Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1MCCC1Ex1NM_020166.3:c.89+42G>ABenign** 
2MCCC1Ex3NM_020166.3:c.137-2A>GNM_020166.3:c.137-2A>GPathogenic11/21/2013 
3MCCC1Ex3NM_020166.3:c.137G>Ap.Gly46Glu | p.G46EVOUS**
4MCCC1Ex3NM_020166.3:c.156C>Ap.Val52= | p.V52=NM_020166.3:c.156C>A, XM_005247635.1:c.44+2033C>A, XR_241502.1:n.301C>AVOUS11/01/2018
5MCCC1Ex3NM_020166.3:c.168C>Gp.Asn56Lys | p.N56KNM_020166.3:c.168C>G, XM_005247635.1:c.44+2045C>G, XR_241502.1:n.313C>GVOUS10/22/2018
6MCCC1Ex3NM_020166.3:c.196C>Tp.Arg66Cys | p.R66CVOUS**
7MCCC1Ex3NM_020166.3:c.205A>Tp.Lys69* | p.K69XNM_020166.3:c.205A>T, XM_005247635.1:c.44+2082A>T, XR_241502.1:n.350A>TPathogenic04/17/2015 
8MCCC1Ex3NM_020166.3:c.263A>Gp.His88Arg | p.H88RVOUS**
9MCCC1Ex4NM_020166.3:c.283G>Ap.Ala95Thr | p.A95TVOUS**
10MCCC1Ex4NM_020166.3:c.343C>Tp.Gln115* | p.Q115XPathogenic** 
11MCCC1Ex4NM_020166.3:c.359C>Tp.Ser120Phe | p.S120FVOUS**
12MCCC1Ex5NM_020166.3:c.396C>Tp.Leu132= | p.L132=NM_020166.3:c.396C>T, XM_005247635.1:c.141-1104C>TBenign11/10/2014 
13MCCC1Ex6NM_020166.3:c.558delAPathogenic** 
14MCCC1Ex6NM_020166.3:c.559T>Cp.Ser187Pro | p.S187PNM_020166.3:c.559T>C, XM_005247635.1:c.208T>C, XR_241502.1:n.704T>CVOUS11/16/2017
15MCCC1Ex6NM_020166.3:c.626G>Ap.Gly209Asp | p.G209DVOUS**
16MCCC1Ex7NM_020166.3:c.640-2A>GNM_020166.3:c.640-2A>G, XM_005247635.1:c.289-2A>G, XR_241502.1:n.785-2A>GPathogenic03/15/2019 
17MCCC1Ex7NM_020166.3:c.640-1G>ANM_020166.3:c.640-1G>A, XM_005247635.1:c.289-1G>APathogenic08/20/2018 
18MCCC1Ex7NM_020166.3:c.640_641delGGNM_020166.3:c.640_641delGG, XM_005247635.1:c.289_290delGG, XR_241502.1:n.785_786delGGPathogenic01/12/2017 
19MCCC1Ex7NM_020166.3:c.694C>Tp.Arg232Trp | p.R232WVOUS02/21/2014
20MCCC1Ex8NM_020166.3:c.841C>Tp.Arg281* | p.R281XNM_020166.3:c.841C>T, XM_005247635.1:c.490C>T, XR_241502.1:n.986C>TPathogenic03/02/2016 
21MCCC1Ex8NM_020166.3:c.847C>Gp.Gln283Glu | p.Q283EVOUS**
22MCCC1Ex8NM_020166.3:c.872delCPathogenic** 
23MCCC1Ex8NM_020166.3:c.872C>Tp.Ala291Val | p.A291VNM_020166.3:c.872C>T, XM_005247635.1:c.521C>T, XR_241502.1:n.1017C>TVOUS11/30/2016
24MCCC1Ex8NM_020166.3:c.873G>Ap.Ala291= | p.A291=NM_020166.3:c.873G>A, XM_005247635.1:c.522G>A, XR_241502.1:n.1018G>AVOUS01/25/2018
25MCCC1Ex8NM_020166.3:c.873+36G>AVOUS**
26MCCC1Ex9NM_020166.3:c.945T>Ap.Tyr315* | p.Y315XNM_020166.3:c.945T>A, XM_005247635.1:c.594T>A, XR_241502.1:n.1090T>APathogenic02/01/2017 
27MCCC1Ex10NM_020166.3:c.974T>Gp.Met325Arg | p.M325RNM_020166.3:c.974T>G, XM_005247635.1:c.623T>GPathogenic11/01/2018 
28MCCC1Ex10NM_020166.3:c.980C>Gp.Ser327* | p.S327XNM_020166.3:c.980C>G, XM_005247635.1:c.629C>G, XR_241502.1:n.1125C>GPathogenic** 
29MCCC1Ex10NM_020166.3:c.1074delGNM_020166.3:c.1074delGPathogenic09/06/2013 
30MCCC1Ex11NM_020166.3:c.1114C>Tp.Gln372* | p.Q372XNM_020166.3:c.1114C>T, XM_005247635.1:c.763C>T, XR_241502.1:n.1259C>TPathogenic10/24/2018 
31MCCC1Ex11NM_020166.3:c.1139A>Gp.His380Arg | p.H380RNM_020166.3:c.1139A>G, XM_005247635.1:c.788A>G, XR_241502.1:n.1284A>GVOUS04/17/2015
32MCCC1Ex11NM_020166.3:c.1155A>Cp.Arg385Ser | p.R385SNM_020166.3:c.1155A>C, XM_005247635.1:c.804A>CPathogenic10/12/2018 
33MCCC1Ex11NM_020166.3:c.1263dupGp.Gln422Alafs*10 | p.Q422AfsX10NM_020166.3:c.1263dupG, XM_005247635.1:c.912dupG, XR_241502.1:n.1408dupGPathogenic11/15/2017 
34MCCC1Ex12NM_020166.3:c.1277T>Cp.Val426Ala | p.V426ANM_020166.3:c.1277T>C, XM_005247635.1:c.926T>CLikely pathogenic05/17/2017 
35MCCC1Ex12NM_020166.3:c.1304C>Tp.Ala435Val | p.A435VVOUS**
36MCCC1Ex12NM_020166.3:c.1315G>Ap.Val439Met | p.V439MNM_020166.3:c.1315G>A, XM_005247635.1:c.964G>A, XR_241502.1:n.1460G>AVOUS07/23/2019
37MCCC1Ex13NM_020166.3:c.1391A>Cp.His464Pro | p.H464PNM_020166.3:c.1391A>C, XM_005247635.1:c.1040A>CBenign11/10/2014 
38MCCC1Ex13NM_020166.3:c.1399A>Tp.Ile467Phe | p.I467FNM_020166.3:c.1399A>T, XM_005247635.1:c.1048A>TVOUS11/12/2015
39MCCC1Ex13NM_020166.3:c.1417C>Gp.Leu473Val | p.L473VVOUS**
40MCCC1Ex13NM_020166.3:c.1526delGp.Cys509Serfs*14 | p.C509SfsX14NM_020166.3:c.1526delG, XM_005247635.1:c.1175delG, XR_241502.1:n.1522+1740delGPathogenic01/20/2017 
41MCCC1Ex13NM_020166.3:c.1594+39T>CBenign** 
42MCCC1Ex14NM_020166.3:c.1614G>Ap.Ser538= | p.S538=NM_020166.3:c.1614G>ABenign01/14/2014 
43MCCC1Ex15NM_020166.3:c.1700C>Tp.Thr567Met | p.T567MNM_020166.3:c.1700C>T, XM_005247635.1:c.1349C>T, XR_241502.1:n.1628C>TVOUS07/09/2014
44MCCC1Ex15NM_020166.3:c.1703A>Gp.Tyr568Cys | p.Y568CVOUS**
45MCCC1Ex17NM_020166.3:c.1905delANM_020166.3:c.1905delAPathogenic11/21/2013 
46MCCC1Ex17NM_020166.3:c.1930G>Tp.Glu644* | p.E644XNM_020166.3:c.1930G>T, XM_005247635.1:c.1579G>T, XR_241502.1:n.1858G>TPathogenic** 
47MCCC1Ex17NM_020166.3:c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATGNM_020166.3:c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG, XM_005247635.1:c.1622_1626+28delAAAAGGTAATCACATGACATCTGTAGAATGATG, XR_241502.1:n.1901_1905+28delAAAAGGTAATCACATGACATCTGTAGAATGATGLikely pathogenic11/08/2016 
48MCCC1Ex18NM_020166.3:c.2009_2043delCGGGAGATTCCCTCATGGTTATGATCGCCATGAAGPathogenic** 
49MCCC1Ex19NM_020166.3:c.2079delAp.Val694* | p.V694XNM_020166.3:c.2079delA, XM_005247635.1:c.1728delA, XR_241502.1:n.2007delAPathogenic11/17/2017 
50MCCC1Ex13NM_020166.4:c.1526delGp.Cys509Serfs*14 | p.C509SfsX14NM_020166.3:c.1526delG, XM_005247635.1:c.1175delG, XR_241502.1:n.1522+1740delGPathogenic01/14/2021 

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.