
78NIPBLEx31NM_133433.3:c.5786A>Gp.Lys1929Arg | p.K1929RNM_015384.4:c.5786A>G, NM_133433.3:c.5786A>GVOUS10/21/2013
79NIPBLEx31NM_133433.3:c.5808+2T>GNM_015384.4:c.5808+2T>G, NM_133433.3:c.5808+2T>G, XM_005248280.1:c.5808+2T>G, XM_005248281.1:c.5448+2T>G, XM_005248282.1:c.5148+2T>G, XM_005248283.1:c.4191+2T>GPathogenic02/13/2015 
80NIPBLEx33NM_133433.3:c.5863-18A>GNM_015384.4:c.5863-18A>G, NM_133433.3:c.5863-18A>G, XM_005248280.1:c.5863-18A>G, XM_005248281.1:c.5503-18A>G, XM_005248282.1:c.5203-18A>G, XM_005248283.1:c.4246-18A>GVOUS02/20/2017
81NIPBLEx33NM_133433.3:c.5863-14_5863-11dupATATNM_015384.4:c.5863-11_5863-10insATAT, NM_015384.4:c.5863-14_5863-11dup, NM_015384.4:c.5863-14_5863-11dupATAT, NM_133433.3:c.5863-11_5863-10insATAT, NM_133433.3:c.5863-14_5863-11dup, NM_133433.3:c.5863-14_5863-11dupATAT, XM_005248280.1:c.5863-11_5863-10insATAT, XM_005248280.1:c.5863-14_5863-11dupATAT, XM_005248281.1:c.5503-11_5503-10insATAT, XM_005248281.1:c.5503-14_5503-11dupATAT, XM_005248282.1:c.5203-11_5203-10insATAT, XM_005248282.1:c.5203-14_5203-11dupATAT, XM_005248283.1:c.4246-11_4246-10insATAT, XM_005248283.1:c.4246-14_4246-11dupATATBenign01/10/2014 
82NIPBLEx33NM_133433.3:c.5863-12_5863-11dupATNM_015384.4:c.5863-11_5863-10insAT, NM_015384.4:c.5863-12_5863-11dup, NM_015384.4:c.5863-12_5863-11dupAT, NM_133433.3:c.5863-11_5863-10insAT, NM_133433.3:c.5863-12_5863-11dup, NM_133433.3:c.5863-12_5863-11dupAT, XM_005248280.1:c.5863-12_5863-11dupAT, XM_005248281.1:c.5503-12_5503-11dupAT, XM_005248282.1:c.5203-12_5203-11dupAT, XM_005248283.1:c.4246-12_4246-11dupATBenign06/29/2015 
83NIPBLEx33NM_133433.3:c.5863-12_5863-11delATNM_015384.4:c.5863-12_5863-11delAT, NM_133433.3:c.5863-12_5863-11delATBenign04/05/2018 
84NIPBLEx33NM_133433.3:c.5863-10G>ANM_015384.4:c.5863-10G>A, NM_133433.3:c.5863-10G>A, XM_005248280.1:c.5863-10G>A, XM_005248281.1:c.5503-10G>A, XM_005248282.1:c.5203-10G>A, XM_005248283.1:c.4246-10G>AVOUS07/11/2017
85NIPBLEx33NM_133433.3:c.5874C>Tp.Ser1958= | p.S1958=NM_015384.4:c.5874C>T, NM_133433.3:c.5874C>T, XM_005248280.1:c.5874C>T, XM_005248281.1:c.5514C>T, XM_005248282.1:c.5214C>T, XM_005248283.1:c.4257C>TBenign07/13/2018 
86NIPBLEx34NM_133433.3:c.6057C>Tp.Leu2019= | p.L2019=Benign02/07/2014 
87NIPBLEx34NM_133433.3:c.6065A>Gp.Lys2022Arg | p.K2022RNM_015384.4:c.6065A>G, NM_133433.3:c.6065A>G, XM_005248280.1:c.6065A>G, XM_005248281.1:c.5705A>G, XM_005248282.1:c.5405A>G, XM_005248283.1:c.4448A>GVOUS09/15/2016
88NIPBLEx34NM_133433.3:c.6082C>Tp.Gln2028* | p.Q2028XNM_015384.4:c.6082C>T, NM_133433.3:c.6082C>T, XM_005248280.1:c.6082C>T, XM_005248281.1:c.5722C>T, XM_005248282.1:c.5422C>T, XM_005248283.1:c.4465C>TPathogenic09/01/2016 
89NIPBLEx34NM_133433.3:c.6108+1G>CNM_015384.4:c.6108+1G>C, NM_133433.3:c.6108+1G>C, XM_005248280.1:c.6108+1G>C, XM_005248281.1:c.5748+1G>C, XM_005248282.1:c.5448+1G>C, XM_005248283.1:c.4491+1G>CPathogenic08/25/2014 
90NIPBLEx35NM_133433.3:c.6109-3T>CNM_015384.4:c.6109-3T>C, NM_133433.3:c.6109-3T>CBenign12/18/2012 
91NIPBLEx35NM_133433.3:c.6156G>Tp.Glu2052Asp | p.E2052DNM_015384.4:c.6156G>T, NM_133433.3:c.6156G>T, XM_005248280.1:c.6156G>T, XM_005248281.1:c.5796G>T, XM_005248282.1:c.5496G>T, XM_005248283.1:c.4539G>TVOUS11/04/2015
92NIPBLEx35NM_133433.3:c.6233_6235delTCAp.Ile2078del | p.I2078delNM_015384.4:c.6233_6235delTCA, NM_133433.3:c.6233_6235delTCA, XM_005248280.1:c.6233_6235delTCA, XM_005248281.1:c.5873_5875delTCA, XM_005248282.1:c.5573_5575delTCA, XM_005248283.1:c.4616_4618delTCAVOUS06/07/2017
93NIPBLEx36NM_133433.3:c.6285T>Gp.Val2095= | p.V2095=NM_015384.4:c.6285T>G, NM_133433.3:c.6285T>G, XM_005248280.1:c.6285T>G, XM_005248281.1:c.5925T>G, XM_005248282.1:c.5625T>G, XM_005248283.1:c.4668T>GVOUS09/02/2016
94NIPBLEx36NM_133433.3:c.6312A>Gp.Lys2104= | p.K2104=NM_015384.4:c.6312A>G, NM_133433.3:c.6312A>GVOUS01/27/2014
95NIPBLEx36NM_133433.3:c.6322G>Ap.Ala2108Thr | p.A2108TNM_015384.4:c.6322G>A, NM_133433.3:c.6322G>A, XM_005248280.1:c.6322G>A, XM_005248281.1:c.5962G>A, XM_005248282.1:c.5662G>A, XM_005248283.1:c.4705G>AVOUS09/19/2016
96NIPBLEx37NM_133433.3:c.6400C>Tp.Leu2134= | p.L2134=NM_015384.4:c.6400C>T, NM_133433.3:c.6400C>T, XM_005248280.1:c.6400C>T, XM_005248281.1:c.6040C>T, XM_005248282.1:c.5740C>T, XM_005248283.1:c.4783C>TVOUS01/31/2018
97NIPBLEx38NM_133433.3:c.6557A>Gp.Glu2186Gly | p.E2186GNM_015384.4:c.6557A>G, NM_133433.3:c.6557A>G, XM_005248280.1:c.6557A>G, XM_005248281.1:c.6197A>G, XM_005248282.1:c.5897A>G, XM_005248283.1:c.4940A>GVOUS08/20/2015
98NIPBLEx38NM_133433.3:c.6558A>Gp.Glu2186= | p.E2186=NM_015384.4:c.6558A>G, NM_133433.3:c.6558A>G, XM_005248280.1:c.6558A>G, XM_005248281.1:c.6198A>G, XM_005248282.1:c.5898A>G, XM_005248283.1:c.4941A>GVOUS12/26/2014
99NIPBLEx38NM_133433.3:c.6589+9A>TNM_015384.4:c.6589+9A>T, NM_133433.3:c.6589+9A>T, XM_005248280.1:c.6589+9A>T, XM_005248281.1:c.6229+9A>T, XM_005248282.1:c.5929+9A>T, XM_005248283.1:c.4972+9A>TLikely benign08/02/2018 
100NIPBLEx39NM_133433.3:c.6590-9C>TNM_015384.4:c.6590-9C>T, NM_133433.3:c.6590-9C>T, XM_005248280.1:c.6590-9C>T, XM_005248281.1:c.6230-9C>T, XM_005248282.1:c.5930-9C>T, XM_005248283.1:c.4973-9C>TVOUS08/21/2017
101NIPBLEx39NM_133433.3:c.6595G>Cp.Ala2199Pro | p.A2199PNM_015384.4:c.6595G>C, NM_133433.3:c.6595G>C, XM_005248280.1:c.6595G>C, XM_005248281.1:c.6235G>C, XM_005248282.1:c.5935G>C, XM_005248283.1:c.4978G>CVOUS02/17/2015
102NIPBLEx39NM_133433.3:c.6673delTPathogenic** 
103NIPBLEx39NM_133433.3:c.6701T>Gp.Leu2234* | p.L2234XNM_015384.4:c.6701T>G, NM_133433.3:c.6701T>GPathogenic12/30/2013 
104NIPBLEx39NM_133433.3:c.6763T>Ap.Trp2255Arg | p.W2255RNM_015384.4:c.6763T>A, NM_133433.3:c.6763T>A, XM_005248280.1:c.6763T>A, XM_005248281.1:c.6403T>A, XM_005248282.1:c.6103T>A, XM_005248283.1:c.5146T>AVOUS08/08/2014
105NIPBLEx41NM_133433.3:c.6955-9delTNM_015384.4:c.6955-9delT, NM_133433.3:c.6955-9delTBenign11/14/2014 
106NIPBLEx41NM_133433.3:c.6981C>Tp.Gly2327= | p.G2327=NM_015384.4:c.6981C>T, NM_133433.3:c.6981C>T, XM_005248280.1:c.6981C>T, XM_005248281.1:c.6621C>T, XM_005248282.1:c.6321C>T, XM_005248283.1:c.5364C>TVOUS05/23/2017
107NIPBLEx41NM_133433.3:c.7047T>Gp.Tyr2349* | p.Y2349XNM_015384.4:c.7047T>G, NM_133433.3:c.7047T>GPathogenic04/15/2014 
108NIPBLEx42NM_133433.3:c.7175G>Ap.Cys2392Tyr | p.C2392YNM_015384.4:c.7175G>A, NM_133433.3:c.7175G>A, XM_005248280.1:c.7175G>A, XM_005248281.1:c.6815G>A, XM_005248282.1:c.6515G>A, XM_005248283.1:c.5558G>ALikely pathogenic02/17/2016 
109NIPBLEx42NM_133433.3:c.7219C>Tp.Arg2407* | p.R2407XNM_015384.4:c.7219C>T, NM_133433.3:c.7219C>TPathogenic04/14/2017 
110NIPBLEx43NM_133433.3:c.7330G>Ap.Glu2444Lys | p.E2444KNM_015384.4:c.7330G>A, NM_133433.3:c.7330G>A, XM_005248280.1:c.7330G>A, XM_005248281.1:c.6970G>A, XM_005248282.1:c.6670G>A, XM_005248283.1:c.5713G>AVOUS10/21/2019
111NIPBLEx44NM_133433.3:c.7418T>Cp.Val2473Ala | p.V2473ANM_015384.4:c.7418T>C, NM_133433.3:c.7418T>C, XM_005248280.1:c.7418T>C, XM_005248281.1:c.7058T>C, XM_005248282.1:c.6758T>C, XM_005248283.1:c.5801T>CVOUS09/25/2015
112NIPBLEx44NM_133433.3:c.7463A>Gp.Asn2488Ser | p.N2488SNM_015384.4:c.7463A>G, NM_133433.3:c.7463A>G, XM_005248280.1:c.7463A>G, XM_005248281.1:c.7103A>G, XM_005248282.1:c.6803A>G, XM_005248283.1:c.5846A>GLikely benign07/25/2014 
113NIPBLEx44NM_133433.3:c.7602C>Tp.Ile2534= | p.I2534=NM_015384.4:c.7602C>T, NM_133433.3:c.7602C>TVOUS10/16/2013
114NIPBLEx45NM_133433.3:c.7728T>Cp.Tyr2576= | p.Y2576=NM_015384.4:c.7728T>C, NM_133433.3:c.7728T>C, XM_005248280.1:c.7728T>C, XM_005248281.1:c.7368T>C, XM_005248282.1:c.7068T>C, XM_005248283.1:c.6111T>CVOUS01/17/2015
115NIPBLEx45NM_133433.3:c.7830G>Cp.Val2610= | p.V2610=NM_015384.4:c.7830G>C, NM_133433.3:c.7830G>C, XM_005248280.1:c.7830G>C, XM_005248281.1:c.7470G>C, XM_005248282.1:c.7170G>C, XM_005248283.1:c.6213G>CBenign07/22/2015 
116NIPBLEx45NM_133433.3:c.7831A>Tp.Lys2611* | p.K2611XPathogenic** 
117NIPBLEx46NM_133433.3:c.7893T>Cp.Asp2631= | p.D2631=NM_015384.4:c.7893T>C, NM_133433.3:c.7893T>C, XM_005248280.1:c.7893T>C, XM_005248281.1:c.7533T>C, XM_005248282.1:c.7233T>C, XM_005248283.1:c.6276T>CVOUS09/04/2015
118NIPBLEx47NM_133433.3:c.8166A>Gp.Pro2722= | p.P2722=NM_015384.4:c.*620A>G, NM_133433.3:c.8166A>GVOUS01/15/2014
119NIPBLEx47NM_133433.3:c.8263G>Ap.Asp2755Asn | p.D2755NNM_015384.4:c.*717G>A, NM_133433.3:c.8263G>A, XM_005248280.1:c.*207G>A, XM_005248281.1:c.7903G>A, XM_005248282.1:c.7603G>A, XM_005248283.1:c.6646G>AVOUS09/11/2019
120NIPBLEx47NM_133433.3:c.8302G>Cp.Glu2768Gln | p.E2768QNM_015384.4:c.*756G>C, NM_133433.3:c.8302G>C, XM_005248280.1:c.*246G>C, XM_005248281.1:c.7942G>C, XM_005248282.1:c.7642G>C, XM_005248283.1:c.6685G>CVOUS07/29/2019
121NIPBLEx47NM_133433.3:c.8377C>Tp.Arg2793* | p.R2793XNM_015384.4:c.*831C>T, NM_133433.3:c.8377C>T, XM_005248280.1:c.*321C>T, XM_005248281.1:c.8017C>T, XM_005248282.1:c.7717C>T, XM_005248283.1:c.6760C>TPathogenic11/13/2012 

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by EGL Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2020-Q1.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official EGL clinical report and should be approached with caution. Only variants identified at EGL are listed in the EmVClass. If you intend to use EGL's classification for publication purposes please contact the laboratory for permission.