Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1MTM1Ex2NM_000252.2:c.19delTLRG_839t1:c.19delT, NM_000252.2:c.19delT, XM_005274686.1:c.40delT, XM_005274687.1:c.19delT, XM_005274688.1:c.-121delT, XR_247311.1:n.66delTPathogenic07/14/2016 
2MTM1Ex2NM_000252.2:c.27T>Gp.Tyr9* | p.Y9XPathogenic** 
3MTM1Ex2NM_000252.2:c.58A>Tp.Lys20* | p.K20XPathogenic** 
4MTM1Ex3NM_000252.2:Ex3:Non-amplificationOther Reportable06/15/2015 
5MTM1Ex3NM_000252.2:c.64-50A>TVOUS**
6MTM1Ex3NM_000252.2:c.64-14T>CNM_000252.2:c.64-14T>C, XM_005274686.1:c.85-14T>C, XM_005274687.1:c.64-14T>C, XM_005274688.1:c.-76-14T>C, XR_247311.1:n.111-14T>CBenign07/10/2015 
7MTM1Ex3NM_000252.2:c.70C>Tp.Arg24* | p.R24XPathogenic02/27/2013 
8MTM1Ex3NM_000252.2:c.122A>Gp.Glu41Gly | p.E41GLRG_839t1:c.122A>G, NM_000252.2:c.122A>G, XM_005274686.1:c.143A>G, XM_005274687.1:c.122A>G, XM_005274688.1:c.-18A>G, XR_247311.1:n.169A>GVOUS07/17/2012
9MTM1Ex4NM_000252.2:c.141_144delAGAAPathogenic** 
10MTM1Ex4NM_000252.2:c.142_143delGAp.Glu48Serfs*12 | p.E48SfsX12LRG_839t1:c.142_143delGA, NM_000252.2:c.142_143delGA, NM_000252.2:c.142_143delGA, XM_005274686.1:c.163_164delGA, XM_005274687.1:c.142_143delGAPathogenic05/24/2013 
11MTM1Ex5NM_000252.2:Ex5:Non-amplificationOther Reportable04/23/2015 
12MTM1Ex5NM_000252.2:c.339T>Cp.Cys113= | p.C113=NM_000252.2:c.339T>C, XM_005274686.1:c.360T>C, XM_005274687.1:c.339T>C, XM_005274688.1:c.-3-4342T>C, XR_247311.1:n.291T>CBenign12/28/2015 
13MTM1Ex6NM_000252.2:Ex6:Non-amplificationOther Reportable04/23/2015 
14MTM1Ex6NM_000252.2:c.420C>Gp.Tyr140* | p.Y140XPathogenic** 
15MTM1Ex6NM_000252.2:c.444+1G>ANM_000252.2:c.444+1G>A, XM_005274686.1:c.465+1G>A, XM_005274687.1:c.444+1G>A, XM_005274688.1:c.99+1G>A, XR_247311.1:n.396+1G>APathogenic12/16/2015 
16MTM1Ex7NM_000252.2:c.461T>Gp.Leu154* | p.L154XPathogenic** 
17MTM1Ex8NM_000252.2:c.595_599delCCTGCNM_000252.2:c.595_599delCCTGC, XM_005274686.1:c.616_620delCCTGC, XM_005274687.1:c.595_599delCCTGC, XM_005274688.1:c.250_254delCCTGC, XR_247311.1:n.547_551delCCTGCPathogenic04/28/2016 
18MTM1Ex8NM_000252.2:c.671G>Tp.Arg224Leu | p.R224LVOUS**
19MTM1Ex9NM_000252.2:c.688T>Cp.Trp230Arg | p.W230RLRG_839t1:c.688T>C, NM_000252.2:c.688T>C, XM_005274686.1:c.709T>C, XM_005274687.1:c.688T>C, XM_005274688.1:c.343T>C, XR_247311.1:n.640T>CVOUS01/08/2019
20MTM1Ex9NM_000252.2:c.721C>Tp.Arg241Cys | p.R241CNM_000252.2:c.721C>T, XM_005274686.1:c.742C>T, XM_005274687.1:c.721C>T, XM_005274688.1:c.376C>T, XR_247311.1:n.673C>TPathogenic07/29/2015 
21MTM1Ex9NM_000252.2:c.780T>Ap.Tyr260* | p.Y260XPathogenic** 
22MTM1Ex10NM_000252.2:c.969delAPathogenic** 
23MTM1Ex10NM_000252.2:c.969dupAPathogenic** 
24MTM1Ex10NM_000252.2:c.1040T>Gp.Leu347* | p.L347XPathogenic11/08/2012 
25MTM1Ex10NM_000252.2:c.1052A>Gp.Lys351Arg | p.K351RLRG_839t1:c.1052A>G, NM_000252.2:c.1052A>G, XM_005274686.1:c.1073A>G, XM_005274687.1:c.1052A>G, XM_005274688.1:c.707A>G, XR_247311.1:n.1004A>GVOUS04/06/2017
26MTM1Ex11NM_000252.2:c.1054-5G>CVOUS09/18/2012
27MTM1Ex11NM_000252.2:c.1088_1089delAANM_000252.2:c.1088_1089delAA, XM_005274686.1:c.1109_1110delAA, XM_005274687.1:c.1088_1089delAA, XM_005274688.1:c.743_744delAA, XR_247311.1:n.1040_1041delAAPathogenic07/10/2015 
28MTM1Ex11NM_000252.2:c.1132G>Ap.Gly378Arg | p.G378RPathogenic** 
29MTM1Ex11NM_000252.2:c.1169T>Ap.Met390Lys | p.M390KVOUS03/11/2014
30MTM1Ex11NM_000252.2:c.1260+3G>ANM_000252.2:c.1260+3G>A, XM_005274686.1:c.1281+3G>A, XM_005274687.1:c.1260+3G>ABenign07/10/2015 
31MTM1Ex11NM_000252.2:c.1260+17A>GLRG_839t1:c.1260+17A>G, NM_000252.2:c.1260+17A>G, XM_005274686.1:c.1281+17A>G, XM_005274687.1:c.1260+17A>G, XM_005274688.1:c.915+17A>G, XR_247311.1:n.1212+17A>GBenign05/12/2016 
32MTM1Ex12NM_000252.2:c.1261-10A>GPathogenic** 
33MTM1Ex12NM_000252.2:c.1261C>Tp.Arg421* | p.R421XNM_000252.2:c.1261C>T, XM_005274686.1:c.1282C>T, XM_005274687.1:c.1261C>T, XM_005274688.1:c.916C>T, XR_247311.1:n.1213C>TPathogenic05/16/2017 
34MTM1Ex12NM_000252.2:c.1291G>Ap.Asp431Asn | p.D431NNM_000252.2:c.1291G>A, XM_005274686.1:c.1312G>A, XM_005274687.1:c.1291G>A, XM_005274688.1:c.946G>A, XR_247311.1:n.1243G>AVOUS05/16/2017
35MTM1Ex12NM_000252.2:c.1297G>Ap.Asp433Asn | p.D433NNM_000252.2:c.1297G>A, XM_005274686.1:c.1318G>A, XM_005274687.1:c.1297G>A, XM_005274688.1:c.952G>A, XR_247311.1:n.1249G>AVOUS05/16/2017
36MTM1Ex12NM_000252.2:c.1306_1310dupCCTATNM_000252.2:c.1306_1310dup, NM_000252.2:c.1310_1311insCCTATPathogenic04/23/2014 
37MTM1Ex13NM_000252.2:c.1357_1358delCCNM_000252.2:c.1357_1358delCCPathogenic06/05/2013 
38MTM1Ex13NM_000252.2:c.1369G>Ap.Glu457Lys | p.E457KVOUS10/24/2012
39MTM1Ex13NM_000252.2:c.1415_1416delGTp.Ser472Metfs*11 | p.S472MfsX11LRG_839t1:c.1415_1416delGT, NM_000252.2:c.1415_1416delGT, XM_005274686.1:c.1436_1437delGT, XM_005274687.1:c.1415_1416delGTPathogenic11/01/2018 
40MTM1Ex14NM_000252.2:c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGAVOUS10/15/2013
41MTM1Ex14NM_000252.2:c.1644+1G>TPathogenic11/01/2012 
42MTM1Ex14NM_000252.2:c.1644+3_1644+6delAAGTNM_000252.2:c.1644+3_1644+6delAAGTPathogenic02/03/2014 

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.