Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1MYO7AEx3NM_000260.3:c.39C>Ap.Asp13Glu | p.D13ENM_000260.3:c.39C>A, NM_001127179.1:c.39C>A, NM_001127179.2:c.39C>A, NM_001127180.1:c.39C>A, XM_005274011.1:c.39C>A, XM_005274012.1:c.39C>AVOUS07/09/2014
2MYO7AEx3NM_000260.3:c.47T>Cp.Leu16Ser | p.L16SNM_000260.3:c.47T>C, NM_001127179.1:c.47T>C, NM_001127179.2:c.47T>C, NM_001127180.1:c.47T>C, XM_005274011.1:c.47T>C, XM_005274012.1:c.47T>CBenign09/18/2014 
3MYO7AEx4NM_000260.3:c.133-7C>TNM_000260.3:c.133-7C>T, NM_001127179.1:c.133-7C>T, NM_001127179.2:c.133-7C>T, NM_001127180.1:c.133-7C>T, XM_005274011.1:c.133-7C>T, XM_005274012.1:c.133-7C>TBenign09/29/2016 
4MYO7AEx4NM_000260.3:c.133G>Tp.Glu45* | p.E45XNM_000260.3:c.133G>T, NM_001127179.1:c.133G>T, NM_001127179.2:c.133G>T, NM_001127180.1:c.133G>T, XM_005274011.1:c.133G>T, XM_005274012.1:c.133G>TPathogenic12/20/2016 
5MYO7AEx5NM_000260.3:c.398A>Cp.His133Pro | p.H133PNM_000260.3:c.398A>C, NM_001127179.1:c.398A>C, NM_001127179.2:c.398A>C, NM_001127180.1:c.398A>C, XM_005274011.1:c.398A>C, XM_005274012.1:c.398A>CVOUS09/10/2015
6MYO7AEx5NM_000260.3:c.401T>Cp.Ile134Thr | p.I134TNM_000260.3:c.401T>C, NM_001127179.1:c.401T>C, NM_001127179.2:c.401T>C, NM_001127180.1:c.401T>C, XM_005274011.1:c.401T>C, XM_005274012.1:c.401T>CVOUS09/10/2015
7MYO7AEx5NM_000260.3:c.401T>Ap.Ile134Asn | p.I134NNM_000260.3:c.401T>A, NM_001127179.1:c.401T>A, NM_001127179.2:c.401T>A, NM_001127180.1:c.401T>A, XM_005274011.1:c.401T>A, XM_005274012.1:c.401T>ALikely pathogenic05/07/2020 
8MYO7AEx5NM_000260.3:c.468C>Tp.Ile156= | p.I156=Benign05/09/2013 
9MYO7AEx6NM_000260.3:c.487G>Ap.Gly163Arg | p.G163RNM_000260.3:c.487G>A, NM_001127179.1:c.487G>A, NM_001127179.2:c.487G>A, NM_001127180.1:c.487G>A, XM_005274011.1:c.487G>A, XM_005274012.1:c.487G>ALikely pathogenic12/21/2018 
10MYO7AEx6NM_000260.3:c.500G>Cp.Ser167Thr | p.S167TNM_000260.3:c.500G>C, NM_001127179.1:c.500G>C, NM_001127179.2:c.500G>C, NM_001127180.1:c.500G>C, XM_005274011.1:c.500G>C, XM_005274012.1:c.500G>CVOUS03/16/2016
11MYO7AEx6NM_000260.3:c.510G>Ap.Leu170= | p.L170=NM_000260.3:c.510G>A, NM_001127179.1:c.510G>A, NM_001127179.2:c.510G>A, NM_001127180.1:c.510G>A, XM_005274011.1:c.510G>A, XM_005274012.1:c.510G>ALikely benign02/17/2015 
12MYO7AEx6NM_000260.3:c.578C>Tp.Thr193Ile | p.T193INM_000260.3:c.578C>T, NM_001127179.1:c.578C>T, NM_001127179.2:c.578C>T, NM_001127180.1:c.578C>T, XM_005274011.1:c.578C>T, XM_005274012.1:c.578C>TVOUS02/02/2017
13MYO7AEx7NM_000260.3:c.614T>Cp.Ile205Thr | p.I205TNM_000260.3:c.614T>C, NM_001127179.1:c.614T>C, NM_001127179.2:c.614T>C, NM_001127180.1:c.614T>C, XM_005274011.1:c.614T>C, XM_005274012.1:c.614T>CVOUS11/28/2017
14MYO7AEx7NM_000260.3:c.640G>Ap.Gly214Arg | p.G214RNM_000260.3:c.640G>A, NM_001127179.1:c.640G>A, NM_001127179.2:c.640G>A, NM_001127180.1:c.640G>A, XM_005274011.1:c.640G>A, XM_005274012.1:c.640G>APathogenic10/21/2014 
15MYO7AEx7NM_000260.3:c.676G>Ap.Ala226Thr | p.A226TNM_000260.3:c.676G>A, NM_001127179.1:c.676G>A, NM_001127179.2:c.676G>A, NM_001127180.1:c.676G>A, XM_005274011.1:c.676G>A, XM_005274012.1:c.676G>AVOUS09/21/2016
16MYO7AEx7NM_000260.3:c.687C>Tp.Gly229= | p.G229=VOUS12/28/2020
17MYO7AEx7NM_000260.3:c.731G>Ap.Arg244His | p.R244HNM_000260.3:c.731G>A, NM_001127179.1:c.731G>A, NM_001127179.2:c.731G>A, NM_001127180.1:c.731G>A, XM_005274011.1:c.731G>A, XM_005274012.1:c.731G>AVOUS09/08/2016
18MYO7AEx8NM_000260.3:c.783T>Cp.Gly261= | p.G261=NM_000260.3:c.783T>C, NM_001127179.1:c.783T>C, NM_001127179.2:c.783T>C, NM_001127180.1:c.783T>C, XM_005274011.1:c.783T>C, XM_005274012.1:c.783T>CBenign11/07/2014 
19MYO7AEx8NM_000260.3:c.803A>Gp.Lys268Arg | p.K268RNM_000260.3:c.803A>G, NM_001127179.1:c.803A>G, NM_001127179.2:c.803A>G, NM_001127180.1:c.803A>G, XM_005274011.1:c.803A>G, XM_005274012.1:c.803A>GVOUS11/07/2014
20MYO7AEx8NM_000260.3:c.849+7C>GNM_000260.3:c.849+7C>G, NM_001127179.1:c.849+7C>G, NM_001127179.2:c.849+7C>G, NM_001127180.1:c.849+7C>G, XM_005274011.1:c.849+7C>G, XM_005274012.1:c.849+7C>GVOUS05/19/2015
21MYO7AEx9NM_000260.3:c.905G>Ap.Arg302His | p.R302HNM_000260.3:c.905G>A, NM_001127179.1:c.905G>A, NM_001127179.2:c.905G>A, NM_001127180.1:c.905G>A, XM_005274011.1:c.905G>A, XM_005274012.1:c.905G>ALikely benign12/16/2014 
22MYO7AEx10NM_000260.3:c.1007G>Ap.Arg336His | p.R336HNM_000260.3:c.1007G>A, NM_001127179.1:c.1007G>A, NM_001127179.2:c.1007G>A, NM_001127180.1:c.1007G>A, XM_005274011.1:c.1007G>A, XM_005274012.1:c.1007G>ALikely benign03/02/2016 
23MYO7AEx10NM_000260.3:c.1056G>Ap.Leu352= | p.L352=NM_000260.3:c.1056G>A, NM_001127179.1:c.1056G>A, NM_001127179.2:c.1056G>A, NM_001127180.1:c.1056G>A, XM_005274011.1:c.1056G>A, XM_005274012.1:c.1056G>AVOUS05/10/2016
24MYO7AEx11NM_000260.3:c.1091C>Ap.Pro364Gln | p.P364QNM_000260.3:c.1091C>A, NM_001127179.1:c.1091C>A, NM_001127179.2:c.1091C>A, NM_001127180.1:c.1091C>A, XM_005274011.1:c.1091C>A, XM_005274012.1:c.1091C>AVOUS05/07/2019
25MYO7AEx12NM_000260.3:c.1208A>Gp.Tyr403Cys | p.Y403CNM_000260.3:c.1208A>G, NM_001127179.1:c.1208A>G, NM_001127179.2:c.1208A>G, NM_001127180.1:c.1208A>G, XM_005274011.1:c.1208A>G, XM_005274012.1:c.1208A>GVOUS01/09/2017
26MYO7AEx12NM_000260.3:c.1209C>Tp.Tyr403= | p.Y403=NM_000260.3:c.1209C>T, NM_001127179.1:c.1209C>T, NM_001127179.2:c.1209C>T, NM_001127180.1:c.1209C>T, XM_005274011.1:c.1209C>T, XM_005274012.1:c.1209C>TVOUS12/14/2016
27MYO7AEx12NM_000260.3:c.1288C>Tp.Arg430Cys | p.R430CNM_000260.3:c.1288C>T, NM_001127179.1:c.1288C>T, NM_001127179.2:c.1288C>T, NM_001127180.1:c.1288C>T, XM_005274011.1:c.1288C>T, XM_005274012.1:c.1288C>TVOUS03/01/2016
28MYO7AEx12NM_000260.3:c.1299C>Tp.Ile433= | p.I433=NM_000260.3:c.1299C>T, NM_001127179.1:c.1299C>T, NM_001127179.2:c.1299C>T, NM_001127180.1:c.1299C>T, XM_005274011.1:c.1299C>T, XM_005274012.1:c.1299C>TVOUS03/30/2017
29MYO7AEx13NM_000260.3:c.1554+7C>TNM_000260.3:c.1554+7C>T, NM_001127179.1:c.1554+7C>T, NM_001127179.2:c.1554+7C>T, NM_001127180.1:c.1554+7C>T, XM_005274011.1:c.1554+7C>T, XM_005274012.1:c.1554+7C>TLikely benign01/03/2017 
30MYO7AEx13NM_000260.3:c.1554+8G>ANM_000260.3:c.1554+8G>A, NM_001127179.1:c.1554+8G>A, NM_001127179.2:c.1554+8G>A, NM_001127180.1:c.1554+8G>A, XM_005274011.1:c.1554+8G>A, XM_005274012.1:c.1554+8G>AVOUS03/11/2015
31MYO7AEx14NM_000260.3:c.1605C>Tp.Asn535= | p.N535=NM_000260.3:c.1605C>T, NM_001127179.1:c.1605C>T, NM_001127179.2:c.1605C>T, NM_001127180.1:c.1605C>T, XM_005274011.1:c.1605C>T, XM_005274012.1:c.1605C>TBenign02/20/2015 
32MYO7AEx16NM_000260.3:c.1854G>Ap.Leu618= | p.L618=NM_000260.3:c.1854G>A, NM_001127179.1:c.1854G>A, NM_001127179.2:c.1854G>A, NM_001127180.1:c.1854G>A, XM_005274011.1:c.1854G>A, XM_005274012.1:c.1854G>ALikely benign12/14/2014 
33MYO7AEx17NM_000260.3:c.2005C>Tp.Arg669* | p.R669XNM_000260.3:c.2005C>T, NM_001127179.1:c.2005C>T, NM_001127179.2:c.2005C>T, NM_001127180.1:c.2005C>T, XM_005274011.1:c.2005C>T, XM_005274012.1:c.2005C>TPathogenic06/29/2018 
34MYO7AEx17NM_000260.3:c.2006G>Ap.Arg669Gln | p.R669QNM_000260.3:c.2006G>A, NM_001127179.1:c.2006G>A, NM_001127179.2:c.2006G>A, NM_001127180.1:c.2006G>A, XM_005274011.1:c.2006G>A, XM_005274012.1:c.2006G>AVOUS12/08/2016
35MYO7AEx17NM_000260.3:c.2025C>Tp.Arg675= | p.R675=NM_000260.3:c.2025C>T, NM_001127179.1:c.2025C>T, NM_001127179.2:c.2025C>T, NM_001127180.1:c.2025C>T, XM_005274011.1:c.2025C>T, XM_005274012.1:c.2025C>TVOUS12/19/2014
36MYO7AEx17NM_000260.3:c.2035G>Ap.Val679Ile | p.V679INM_000260.3:c.2035G>A, NM_001127179.1:c.2035G>A, NM_001127179.2:c.2035G>A, NM_001127180.1:c.2035G>A, XM_005274011.1:c.2035G>A, XM_005274012.1:c.2035G>ABenign03/22/2016 
37MYO7AEx17NM_000260.3:c.2088C>Tp.Tyr696= | p.Y696=NM_000260.3:c.2088C>T, NM_001127179.1:c.2088C>T, NM_001127179.2:c.2088C>T, NM_001127180.1:c.2088C>T, XM_005274011.1:c.2088C>T, XM_005274012.1:c.2088C>TVOUS01/12/2018
38MYO7AEx18NM_000260.3:c.2097C>Tp.Gly699= | p.G699=NM_000260.3:c.2097C>T, NM_001127179.1:c.2097C>T, NM_001127179.2:c.2097C>T, NM_001127180.1:c.2097C>T, XM_005274011.1:c.2097C>T, XM_005274012.1:c.2097C>TVOUS11/01/2016
39MYO7AEx18NM_000260.3:c.2187+3G>ANM_000260.3:c.2187+3G>A, NM_001127179.1:c.2187+3G>A, NM_001127179.2:c.2187+3G>A, NM_001127180.1:c.2187+3G>A, XM_005274011.1:c.2187+3G>A, XM_005274012.1:c.2187+3G>AVOUS11/02/2018
40MYO7AEx19NM_000260.3:c.2208G>Ap.Leu736= | p.L736=NM_000260.3:c.2208G>A, NM_001127179.1:c.2208G>A, NM_001127179.2:c.2208G>A, NM_001127180.1:c.2208G>A, XM_005274011.1:c.2208G>A, XM_005274012.1:c.2208G>AVOUS10/01/2015
41MYO7AEx19NM_000260.3:c.2236G>Ap.Asp746Asn | p.D746NNM_000260.3:c.2236G>A, NM_001127179.1:c.2236G>A, NM_001127179.2:c.2236G>A, NM_001127180.1:c.2236G>A, XM_005274011.1:c.2236G>A, XM_005274012.1:c.2236G>ABenign04/04/2017 
42MYO7AEx20NM_000260.3:c.2293C>Ap.Leu765Met | p.L765MNM_000260.3:c.2293C>A, NM_001127179.1:c.2293C>A, NM_001127179.2:c.2293C>A, NM_001127180.1:c.2293C>A, XM_005274011.1:c.2293C>A, XM_005274012.1:c.2293C>AVOUS02/01/2017
43MYO7AEx20NM_000260.3:c.2340T>Gp.Gly780= | p.G780=NM_000260.3:c.2340T>G, NM_001127179.1:c.2340T>G, NM_001127179.2:c.2340T>G, NM_001127180.1:c.2340T>G, XM_005274011.1:c.2340T>G, XM_005274012.1:c.2340T>GVOUS01/16/2015
44MYO7AEx20NM_000260.3:c.2348G>Ap.Cys783Tyr | p.C783YNM_000260.3:c.2348G>A, NM_001127179.1:c.2348G>A, NM_001127179.2:c.2348G>A, NM_001127180.1:c.2348G>A, XM_005274011.1:c.2348G>A, XM_005274012.1:c.2348G>AVOUS05/01/2017
45MYO7AEx21NM_000260.3:c.2427G>Tp.Gln809His | p.Q809HNM_000260.3:c.2427G>T, NM_001127179.1:c.2427G>T, NM_001127179.2:c.2427G>T, NM_001127180.1:c.2427G>T, XM_005274011.1:c.2427G>T, XM_005274012.1:c.2427G>TVOUS03/21/2016
46MYO7AEx21NM_000260.3:c.2447G>Ap.Arg816His | p.R816HNM_000260.3:c.2447G>A, NM_001127179.1:c.2447G>A, NM_001127179.2:c.2447G>A, NM_001127180.1:c.2447G>A, XM_005274011.1:c.2447G>A, XM_005274012.1:c.2447G>ALikely benign10/01/2015 
47MYO7AEx21NM_000260.3:c.2487G>Ap.Val829= | p.V829=NM_000260.3:c.2487G>A, NM_001127179.1:c.2487G>A, NM_001127179.2:c.2487G>A, NM_001127180.1:c.2487G>A, XM_005274011.1:c.2487G>A, XM_005274012.1:c.2487G>AVOUS11/06/2018
48MYO7AEx21NM_000260.3:c.2527G>Ap.Val843Met | p.V843MNM_000260.3:c.2527G>A, NM_001127179.1:c.2527G>A, NM_001127179.2:c.2527G>A, NM_001127180.1:c.2527G>A, XM_005274011.1:c.2527G>A, XM_005274012.1:c.2527G>AVOUS10/14/2016
49MYO7AEx21NM_000260.3:c.2558G>Ap.Arg853His | p.R853HNM_000260.3:c.2558G>A, NM_001127179.1:c.2558G>A, NM_001127179.2:c.2558G>A, NM_001127180.1:c.2558G>A, XM_005274011.1:c.2558G>A, XM_005274012.1:c.2558G>AVOUS03/20/2015
50MYO7AEx21NM_000260.3:c.2572C>Tp.Arg858Cys | p.R858CNM_000260.3:c.2572C>T, NM_001127179.1:c.2572C>T, NM_001127179.2:c.2572C>T, NM_001127180.1:c.2572C>T, XM_005274011.1:c.2572C>T, XM_005274012.1:c.2572C>TVOUS11/21/2014
51MYO7AEx22NM_000260.3:c.2617C>Tp.Arg873Trp | p.R873WNM_000260.3:c.2617C>T, NM_001127179.1:c.2617C>T, NM_001127179.2:c.2617C>T, NM_001127180.1:c.2617C>T, XM_005274011.1:c.2617C>T, XM_005274012.1:c.2617C>TVOUS10/16/2014
52MYO7AEx23NM_000260.3:c.2798G>Ap.Arg933His | p.R933HNM_000260.3:c.2798G>A, NM_001127179.1:c.2798G>A, NM_001127179.2:c.2798G>A, NM_001127180.1:c.2798G>A, XM_005274011.1:c.2798G>A, XM_005274012.1:c.2798G>AVOUS02/12/2016
53MYO7AEx23NM_000260.3:c.2827G>Ap.Val943Met | p.V943MNM_000260.3:c.2827G>A, NM_001127179.1:c.2827G>A, NM_001127179.2:c.2827G>A, NM_001127180.1:c.2827G>A, XM_005274011.1:c.2827G>A, XM_005274012.1:c.2827G>AVOUS12/06/2016
54MYO7AEx23NM_000260.3:c.2886G>Cp.Gln962His | p.Q962HNM_000260.3:c.2886G>C, NM_001127179.1:c.2886G>C, NM_001127179.2:c.2886G>C, NM_001127180.1:c.2886G>C, XM_005274011.1:c.2886G>C, XM_005274012.1:c.2886G>CVOUS12/19/2014
55MYO7AEx24NM_000260.3:c.3038C>Tp.Thr1013Ile | p.T1013INM_000260.3:c.3038C>T, NM_001127179.1:c.3038C>T, NM_001127179.2:c.3038C>T, NM_001127180.1:c.3038C>T, XM_005274011.1:c.3038C>T, XM_005274012.1:c.3038C>TVOUS10/15/2016
56MYO7AEx24NM_000260.3:c.3086A>Gp.His1029Arg | p.H1029RNM_000260.3:c.3086A>G, NM_001127179.1:c.3086A>G, NM_001127179.2:c.3086A>G, NM_001127180.1:c.3086A>G, XM_005274011.1:c.3086A>G, XM_005274012.1:c.3086A>GLikely benign04/28/2017 
57MYO7AEx25NM_000260.3:c.3134T>Cp.Ile1045Thr | p.I1045TNM_000260.3:c.3134T>C, NM_001127179.1:c.3134T>C, NM_001127179.2:c.3134T>C, NM_001127180.1:c.3134T>C, XM_005274011.1:c.3134T>C, XM_005274012.1:c.3134T>CVOUS05/09/2017
58MYO7AEx25NM_000260.3:c.3283G>Ap.Glu1095Lys | p.E1095KNM_000260.3:c.3283G>A, NM_001127179.1:c.3283G>A, NM_001127179.2:c.3283G>A, NM_001127180.1:c.3283G>A, XM_005274011.1:c.3283G>A, XM_005274012.1:c.3283G>AVOUS02/10/2016
59MYO7AEx26NM_000260.3:c.3297C>Tp.Pro1099= | p.P1099=NM_000260.3:c.3297C>T, NM_001127179.1:c.3297C>T, NM_001127179.2:c.3297C>T, NM_001127180.1:c.3297C>T, XM_005274011.1:c.3297C>T, XM_005274012.1:c.3297C>TVOUS01/22/2016
60MYO7AEx27NM_000260.3:c.3404C>Ap.Ser1135Tyr | p.S1135YNM_000260.3:c.3404C>A, NM_001127179.1:c.3404C>A, NM_001127179.2:c.3404C>A, NM_001127180.1:c.3404C>A, XM_005274011.1:c.3404C>A, XM_005274012.1:c.3404C>AVOUS01/08/2016
61MYO7AEx27NM_000260.3:c.3476G>Tp.Gly1159Val | p.G1159VNM_000260.3:c.3476G>T, NM_001127179.1:c.3476G>T, NM_001127179.2:c.3476G>T, NM_001127180.1:c.3476G>T, XM_005274011.1:c.3476G>T, XM_005274012.1:c.3476G>TPathogenic11/15/2018 
62MYO7AEx27NM_000260.3:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTGNM_000260.3:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG, NM_001127179.1:c.3515_3536delGAGGCGGGGACACCAGGGCCTG, NM_001127179.2:c.3515_3536delGAGGCGGGGACACCAGGGCCTG, NM_001127180.1:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG, XM_005274011.1:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG, XM_005274012.1:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTGBenign06/13/2017 
63MYO7AEx28NM_000260.3:c.3527G>Ap.Ser1176Asn | p.S1176NNM_000260.3:c.3527G>A, NM_001127179.1:c.*4540G>A, NM_001127179.2:c.*4618G>A, NM_001127180.1:c.3527G>A, XM_005274011.1:c.3527G>A, XM_005274012.1:c.3527G>AVOUS07/29/2014
64MYO7AEx28NM_000260.3:c.3582C>Tp.Leu1194= | p.L1194=NM_000260.3:c.3582C>T, NM_001127179.1:c.*4595C>T, NM_001127179.2:c.*4673C>T, NM_001127180.1:c.3582C>T, XM_005274011.1:c.3582C>T, XM_005274012.1:c.3582C>TVOUS12/01/2015
65MYO7AEx28NM_000260.3:c.3595G>Ap.Val1199Met | p.V1199MNM_000260.3:c.3595G>A, NM_001127179.1:c.*4608G>A, NM_001127179.2:c.*4686G>A, NM_001127180.1:c.3595G>A, XM_005274011.1:c.3595G>A, XM_005274012.1:c.3595G>AVOUS05/29/2018
66MYO7AEx29NM_000260.3:c.3729G>Ap.Pro1243= | p.P1243=NM_000260.3:c.3729G>A, NM_001127180.1:c.3729G>AVOUS04/03/2014
67MYO7AEx29NM_000260.3:c.3750+5G>ANM_000260.3:c.3750+5G>A, NM_001127180.1:c.3750+5G>A, XM_005274011.1:c.3750+5G>A, XM_005274012.1:c.3750+5G>AVOUS07/21/2017
68MYO7AEx29NM_000260.3:c.3750+7G>ANM_000260.3:c.3750+7G>A, NM_001127180.1:c.3750+7G>A, XM_005274011.1:c.3750+7G>A, XM_005274012.1:c.3750+7G>AVOUS12/06/2016
69MYO7AEx29NM_000260.3:c.3750+9G>ANM_000260.3:c.3750+9G>A, NM_001127180.1:c.3750+9G>A, XM_005274011.1:c.3750+9G>A, XM_005274012.1:c.3750+9G>AVOUS10/06/2016
70MYO7AEx31NM_000260.3:c.3927G>Tp.Val1309= | p.V1309=NM_000260.3:c.3927G>T, NM_001127180.1:c.3927G>T, XM_005274011.1:c.3927G>T, XM_005274012.1:c.3927G>TVOUS07/23/2015
71MYO7AEx31NM_000260.3:c.4066A>Tp.Ser1356Cys | p.S1356CNM_000260.3:c.4066A>T, NM_001127180.1:c.4066A>T, XM_005274011.1:c.4066A>T, XM_005274012.1:c.4066A>TVOUS11/01/2016
72MYO7AEx31NM_000260.3:c.4074C>Tp.Ser1358= | p.S1358=NM_000260.3:c.4074C>T, NM_001127180.1:c.4074C>T, XM_005274011.1:c.4074C>T, XM_005274012.1:c.4074C>TBenign03/23/2016 
73MYO7AEx31NM_000260.3:c.4117C>Tp.Arg1373* | p.R1373XNM_000260.3:c.4117C>T, NM_001127180.1:c.4117C>T, XM_005274011.1:c.4117C>T, XM_005274012.1:c.4117C>TPathogenic04/07/2020 
74MYO7AEx32NM_000260.3:c.4192G>Ap.Val1398Ile | p.V1398INM_000260.3:c.4192G>A, NM_001127180.1:c.4192G>A, XM_005274011.1:c.4192G>A, XM_005274012.1:c.4192G>AVOUS10/18/2016
75MYO7AEx32NM_000260.3:c.4222C>Tp.Arg1408Cys | p.R1408CNM_000260.3:c.4222C>T, NM_001127180.1:c.4222C>T, XM_005274011.1:c.4222C>T, XM_005274012.1:c.4222C>TVOUS01/03/2017
76MYO7AEx32NM_000260.3:c.4225delCp.Leu1409Serfs*2 | p.L1409SfsX2NM_000260.3:c.4225delC, NM_001127180.1:c.4225delC, XM_005274011.1:c.4225delC, XM_005274012.1:c.4225delCPathogenic12/20/2016 
77MYO7AEx32NM_000260.3:c.4281G>Ap.Thr1427= | p.T1427=NM_000260.3:c.4281G>A, NM_001127180.1:c.4281G>A, XM_005274011.1:c.4281G>A, XM_005274012.1:c.4281G>AVOUS11/02/2018
78MYO7AEx33NM_000260.3:c.4441+7C>TNM_000260.3:c.4441+7C>T, NM_001127180.1:c.4441+7C>T, XM_005274011.1:c.4441+7C>T, XM_005274012.1:c.4441+7C>TVOUS07/29/2014
79MYO7AEx33NM_000260.3:c.4441+8G>ANM_000260.3:c.4441+8G>A, NM_001127180.1:c.4441+8G>A, XM_005274011.1:c.4441+8G>A, XM_005274012.1:c.4441+8G>AVOUS10/20/2015
80MYO7AEx34NM_000260.3:c.4461C>Tp.Asn1487= | p.N1487=NM_000260.3:c.4461C>T, NM_001127180.1:c.4461C>T, XM_005274011.1:c.4461C>T, XM_005274012.1:c.4461C>TBenign10/16/2014 
81MYO7AEx34NM_000260.3:c.4544_4551delAGATCATGinsCAp.Glu1515_Met1517delinsAla | p.E1515_M1517delinsANM_000260.3:c.4544_4551delinsCA, NM_001127180.1:c.4544_4551delinsCA, XM_005274011.1:c.4544_4551delinsCA, XM_005274012.1:c.4544_4551delinsCALikely pathogenic02/01/2016 
82MYO7AEx35NM_000260.3:c.4589C>Tp.Ser1530Leu | p.S1530LNM_000260.3:c.4589C>T, NM_001127180.1:c.4569-94C>T, XM_005274011.1:c.4589C>T, XM_005274012.1:c.4569-94C>TBenign09/03/2014 
83MYO7AEx35NM_000260.3:c.4667_4668delCGinsTAp.Pro1556Leu | p.P1556LNM_000260.3:c.4667_4668delinsTA, NM_001127180.1:c.4569-16_4569-15delinsTA, XM_005274011.1:c.4667_4668delinsTA, XM_005274012.1:c.4569-16_4569-15delinsTAVOUS04/12/2019
84MYO7AEx35NM_000260.3:c.4697C>Tp.Thr1566Met | p.T1566MNM_000260.3:c.4697C>T, NM_001127180.1:c.4583C>T, XM_005274011.1:c.4697C>T, XM_005274012.1:c.4583C>TBenign01/31/2017 
85MYO7AEx35NM_000260.3:c.4755C>Tp.Ser1585= | p.S1585=NM_000260.3:c.4755C>T, NM_001127180.1:c.4641C>T, XM_005274011.1:c.4755C>T, XM_005274012.1:c.4641C>TBenign07/11/2014 
86MYO7AEx35NM_000260.3:c.4757A>Gp.Asn1586Ser | p.N1586SNM_000260.3:c.4757A>G, NM_001127180.1:c.4643A>G, XM_005274011.1:c.4757A>G, XM_005274012.1:c.4643A>GVOUS02/04/2016
87MYO7AEx35NM_000260.3:c.4805G>Ap.Arg1602Gln | p.R1602QNM_000260.3:c.4805G>A, NM_001127180.1:c.4691G>A, XM_005274011.1:c.4805G>A, XM_005274012.1:c.4691G>ALikely benign12/08/2016 
88MYO7AEx35NM_000260.3:c.4845C>Ap.Pro1615= | p.P1615=NM_000260.3:c.4845C>A, NM_001127180.1:c.4731C>A, XM_005274011.1:c.4845C>A, XM_005274012.1:c.4731C>ALikely benign08/01/2016 
89MYO7AEx35NM_000260.3:c.4851C>Tp.Pro1617= | p.P1617=NM_000260.3:c.4851C>T, NM_001127180.1:c.4737C>T, XM_005274011.1:c.4851C>T, XM_005274012.1:c.4737C>TVOUS05/14/2018
90MYO7AEx36NM_000260.3:c.4973A>Gp.Gln1658Arg | p.Q1658RNM_000260.3:c.4973A>G, NM_001127180.1:c.4859A>G, XM_005274011.1:c.4973A>G, XM_005274012.1:c.4856A>GVOUS07/06/2018
91MYO7AEx36NM_000260.3:c.4992C>Tp.Thr1664= | p.T1664=NM_000260.3:c.4992C>T, NM_001127180.1:c.4878C>T, XM_005274011.1:c.4992C>T, XM_005274012.1:c.4875C>TBenign10/01/2015 
92MYO7AEx36NM_000260.3:c.4996A>Tp.Ser1666Cys | p.S1666CNM_000260.3:c.4996A>T, NM_001127180.1:c.4882A>T, XM_005274011.1:c.4996A>T, XM_005274012.1:c.4879A>TBenign06/22/2014 
93MYO7AEx36NM_000260.3:c.5004C>Tp.Tyr1668= | p.Y1668=NM_000260.3:c.5004C>T, NM_001127180.1:c.4890C>T, XM_005274011.1:c.5004C>T, XM_005274012.1:c.4887C>TVOUS03/31/2017
94MYO7AEx36NM_000260.3:c.5033G>Ap.Arg1678Gln | p.R1678QNM_000260.3:c.5033G>A, NM_001127180.1:c.4919G>A, XM_005274011.1:c.5033G>A, XM_005274012.1:c.4916G>AVOUS09/07/2018
95MYO7AEx37NM_000260.3:c.5108C>Tp.Ala1703Val | p.A1703VNM_000260.3:c.5108C>T, NM_001127180.1:c.4994C>T, XM_005274011.1:c.5108C>T, XM_005274012.1:c.4991C>TVOUS11/22/2014
96MYO7AEx37NM_000260.3:c.5156A>Gp.Tyr1719Cys | p.Y1719CNM_000260.3:c.5156A>G, NM_001127180.1:c.5042A>GBenign02/06/2015 
97MYO7AEx38NM_000260.3:c.5169-6C>TNM_000260.3:c.5169-6C>T, NM_001127180.1:c.5055-6C>T, XM_005274011.1:c.5169-6C>T, XM_005274012.1:c.5052-6C>TVOUS06/23/2016
98MYO7AEx38NM_000260.3:c.5215C>Ap.Arg1739= | p.R1739=NM_000260.3:c.5215C>A, NM_001127180.1:c.5101C>A, XM_005274011.1:c.5215C>A, XM_005274012.1:c.5098C>ABenign03/06/2015 
99MYO7AEx38NM_000260.3:c.5227C>Ap.Arg1743= | p.R1743=NM_000260.3:c.5227C>A, NM_001127180.1:c.5113C>A, XM_005274011.1:c.5227C>A, XM_005274012.1:c.5110C>AVOUS02/26/2016
100MYO7AEx38NM_000260.3:c.5227C>Tp.Arg1743Trp | p.R1743WNM_000260.3:c.5227C>T, NM_001127180.1:c.5113C>T, XM_005274011.1:c.5227C>T, XM_005274012.1:c.5110C>TVOUS10/29/2020
101MYO7AEx38NM_000260.3:c.5253G>Tp.Pro1751= | p.P1751=NM_000260.3:c.5253G>T, NM_001127180.1:c.5139G>T, XM_005274011.1:c.5253G>T, XM_005274012.1:c.5136G>TVOUS06/11/2018
102MYO7AEx38NM_000260.3:c.5324T>Cp.Ile1775Thr | p.I1775TNM_000260.3:c.5324T>C, NM_001127180.1:c.5210T>C, XM_005274011.1:c.5324T>C, XM_005274012.1:c.5207T>CLikely benign06/04/2015 
103MYO7AEx39NM_000260.3:c.5480+10G>ANM_000260.3:c.5480+10G>A, NM_001127180.1:c.5366+10G>A, XM_005274011.1:c.5486+10G>A, XM_005274012.1:c.5363+10G>AVOUS10/20/2016
104MYO7AEx40NM_000260.3:c.5494C>Tp.Arg1832Trp | p.R1832WNM_000260.3:c.5494C>T, NM_001127180.1:c.5380C>T, XM_005274011.1:c.5500C>T, XM_005274012.1:c.5377C>TVOUS01/20/2015
105MYO7AEx40NM_000260.3:c.5589C>Gp.His1863Gln | p.H1863QNM_000260.3:c.5589C>G, NM_001127180.1:c.5475C>GVOUS01/21/2014
106MYO7AEx40NM_000260.3:c.5598C>Ap.Leu1866= | p.L1866=NM_000260.3:c.5598C>A, NM_001127180.1:c.5484C>A, XM_005274011.1:c.5604C>A, XM_005274012.1:c.5481C>ALikely benign04/24/2018 
107MYO7AEx40NM_000260.3:c.5618G>Ap.Arg1873Gln | p.R1873QNM_000260.3:c.5618G>A, NM_001127180.1:c.5504G>A, XM_005274011.1:c.5624G>A, XM_005274012.1:c.5501G>AVOUS02/09/2017
108MYO7AEx41NM_000260.3:c.5688G>Ap.Gln1896= | p.Q1896=NM_000260.3:c.5688G>A, NM_001127180.1:c.5574G>A, XM_005274011.1:c.5694G>A, XM_005274012.1:c.5571G>AVOUS10/20/2015
109MYO7AEx42NM_000260.3:c.5835C>Tp.Leu1945= | p.L1945=NM_000260.3:c.5835C>T, NM_001127180.1:c.5721C>T, XM_005274011.1:c.5841C>T, XM_005274012.1:c.5718C>TBenign03/06/2015 
110MYO7AEx43NM_000260.3:c.5857-7A>TNM_000260.3:c.5857-7A>T, NM_001127180.1:c.5743-7A>T, XM_005274011.1:c.5863-7A>T, XM_005274012.1:c.5740-7A>TBenign11/19/2014 
111MYO7AEx43NM_000260.3:c.5860C>Ap.Leu1954Ile | p.L1954INM_000260.3:c.5860C>A, NM_001127180.1:c.5746C>A, XM_005274011.1:c.5866C>A, XM_005274012.1:c.5743C>ABenign11/19/2014 
112MYO7AEx43NM_000260.3:c.5860C>Gp.Leu1954Val | p.L1954VNM_000260.3:c.5860C>G, NM_001127180.1:c.5746C>G, XM_005274011.1:c.5866C>G, XM_005274012.1:c.5743C>GVOUS08/10/2015
113MYO7AEx43NM_000260.3:c.5866G>Ap.Val1956Ile | p.V1956INM_000260.3:c.5866G>A, NM_001127180.1:c.5752G>A, XM_005274011.1:c.5872G>A, XM_005274012.1:c.5749G>ABenign11/19/2014 
114MYO7AEx43NM_000260.3:c.5896G>Ap.Val1966Ile | p.V1966INM_000260.3:c.5896G>A, NM_001127180.1:c.5782G>A, XM_005274011.1:c.5902G>A, XM_005274012.1:c.5779G>AVOUS02/27/2018
115MYO7AEx43NM_000260.3:c.5944G>Ap.Gly1982Arg | p.G1982RNM_000260.3:c.5944G>A, NM_001127180.1:c.5830G>A, XM_005274011.1:c.5950G>A, XM_005274012.1:c.5827G>APathogenic02/09/2017 
116MYO7AEx44NM_000260.3:c.5968C>Tp.Gln1990* | p.Q1990XNM_000260.3:c.5968C>T, NM_001127180.1:c.5854C>T, XM_005274011.1:c.5974C>T, XM_005274012.1:c.5851C>TPathogenic01/20/2015 
117MYO7AEx45NM_000260.3:c.6165C>Tp.Ser2055= | p.S2055=NM_000260.3:c.6165C>T, NM_001127180.1:c.6051C>T, XM_005274011.1:c.6171C>T, XM_005274012.1:c.6048C>TVOUS09/14/2016
118MYO7AEx45NM_000260.3:c.6214G>Ap.Val2072Ile | p.V2072INM_000260.3:c.6214G>A, NM_001127180.1:c.6100G>A, XM_005274011.1:c.6220G>A, XM_005274012.1:c.6097G>ALikely benign09/05/2017 
119MYO7AEx46NM_000260.3:c.6326C>Tp.Thr2109Ile | p.T2109INM_000260.3:c.6326C>T, NM_001127180.1:c.6212C>T, NM_182833.1:c.*5368G>A, XM_005273837.1:c.*5368G>A, XM_005274011.1:c.6332C>T, XM_005274012.1:c.6209C>TVOUS01/09/2017
120MYO7AEx47NM_000260.3:c.6424G>Ap.Asp2142Asn | p.D2142NNM_000260.3:c.6424G>A, NM_001127180.1:c.6304G>A, NM_182833.1:c.*4256C>T, XM_005273837.1:c.*4256C>T, XM_005274011.1:c.6430G>A, XM_005274012.1:c.6307G>ABenign09/11/2018 
121MYO7AEx49NM_000260.3:c.*8C>TNM_000260.3:c.*8C>T, NM_001127180.1:c.*8C>T, NM_182833.1:c.*2573G>AVOUS04/25/2014
122MYO7AEx49NM_000260.3:c.6614_6634dupTGAGCAAACAGCGGGGCTCCANM_000260.3:c.6634_6635insTGAGCAAACAGCGGGGCTCCA, NM_001127180.1:c.6514_6515insTGAGCAAACAGCGGGGCTCCA, NM_182833.1:c.*2594_*2595insTGGAGCCCCGCTGTTTGCTCA, XM_005273837.1:c.*2594_*2595insTGGAGCCCCGCTGTTTGCTCA, XM_005274011.1:c.6640_6641insTGAGCAAACAGCGGGGCTCCA, XM_005274012.1:c.6517_6518insTGAGCAAACAGCGGGGCTCCALikely benign12/21/2015 
123MYO7AEx5NM_001127179.2:c.398A>Cp.His133Pro | p.H133PNM_000260.3:c.398A>C, NM_001127179.1:c.398A>C, NM_001127179.2:c.398A>C, NM_001127180.1:c.398A>C, XM_005274011.1:c.398A>C, XM_005274012.1:c.398A>CVOUS09/11/2015
124MYO7AEx5NM_001127179.2:c.401T>Cp.Ile134Thr | p.I134TNM_000260.3:c.401T>C, NM_001127179.1:c.401T>C, NM_001127179.2:c.401T>C, NM_001127180.1:c.401T>C, XM_005274011.1:c.401T>C, XM_005274012.1:c.401T>CVOUS09/11/2015
125MYO7AEx6NM_001127179.2:c.510G>Ap.Leu170= | p.L170=NM_000260.3:c.510G>A, NM_001127179.1:c.510G>A, NM_001127179.2:c.510G>A, NM_001127180.1:c.510G>A, XM_005274011.1:c.510G>A, XM_005274012.1:c.510G>ALikely benign03/24/2016 
126MYO7AEx9NM_001127179.2:c.999T>Gp.Tyr333* | p.Y333XNM_000260.3:c.999T>G, NM_001127179.1:c.999T>G, NM_001127179.2:c.999T>G, NM_001127180.1:c.999T>G, XM_005274011.1:c.999T>G, XM_005274012.1:c.999T>GPathogenic07/24/2018 
127MYO7AEx14NM_001127179.2:c.1605C>Tp.Asn535= | p.N535=NM_000260.3:c.1605C>T, NM_001127179.1:c.1605C>T, NM_001127179.2:c.1605C>T, NM_001127180.1:c.1605C>T, XM_005274011.1:c.1605C>T, XM_005274012.1:c.1605C>TBenign10/08/2015 
128MYO7AEx23NM_001127179.2:c.2798G>Ap.Arg933His | p.R933HNM_000260.3:c.2798G>A, NM_001127179.1:c.2798G>A, NM_001127179.2:c.2798G>A, NM_001127180.1:c.2798G>A, XM_005274011.1:c.2798G>A, XM_005274012.1:c.2798G>AVOUS02/12/2016
129MYO7AEx27NM_001127179.2:c.3515_3536delGAGGCGGGGACACCAGGGCCTGNM_000260.3:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG, NM_001127179.1:c.3515_3536delGAGGCGGGGACACCAGGGCCTG, NM_001127179.2:c.3515_3536delGAGGCGGGGACACCAGGGCCTG, NM_001127180.1:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG, XM_005274011.1:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG, XM_005274012.1:c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTGBenign09/19/2015 
130MYO7AEx27NM_001127179.2:c.3520G>Ap.Gly1174Arg | p.G1174RNM_000260.3:c.3503+17G>A, NM_001127179.1:c.3520G>A, NM_001127179.2:c.3520G>A, NM_001127180.1:c.3503+17G>A, XM_005274011.1:c.3503+17G>A, XM_005274012.1:c.3503+17G>AVOUS12/21/2015
131MYO7AEx35NM_001127180.1:c.4583C>Tp.Thr1528Met | p.T1528MNM_000260.3:c.4697C>T, NM_001127180.1:c.4583C>T, XM_005274011.1:c.4697C>T, XM_005274012.1:c.4583C>TBenign04/12/2019 

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.