Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1LAMA2Ex1NM_000426.3:c.13G>Ap.Ala5Thr | p.A5TNM_000426.3:c.13G>A, NM_001079823.1:c.13G>A, XM_005266981.1:c.13G>A, XM_005266982.1:c.13G>AVOUS07/18/2014
2LAMA2Ex1NM_000426.3:c.-17delCVOUS**
3LAMA2Ex1NM_000426.3:c.101A>Gp.His34Arg | p.H34RNM_000426.3:c.101A>G, NM_001079823.1:c.101A>GVOUS02/08/2013
4LAMA2Ex1NM_000426.3:c.112+1G>ANM_000426.3:c.112+1G>A, NM_001079823.1:c.112+1G>A, XM_005266981.1:c.112+1G>A, XM_005266982.1:c.112+1G>APathogenic11/23/2014 
5LAMA2Ex2NM_000426.3:c.156C>Tp.Ile52= | p.I52=LRG_409t1:c.156C>T, NM_000426.3:c.156C>T, NM_001079823.1:c.156C>TBenign09/20/2012 
6LAMA2Ex2NM_000426.3:c.184G>Tp.Gly62* | p.G62XLRG_409t1:c.184G>T, NM_000426.3:c.184G>T, NM_001079823.1:c.184G>T, XM_005266981.1:c.184G>T, XM_005266982.1:c.184G>TPathogenic01/21/2013 
7LAMA2Ex2NM_000426.3:c.255C>Tp.Ile85= | p.I85=LRG_409t1:c.255C>T, NM_000426.3:c.255C>T, NM_001079823.1:c.255C>TVOUS05/06/2015
8LAMA2Ex3NM_000426.3:c.284-4A>GLRG_409t1:c.284-4A>G, NM_000426.3:c.284-4A>G, NM_001079823.1:c.284-4A>G, XM_005266981.1:c.284-4A>G, XM_005266982.1:c.284-4A>GVOUS08/25/2016
9LAMA2Ex3NM_000426.3:c.381C>Ap.Thr127= | p.T127=LRG_409t1:c.381C>A, NM_000426.3:c.381C>A, NM_001079823.1:c.381C>ABenign05/26/2015 
10LAMA2Ex3NM_000426.3:c.396+1G>TNM_000426.3:c.396+1G>T, NM_001079823.1:c.396+1G>T, XM_005266981.1:c.396+1G>T, XM_005266982.1:c.396+1G>TPathogenic09/04/2015 
11LAMA2Ex4NM_000426.3:c.397-15G>ANM_000426.3:c.397-15G>A, NM_001079823.1:c.397-15G>ABenign** 
12LAMA2Ex4NM_000426.3:c.411G>Ap.Ala137= | p.A137=LRG_409t1:c.411G>A, NM_000426.3:c.411G>A, NM_001079823.1:c.411G>A, XM_005266981.1:c.411G>A, XM_005266982.1:c.411G>ALikely benign12/28/2016 
13LAMA2Ex4NM_000426.3:c.444dupGNM_000426.3:c.444_445insG, NM_001079823.1:c.444_445insG, XM_005266981.1:c.444_445insG, XM_005266982.1:c.444_445insGPathogenic09/04/2015 
14LAMA2Ex4NM_000426.3:c.479A>Tp.Asp160Val | p.D160VNM_000426.3:c.479A>T, NM_001079823.1:c.479A>T, XM_005266981.1:c.479A>T, XM_005266982.1:c.479A>TVOUS01/07/2015
15LAMA2Ex4NM_000426.3:c.524_534dupAGTGCCTAACGNM_000426.3:c.534_535insAGTGCCTAACG, NM_001079823.1:c.534_535insAGTGCCTAACG, XM_005266981.1:c.534_535insAGTGCCTAACG, XM_005266982.1:c.534_535insAGTGCCTAACGPathogenic11/23/2014 
16LAMA2Ex4NM_000426.3:c.533C>Tp.Thr178Met | p.T178MNM_000426.3:c.533C>T, NM_001079823.1:c.533C>TVOUS**
17LAMA2Ex4NM_000426.3:c.595T>Ap.Cys199Ser | p.C199SLRG_409t1:c.595T>A, NM_000426.3:c.595T>A, NM_001079823.1:c.595T>A, XM_005266981.1:c.595T>A, XM_005266982.1:c.595T>AVOUS06/09/2016
18LAMA2Ex4NM_000426.3:c.611C>Tp.Ser204Phe | p.S204FLRG_409t1:c.611C>T, NM_000426.3:c.611C>T, NM_001079823.1:c.611C>T, XM_005266981.1:c.611C>T, XM_005266982.1:c.611C>TVOUS08/06/2020
19LAMA2Ex4NM_000426.3:c.623C>Ap.Pro208His | p.P208HNM_000426.3:c.623C>A, NM_001079823.1:c.623C>AVOUS11/13/2015
20LAMA2Ex5NM_000426.3:c.640-26G>ABenign** 
21LAMA2Ex5NM_000426.3:c.675C>Tp.Ala225= | p.A225=NM_000426.3:c.675C>T, NM_001079823.1:c.675C>TBenign12/06/2013 
22LAMA2Ex5NM_000426.3:c.713C>Ap.Ala238Asp | p.A238DLRG_409t1:c.713C>A, NM_000426.3:c.713C>A, NM_001079823.1:c.713C>A, XM_005266981.1:c.713C>A, XM_005266982.1:c.713C>AVOUS05/19/2016
23LAMA2Ex5NM_000426.3:c.817A>Tp.Arg273* | p.R273XLRG_409t1:c.817A>T, NM_000426.3:c.817A>T, NM_001079823.1:c.817A>T, XM_005266981.1:c.817A>T, XM_005266982.1:c.817A>TPathogenic05/08/2018 
24LAMA2Ex6NM_000426.3:c.830C>Tp.Ser277Leu | p.S277LNM_000426.3:c.830C>T, NM_001079823.1:c.830C>TVOUS05/22/2013
25LAMA2Ex7NM_000426.3:c.939_940delATLRG_409t1:c.939_940delAT, NM_000426.3:c.939_940delAT, NM_001079823.1:c.939_940delAT, XM_005266981.1:c.939_940delAT, XM_005266982.1:c.939_940delATPathogenic** 
26LAMA2Ex8NM_000426.3:c.1032_1042delCAATTGTCATGLRG_409t1:c.1032_1042delCAATTGTCATG, NM_000426.3:c.1032_1042delCAATTGTCATG, NM_001079823.1:c.1032_1042delCAATTGTCATG, XM_005266981.1:c.1032_1042delCAATTGTCATG, XM_005266982.1:c.1032_1042delCAATTGTCATGPathogenic08/08/2016 
27LAMA2Ex8NM_000426.3:c.1206+3A>CLRG_409t1:c.1206+3A>C, NM_000426.3:c.1206+3A>C, NM_001079823.1:c.1206+3A>C, XM_005266981.1:c.1206+3A>C, XM_005266982.1:c.1206+3A>CVOUS10/01/2018
28LAMA2Ex8NM_000426.3:c.1206+11C>TNM_000426.3:c.1206+11C>T, NM_001079823.1:c.1206+11C>TBenign** 
29LAMA2Ex10NM_000426.3:c.1403C>Gp.Ala468Gly | p.A468GLRG_409t1:c.1403C>G, NM_000426.3:c.1403C>G, NM_001079823.1:c.1403C>G, XM_005266981.1:c.1403C>G, XM_005266982.1:c.1403C>GBenign** 
30LAMA2Ex11NM_000426.3:c.1491T>Cp.Cys497= | p.C497=LRG_409t1:c.1491T>C, NM_000426.3:c.1491T>C, NM_001079823.1:c.1491T>CBenign** 
31LAMA2Ex11NM_000426.3:c.1533T>Cp.Asn511= | p.N511=NM_000426.3:c.1533T>C, NM_001079823.1:c.1533T>CBenign** 
32LAMA2Ex11NM_000426.3:c.1546G>Ap.Asp516Asn | p.D516NNM_000426.3:c.1546G>A, NM_001079823.1:c.1546G>A, XM_005266981.1:c.1546G>A, XM_005266982.1:c.1546G>AVOUS02/18/2016
33LAMA2Ex11NM_000426.3:c.1550A>Tp.Glu517Val | p.E517VLRG_409t1:c.1550A>T, NM_000426.3:c.1550A>T, NM_001079823.1:c.1550A>T, XM_005266981.1:c.1550A>T, XM_005266982.1:c.1550A>TVOUS02/04/2020
34LAMA2Ex11NM_000426.3:c.1580G>Ap.Cys527Tyr | p.C527YLRG_409t1:c.1580G>A, NM_000426.3:c.1580G>A, NM_001079823.1:c.1580G>A, XM_005266981.1:c.1580G>A, XM_005266982.1:c.1580G>AVOUS04/05/2013
35LAMA2Ex12NM_000426.3:c.1610_1611delTANM_000426.3:c.1610_1611delTA, NM_001079823.1:c.1610_1611delTA, XM_005266981.1:c.1610_1611delTA, XM_005266982.1:c.1610_1611delTAPathogenic02/23/2016 
36LAMA2Ex12NM_000426.3:c.1612C>Tp.Gln538* | p.Q538XPathogenic** 
37LAMA2Ex12NM_000426.3:c.1621A>Gp.Ser541Gly | p.S541GNM_000426.3:c.1621A>G, NM_001079823.1:c.1621A>GVOUS04/17/2015
38LAMA2Ex12NM_000426.3:c.1634T>Ap.Leu545Gln | p.L545QBenign03/12/2013 
39LAMA2Ex12NM_000426.3:c.1645C>Tp.Pro549Ser | p.P549SLRG_409t1:c.1645C>T, NM_000426.3:c.1645C>T, NM_001079823.1:c.1645C>T, XM_005266981.1:c.1645C>T, XM_005266982.1:c.1645C>TVOUS06/02/2017
40LAMA2Ex12NM_000426.3:c.1701C>Tp.Ile567= | p.I567=NM_000426.3:c.1701C>T, NM_001079823.1:c.1701C>TBenign09/15/2014 
41LAMA2Ex12NM_000426.3:c.1710T>Cp.Ser570= | p.S570=LRG_409t1:c.1710T>C, NM_000426.3:c.1710T>C, NM_001079823.1:c.1710T>C, XM_005266981.1:c.1710T>C, XM_005266982.1:c.1710T>CVOUS04/09/2021
42LAMA2Ex12NM_000426.3:c.1782+10C>TNM_000426.3:c.1782+10C>T, NM_001079823.1:c.1782+10C>T, XM_005266981.1:c.1782+10C>T, XM_005266982.1:c.1782+10C>TVOUS01/30/2015
43LAMA2Ex13NM_000426.3:c.1798G>Ap.Gly600Arg | p.G600RBenign02/08/2013 
44LAMA2Ex13NM_000426.3:c.1816A>Gp.Ile606Val | p.I606VNM_000426.3:c.1816A>G, NM_001079823.1:c.1816A>G, XM_005266981.1:c.1816A>G, XM_005266982.1:c.1816A>GVOUS12/09/2014
45LAMA2Ex13NM_000426.3:c.1854_1861dupACGTGTTCLRG_409t1:c.1861_1862insACGTGTTC, NM_000426.3:c.1861_1862insACGTGTTC, NM_001079823.1:c.1861_1862insACGTGTTC, XM_005266981.1:c.1861_1862insACGTGTTC, XM_005266982.1:c.1861_1862insACGTGTTCPathogenic07/08/2015 
46LAMA2Ex13NM_000426.3:c.1855_1856insATGTTCACNM_000426.3:c.1855_1856insATGTTCAC, NM_001079823.1:c.1855_1856insATGTTCAC, XM_005266981.1:c.1855_1856insATGTTCAC, XM_005266982.1:c.1855_1856insATGTTCACPathogenic10/28/2014 
47LAMA2Ex13NM_000426.3:c.1856G>Ap.Arg619His | p.R619HLRG_409t1:c.1856G>A, NM_000426.3:c.1856G>A, NM_001079823.1:c.1856G>A, XM_005266981.1:c.1856G>A, XM_005266982.1:c.1856G>ABenign01/20/2016 
48LAMA2Ex13NM_000426.3:c.1882G>Ap.Glu628Lys | p.E628KNM_000426.3:c.1882G>A, NM_001079823.1:c.1882G>A, XM_005266981.1:c.1882G>A, XM_005266982.1:c.1882G>AVOUS09/22/2014
49LAMA2Ex14NM_000426.3:c.2037G>Cp.Ala679= | p.A679=NM_000426.3:c.2037G>C, NM_001079823.1:c.2037G>CVOUS10/22/2013
50LAMA2Ex14NM_000426.3:c.2049_2050delAGNM_000426.3:c.2049_2050delAG, NM_001079823.1:c.2049_2050delAGPathogenic11/08/2013 
51LAMA2Ex14NM_000426.3:c.2084A>Tp.Asp695Val | p.D695VNM_000426.3:c.2084A>T, NM_001079823.1:c.2084A>TVOUS**
52LAMA2Ex15NM_000426.3:c.2115T>Gp.Leu705= | p.L705=LRG_409t1:c.2115T>G, NM_000426.3:c.2115T>G, NM_001079823.1:c.2115T>GVOUS06/11/2013
53LAMA2Ex15NM_000426.3:c.2177G>Ap.Cys726Tyr | p.C726YVOUS**
54LAMA2Ex15NM_000426.3:c.2186G>Tp.Gly729Val | p.G729VNM_000426.3:c.2186G>T, NM_001079823.1:c.2186G>T, XM_005266981.1:c.2186G>T, XM_005266982.1:c.2186G>TVOUS04/07/2015
55LAMA2Ex16NM_000426.3:c.2209-6_2209-3delTCTCLRG_409t1:c.2209-6_2209-3delTCTC, NM_000426.3:c.2209-6_2209-3delTCTC, NM_001079823.1:c.2209-6_2209-3delTCTC, XM_005266981.1:c.2209-6_2209-3delTCTC, XM_005266982.1:c.2209-6_2209-3delTCTCVOUS04/30/2018
56LAMA2Ex16NM_000426.3:c.2288C>Tp.Ala763Val | p.A763VLRG_409t1:c.2288C>T, NM_000426.3:c.2288C>T, NM_001079823.1:c.2288C>T, XM_005266981.1:c.2288C>T, XM_005266982.1:c.2288C>TVOUS01/04/2017
57LAMA2Ex16NM_000426.3:c.2289G>Ap.Ala763= | p.A763=NM_000426.3:c.2289G>A, NM_001079823.1:c.2289G>A, XM_005266981.1:c.2289G>A, XM_005266982.1:c.2289G>AVOUS12/12/2014
58LAMA2Ex16NM_000426.3:c.2304C>Tp.Asp768= | p.D768=NM_000426.3:c.2304C>T, NM_001079823.1:c.2304C>TVOUS12/18/2013
59LAMA2Ex16NM_000426.3:c.2318G>Ap.Cys773Tyr | p.C773YLRG_409t1:c.2318G>A, NM_000426.3:c.2318G>A, NM_001079823.1:c.2318G>A, XM_005266981.1:c.2318G>A, XM_005266982.1:c.2318G>AVOUS09/19/2016
60LAMA2Ex17NM_000426.3:c.2324A>Gp.Asn775Ser | p.N775SLRG_409t1:c.2324A>G, NM_000426.3:c.2324A>G, NM_001079823.1:c.2324A>G, XM_005266981.1:c.2324A>G, XM_005266982.1:c.2324A>GVOUS10/13/2017
61LAMA2Ex17NM_000426.3:c.2352T>Gp.Tyr784* | p.Y784XLRG_409t1:c.2352T>G, NM_000426.3:c.2352T>G, NM_001079823.1:c.2352T>G, XM_005266981.1:c.2352T>G, XM_005266982.1:c.2352T>GPathogenic08/04/2016 
62LAMA2Ex17NM_000426.3:c.2375T>Cp.Phe792Ser | p.F792SNM_000426.3:c.2375T>C, NM_001079823.1:c.2375T>CVOUS07/11/2013
63LAMA2Ex17NM_000426.3:c.2382C>Tp.Gly794= | p.G794=NM_000426.3:c.2382C>T, NM_001079823.1:c.2382C>T, XM_005266981.1:c.2382C>T, XM_005266982.1:c.2382C>TVOUS03/06/2015
64LAMA2Ex18NM_000426.3:c.2462C>Tp.Thr821Met | p.T821MNM_000426.3:c.2462C>T, NM_001079823.1:c.2462C>T, XM_005266981.1:c.2462C>T, XM_005266982.1:c.2462C>TVOUS06/22/2015
65LAMA2Ex18NM_000426.3:c.2476C>Tp.Arg826Trp | p.R826WNM_000426.3:c.2476C>T, NM_001079823.1:c.2476C>TBenign12/17/2013 
66LAMA2Ex19NM_000426.3:c.2584T>Cp.Cys862Arg | p.C862RLRG_409t1:c.2584T>C, NM_000426.3:c.2584T>C, NM_001079823.1:c.2584T>C, XM_005266981.1:c.2584T>C, XM_005266982.1:c.2584T>CVOUS05/27/2016
67LAMA2Ex19NM_000426.3:c.2736G>Ap.Ala912= | p.A912=LRG_409t1:c.2736G>A, NM_000426.3:c.2736G>A, NM_001079823.1:c.2736G>A, XM_005266981.1:c.2736G>A, XM_005266982.1:c.2736G>AVOUS05/09/2016
68LAMA2Ex19NM_000426.3:c.2749+1G>CNM_000426.3:c.2749+1G>C, NM_001079823.1:c.2749+1G>C, XM_005266981.1:c.2749+1G>C, XM_005266982.1:c.2749+1G>CPathogenic04/17/2015 
69LAMA2Ex19NM_000426.3:c.2749+34T>CBenign** 
70LAMA2Ex20NM_000426.3:c.2750-1G>CPathogenic02/12/2013 
71LAMA2Ex20NM_000426.3:c.2756G>Tp.Arg919Leu | p.R919LBenign07/18/2012 
72LAMA2Ex20NM_000426.3:c.2799A>Gp.Gln933= | p.Q933=LRG_409t1:c.2799A>G, NM_000426.3:c.2799A>G, NM_001079823.1:c.2799A>GBenign07/10/2012 
73LAMA2Ex20NM_000426.3:c.2831A>Gp.Gln944Arg | p.Q944RNM_000426.3:c.2831A>G, NM_001079823.1:c.2831A>G, XM_005266981.1:c.2831A>G, XM_005266982.1:c.2831A>GVOUS03/31/2015
74LAMA2Ex21NM_000426.3:c.2857-39T>CBenign** 
75LAMA2Ex21NM_000426.3:c.2916T>Gp.Phe972Leu | p.F972LLRG_409t1:c.2916T>G, NM_000426.3:c.2916T>G, NM_001079823.1:c.2916T>G, XM_005266981.1:c.3180T>G, XM_005266982.1:c.3180T>GVOUS06/21/2016
76LAMA2Ex21NM_000426.3:c.2962C>Tp.Gln988* | p.Q988XNM_000426.3:c.2962C>T, NM_001079823.1:c.2962C>TPathogenic06/04/2013 
77LAMA2Ex21NM_000426.3:c.2993G>Ap.Arg998His | p.R998HNM_000426.3:c.2993G>A, NM_001079823.1:c.2993G>A, XM_005266981.1:c.3257G>A, XM_005266982.1:c.3257G>AVOUS02/13/2015
78LAMA2Ex21NM_000426.3:c.3014A>Gp.Asn1005Ser | p.N1005SLRG_409t1:c.3014A>G, NM_000426.3:c.3014A>G, NM_001079823.1:c.3014A>G, XM_005266981.1:c.3278A>G, XM_005266982.1:c.3278A>GVOUS08/25/2016
79LAMA2Ex21NM_000426.3:c.3037+49G>ABenign** 
80LAMA2Ex22NM_000426.3:c.3154A>Gp.Ser1052Gly | p.S1052GNM_000426.3:c.3154A>G, NM_001079823.1:c.3154A>GVOUS**
81LAMA2Ex22NM_000426.3:c.3174+38A>GBenign** 
82LAMA2Ex23NM_000426.3:c.3175-32_3175-31delGTLRG_409t1:c.3175-32_3175-31delGT, NM_000426.3:c.3175-32_3175-31delGT, NM_001079823.1:c.3175-32_3175-31delGT, XM_005266981.1:c.3439-32_3439-31delGT, XM_005266982.1:c.3439-32_3439-31delGTBenign05/27/2016 
83LAMA2Ex23NM_000426.3:c.3215delGNM_000426.3:c.3215delG, NM_001079823.1:c.3215delG, XM_005266981.1:c.3479delG, XM_005266982.1:c.3479delGPathogenic** 
84LAMA2Ex23NM_000426.3:c.3226A>Gp.Thr1076Ala | p.T1076ALRG_409t1:c.3226A>G, NM_000426.3:c.3226A>G, NM_001079823.1:c.3226A>G, XM_005266981.1:c.3490A>G, XM_005266982.1:c.3490A>GVOUS06/13/2019
85LAMA2Ex23NM_000426.3:c.3237C>Ap.Cys1079* | p.C1079XLRG_409t1:c.3237C>A, NM_000426.3:c.3237C>A, NM_001079823.1:c.3237C>A, XM_005266981.1:c.3501C>A, XM_005266982.1:c.3501C>APathogenic03/01/2017 
86LAMA2Ex23NM_000426.3:c.3411+13G>ALRG_409t1:c.3411+13G>A, NM_000426.3:c.3411+13G>A, NM_001079823.1:c.3411+13G>ABenign01/20/2016 
87LAMA2Ex24NM_000426.3:c.3412G>Ap.Val1138Met | p.V1138MNM_000426.3:c.3412G>A, NM_001079823.1:c.3412G>ABenign01/20/2016 
88LAMA2Ex24NM_000426.3:c.3532G>Ap.Ala1178Thr | p.A1178TLRG_409t1:c.3532G>A, NM_000426.3:c.3532G>A, NM_001079823.1:c.3532G>A, XM_005266981.1:c.3796G>A, XM_005266982.1:c.3796G>AVOUS12/15/2016
89LAMA2Ex25NM_000426.3:c.3556-15T>GNM_000426.3:c.3556-15T>G, NM_001079823.1:c.3556-15T>GBenign06/18/2013 
90LAMA2Ex25NM_000426.3:c.3572A>Gp.Glu1191Gly | p.E1191GLRG_409t1:c.3572A>G, NM_000426.3:c.3572A>G, NM_001079823.1:c.3572A>G, XM_005266981.1:c.3836A>G, XM_005266982.1:c.3836A>GVOUS06/13/2019
91LAMA2Ex25NM_000426.3:c.3585A>Gp.Leu1195= | p.L1195=NM_000426.3:c.3585A>G, NM_001079823.1:c.3585A>G, XM_005266981.1:c.3849A>G, XM_005266982.1:c.3849A>GVOUS06/02/2015
92LAMA2Ex25NM_000426.3:c.3613A>Gp.Thr1205Ala | p.T1205ANM_000426.3:c.3613A>G, NM_001079823.1:c.3613A>GBenign** 
93LAMA2Ex25NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCANM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_001079823.1:c.3623_3645delAGGGCATTGTTTTTCAACATCCAPathogenic01/21/2013 
94LAMA2Ex25NM_000426.3:c.3630delTLRG_409t1:c.3630delT, NM_000426.3:c.3630delT, NM_001079823.1:c.3630delTPathogenic09/21/2016 
95LAMA2Ex25NM_000426.3:c.3645A>Gp.Pro1215= | p.P1215=NM_000426.3:c.3645A>G, NM_001079823.1:c.3645A>G, XM_005266981.1:c.3909A>G, XM_005266982.1:c.3909A>GVOUS05/06/2015
96LAMA2Ex25NM_000426.3:c.3685C>Tp.His1229Tyr | p.H1229YLRG_409t1:c.3685C>T, NM_000426.3:c.3685C>T, NM_001079823.1:c.3685C>T, XM_005266981.1:c.3949C>T, XM_005266982.1:c.3949C>TVOUS09/30/2016
97LAMA2Ex25NM_000426.3:c.3718C>Tp.Gln1240* | p.Q1240XLRG_409t1:c.3718C>T, NM_000426.3:c.3718C>T, NM_001079823.1:c.3718C>TPathogenic04/03/2013 
98LAMA2Ex26NM_000426.3:c.3924+2T>CLRG_409t1:c.3924+2T>C, NM_000426.3:c.3924+2T>C, NM_001079823.1:c.3924+2T>C, XM_005266981.1:c.4188+2T>C, XM_005266982.1:c.4188+2T>CPathogenic08/10/2018 
99LAMA2Ex27NM_000426.3:c.3976C>Tp.Arg1326* | p.R1326XNM_000426.3:c.3976C>T, NM_001079823.1:c.3976C>TPathogenic02/06/2015 
100LAMA2Ex27NM_000426.3:c.3979_3985dupGAAGACTp.Phe1329* | p.F1329XLRG_409t1:c.3979_3985dupGAAGACT, LRG_409t1:c.3979_3985insGAAGACT, LRG_409t1:c.3985_3986insGAAGACT, NM_000426.3:c.3979_3985dupGAAGACT, NM_000426.3:c.3979_3985insGAAGACT, NM_000426.3:c.3985_3986insGAAGACT, NM_001079823.1:c.3979_3985dupGAAGACT, NM_001079823.1:c.3979_3985insGAAGACT, NM_001079823.1:c.3985_3986insGAAGACT, XM_005266981.1:c.4243_4249dupGAAGACT, XM_005266981.1:c.4243_4249insGAAGACT, XM_005266981.1:c.4249_4250insGAAGACT, XM_005266982.1:c.4243_4249dupGAAGACT, XM_005266982.1:c.4243_4249insGAAGACT, XM_005266982.1:c.4249_4250insGAAGACTPathogenic02/28/2017 
101LAMA2Ex27NM_000426.3:c.4048C>Tp.Arg1350* | p.R1350XNM_000426.3:c.4048C>T, NM_001079823.1:c.4048C>T, XM_005266981.1:c.4312C>T, XM_005266982.1:c.4312C>TPathogenic11/20/2015 
102LAMA2Ex28NM_000426.3:c.4075A>Gp.Met1359Val | p.M1359VLRG_409t1:c.4075A>G, NM_000426.3:c.4075A>G, NM_001079823.1:c.4075A>G, XM_005266981.1:c.4339A>G, XM_005266982.1:c.4339A>GVOUS06/17/2019
103LAMA2Ex28NM_000426.3:c.4148C>Tp.Pro1383Leu | p.P1383LLRG_409t1:c.4148C>T, NM_000426.3:c.4148C>T, NM_001079823.1:c.4148C>T, XM_005266981.1:c.4412C>T, XM_005266982.1:c.4412C>TVOUS12/11/2017
104LAMA2Ex28NM_000426.3:c.4166T>Cp.Leu1389Pro | p.L1389PLRG_409t1:c.4166T>C, NM_000426.3:c.4166T>C, NM_001079823.1:c.4166T>C, XM_005266981.1:c.4430T>C, XM_005266982.1:c.4430T>CVOUS12/20/2016
105LAMA2Ex30NM_000426.3:c.4312-19_4312-17delTCTVOUS09/11/2012
106LAMA2Ex31NM_000426.3:c.4437-5T>ABenign04/17/2013 
107LAMA2Ex31NM_000426.3:c.4470C>Tp.Asp1490= | p.D1490=Benign04/17/2013 
108LAMA2Ex31NM_000426.3:c.4487C>Tp.Ala1496Val | p.A1496VLRG_409t1:c.4487C>T, NM_000426.3:c.4487C>T, NM_001079823.1:c.4487C>TVOUS06/09/2016
109LAMA2Ex31NM_000426.3:c.4523+1G>APathogenic02/12/2013 
110LAMA2Ex31NM_000426.3:c.4523+19C>TBenign09/21/2012 
111LAMA2Ex32NM_000426.3:c.4620C>Ap.Asp1540Glu | p.D1540ELRG_409t1:c.4620C>A, NM_000426.3:c.4620C>A, NM_001079823.1:c.4620C>A, XM_005266981.1:c.4884C>A, XM_005266982.1:c.4884C>AVOUS08/14/2017
112LAMA2Ex32NM_000426.3:c.4645C>Tp.Arg1549* | p.R1549XPathogenic** 
113LAMA2Ex33NM_000426.3:c.4750G>Ap.Gly1584Ser | p.G1584SNM_000426.3:c.4750G>A, NM_001079823.1:c.4750G>ABenign11/02/2012 
114LAMA2Ex34NM_000426.3:c.4926A>Gp.Thr1642= | p.T1642=NM_000426.3:c.4926A>G, NM_001079823.1:c.4926A>G, XM_005266981.1:c.5190A>G, XM_005266982.1:c.5190A>GVOUS11/17/2014
115LAMA2Ex34NM_000426.3:c.4935C>Ap.Thr1645= | p.T1645=NM_000426.3:c.4935C>A, NM_001079823.1:c.4935C>A, XM_005266981.1:c.5199C>A, XM_005266982.1:c.5199C>ABenign02/18/2016 
116LAMA2Ex34NM_000426.3:c.4956C>Gp.Thr1652= | p.T1652=Benign09/21/2012 
117LAMA2Ex34NM_000426.3:c.4959+6G>TLRG_409t1:c.4959+6G>T, NM_000426.3:c.4959+6G>T, NM_001079823.1:c.4959+6G>T, XM_005266981.1:c.5223+6G>T, XM_005266982.1:c.5223+6G>TVOUS04/21/2017
118LAMA2Ex35NM_000426.3:c.4960-17C>ANM_000426.3:c.4960-17C>A, NM_001079823.1:c.4960-17C>AVOUS**
119LAMA2Ex35NM_000426.3:c.4969G>Ap.Val1657Met | p.V1657MNM_000426.3:c.4969G>A, NM_001079823.1:c.4969G>A, XM_005266981.1:c.5233G>A, XM_005266982.1:c.5233G>AVOUS12/18/2014
120LAMA2Ex35NM_000426.3:c.5050G>Tp.Glu1684* | p.E1684XLRG_409t1:c.5050G>T, NM_000426.3:c.5050G>T, NM_001079823.1:c.5050G>TPathogenic10/02/2015 
121LAMA2Ex35NM_000426.3:c.5071+18A>GBenign** 
122LAMA2Ex36NM_000426.3:c.5072-6delCNM_000426.3:c.5072-6delC, NM_001079823.1:c.5072-6delC, XM_005266981.1:c.5336-6delC, XM_005266982.1:c.5336-6delCBenign08/27/2015 
123LAMA2Ex36NM_000426.3:c.5116C>Tp.Arg1706* | p.R1706XLRG_409t1:c.5116C>T, NM_000426.3:c.5116C>T, NM_001079823.1:c.5116C>T, XM_005266981.1:c.5380C>T, XM_005266982.1:c.5380C>TPathogenic06/01/2016 
124LAMA2Ex37NM_000426.3:c.5247C>Tp.Ala1749= | p.A1749=NM_000426.3:c.5247C>T, NM_001079823.1:c.5247C>TBenign12/13/2013 
125LAMA2Ex37NM_000426.3:c.5260delGNM_000426.3:c.5260delGPathogenic05/13/2014 
126LAMA2Ex37NM_000426.3:c.5280G>Ap.Glu1760= | p.E1760=VOUS**
127LAMA2Ex38NM_000426.3:c.5466A>Gp.Glu1822= | p.E1822=LRG_409t1:c.5466A>G, NM_000426.3:c.5466A>G, NM_001079823.1:c.5466A>GBenign07/18/2012 
128LAMA2Ex38NM_000426.3:c.5469C>Tp.Ser1823= | p.S1823=LRG_409t1:c.5469C>T, NM_000426.3:c.5469C>T, NM_001079823.1:c.5469C>T, XM_005266981.1:c.5733C>T, XM_005266982.1:c.5733C>TVOUS01/04/2017
129LAMA2Ex38NM_000426.3:c.5502G>Ap.Glu1834= | p.E1834=LRG_409t1:c.5502G>A, NM_000426.3:c.5502G>A, NM_001079823.1:c.5502G>ABenign07/18/2012 
130LAMA2Ex38NM_000426.3:c.5518G>Ap.Asp1840Asn | p.D1840NNM_000426.3:c.5518G>A, NM_001079823.1:c.5518G>A, XM_005266981.1:c.5782G>A, XM_005266982.1:c.5782G>AVOUS12/09/2015
131LAMA2Ex38NM_000426.3:c.5530C>Ap.Arg1844Ser | p.R1844SNM_000426.3:c.5530C>A, NM_001079823.1:c.5530C>ABenign10/04/2013 
132LAMA2Ex38NM_000426.3:c.5562+5G>CLRG_409t1:c.5562+5G>C, NM_000426.3:c.5562+5G>C, NM_001079823.1:c.5562+5G>C, XM_005266981.1:c.5826+5G>C, XM_005266982.1:c.5826+5G>CPathogenic04/08/2019 
133LAMA2Ex39NM_000426.3:c.5601T>Gp.Ser1867= | p.S1867=NM_000426.3:c.5601T>G, NM_001079823.1:c.5601T>G, XM_005266981.1:c.5865T>G, XM_005266982.1:c.5865T>GVOUS12/09/2014
134LAMA2Ex39NM_000426.3:c.5605G>Tp.Glu1869* | p.E1869XLRG_409t1:c.5605G>T, NM_000426.3:c.5605G>T, NM_001079823.1:c.5605G>T, XM_005266981.1:c.5869G>T, XM_005266982.1:c.5869G>TPathogenic06/30/2020 
135LAMA2Ex39NM_000426.3:c.5614G>Tp.Asp1872Tyr | p.D1872YVOUS**
136LAMA2Ex39NM_000426.3:c.5633C>Tp.Ser1878Phe | p.S1878FNM_000426.3:c.5633C>T, NM_001079823.1:c.5633C>T, XM_005266981.1:c.5897C>T, XM_005266982.1:c.5897C>TBenign03/11/2013 
137LAMA2Ex39NM_000426.3:c.5688C>Tp.His1896= | p.H1896=LRG_409t1:c.5688C>T, NM_000426.3:c.5688C>T, NM_001079823.1:c.5688C>TBenign06/07/2016 
138LAMA2Ex39NM_000426.3:c.5706_5712delCTCATCTPathogenic08/31/2012 
139LAMA2Ex39NM_000426.3:c.5726+39T>CBenign** 
140LAMA2Ex40NM_000426.3:c.5727-24T>ABenign** 
141LAMA2Ex40NM_000426.3:c.5727-24_5727-21delinsACTGBenign** 
142LAMA2Ex40NM_000426.3:c.5727-22C>TBenign** 
143LAMA2Ex40NM_000426.3:c.5727-21T>GBenign** 
144LAMA2Ex40NM_000426.3:c.5749A>Tp.Ile1917Phe | p.I1917FLRG_409t1:c.5749A>T, NM_000426.3:c.5749A>T, NM_001079823.1:c.5749A>T, XM_005266981.1:c.6013A>T, XM_005266982.1:c.6013A>TVOUS08/22/2019
145LAMA2Ex41NM_000426.3:c.5914C>Tp.Gln1972* | p.Q1972XNM_000426.3:c.5914C>T, NM_001079823.1:c.5914C>T, XM_005266981.1:c.6178C>T, XM_005266982.1:c.6178C>TPathogenic05/13/2014 
146LAMA2Ex41NM_000426.3:c.5968+28T>ABenign** 
147LAMA2Ex42NM_000426.3:c.5969-4G>ALRG_409t1:c.5969-4G>A, NM_000426.3:c.5969-4G>A, NM_001079823.1:c.5969-4G>A, XM_005266981.1:c.6233-4G>A, XM_005266982.1:c.6233-4G>ALikely benign10/12/2016 
148LAMA2Ex42NM_000426.3:c.6002G>Ap.Arg2001Lys | p.R2001KNM_000426.3:c.6002G>A, NM_001079823.1:c.6002G>A, XM_005266981.1:c.6266G>A, XM_005266982.1:c.6266G>AVOUS11/10/2014
149LAMA2Ex42NM_000426.3:c.6011delAPathogenic01/21/2013 
150LAMA2Ex42NM_000426.3:c.6038delTp.Leu2013* | p.L2013XLRG_409t1:c.6038delT, NM_000426.3:c.6038delT, NM_001079823.1:c.6038delTPathogenic07/13/2017 
151LAMA2Ex43NM_000426.3:c.6086-40C>GBenign** 
152LAMA2Ex43NM_000426.3:c.6150T>Cp.Asp2050= | p.D2050=Benign03/14/2013 
153LAMA2Ex43NM_000426.3:c.6161A>Gp.Gln2054Arg | p.Q2054RNM_000426.3:c.6161A>G, NM_001079823.1:c.6161A>G, XM_005266981.1:c.6425A>G, XM_005266982.1:c.6425A>GVOUS02/16/2015
154LAMA2Ex43NM_000426.3:c.6167C>Ap.Thr2056Lys | p.T2056KBenign** 
155LAMA2Ex43NM_000426.3:c.6234A>Gp.Lys2078= | p.K2078=Benign** 
156LAMA2Ex43NM_000426.3:c.6237G>Ap.Thr2079= | p.T2079=NM_000426.3:c.6237G>A, NM_001079823.1:c.6237G>ABenign01/20/2016 
157LAMA2Ex43NM_000426.3:c.6268+5G>CNM_000426.3:c.6268+5G>C, NM_001079823.1:c.6268+5G>C, XM_005266981.1:c.6532+5G>C, XM_005266982.1:c.6532+5G>CVOUS12/03/2015
158LAMA2Ex44NM_000426.3:c.6274+4C>TBenign** 
159LAMA2Ex44NM_000426.3:c.6274+24C>TBenign** 
160LAMA2Ex44NM_000426.3:c.6274+47A>TBenign** 
161LAMA2Ex45NM_000426.3:c.6322C>Tp.Arg2108Trp | p.R2108WNM_000426.3:c.6322C>T, NM_001079823.1:c.6322C>TVOUS05/21/2015
162LAMA2Ex45NM_000426.3:c.6345C>Tp.Pro2115= | p.P2115=LRG_409t1:c.6345C>T, NM_000426.3:c.6345C>T, NM_001079823.1:c.6345C>T, XM_005266981.1:c.6609C>T, XM_005266982.1:c.6609C>TVOUS08/24/2016
163LAMA2Ex45NM_000426.3:c.6426T>Cp.Asn2142= | p.N2142=NM_000426.3:c.6426T>C, NM_001079823.1:c.6426T>C, XM_005266981.1:c.6690T>C, XM_005266982.1:c.6690T>CVOUS12/24/2015
164LAMA2Ex45NM_000426.3:c.6429+8C>ALRG_409t1:c.6429+8C>A, NM_000426.3:c.6429+8C>A, NM_001079823.1:c.6429+8C>A, XM_005266981.1:c.6693+8C>A, XM_005266982.1:c.6693+8C>ALikely benign08/08/2017 
165LAMA2Ex46NM_000426.3:c.6444G>Ap.Val2148= | p.V2148=NM_000426.3:c.6444G>A, NM_001079823.1:c.6444G>A, XM_005266981.1:c.6708G>A, XM_005266982.1:c.6708G>AVOUS10/15/2015
166LAMA2Ex46NM_000426.3:c.6551T>Cp.Phe2184Ser | p.F2184SNM_000426.3:c.6551T>C, NM_001079823.1:c.6551T>CVOUS07/23/2013
167LAMA2Ex46NM_000426.3:c.6563G>Ap.Ser2188Asn | p.S2188NVOUS12/20/2012
168LAMA2Ex47NM_000426.3:c.6617delTPathogenic** 
169LAMA2Ex47NM_000426.3:c.6629T>Cp.Val2210Ala | p.V2210ALRG_409t1:c.6629T>C, NM_000426.3:c.6629T>C, NM_001079823.1:c.6629T>C, XM_005266981.1:c.6893T>C, XM_005266982.1:c.6893T>CVOUS05/30/2018
170LAMA2Ex47NM_000426.3:c.6649G>Ap.Val2217Ile | p.V2217ILRG_409t1:c.6649G>A, NM_000426.3:c.6649G>A, NM_001079823.1:c.6649G>A, XM_005266981.1:c.6913G>A, XM_005266982.1:c.6913G>ABenign04/20/2016 
171LAMA2Ex47NM_000426.3:c.6690C>Ap.Tyr2230* | p.Y2230XPathogenic** 
172LAMA2Ex47NM_000426.3:c.6697G>Ap.Val2233Ile | p.V2233INM_000426.3:c.6697G>A, NM_001079823.1:c.6697G>AVOUS01/27/2014
173LAMA2Ex47NM_000426.3:c.6707+37T>CBenign** 
174LAMA2Ex48NM_000426.3:c.6786G>Ap.Ser2262= | p.S2262=NM_000426.3:c.6786G>A, NM_001079823.1:c.6786G>AVOUS06/18/2013
175LAMA2Ex48NM_000426.3:c.6816T>Cp.Asp2272= | p.D2272=NM_000426.3:c.6816T>C, NM_001079823.1:c.6816T>C, XM_005266981.1:c.7080T>C, XM_005266982.1:c.7080T>CVOUS02/13/2015
176LAMA2Ex48NM_000426.3:c.6832A>Gp.Met2278Val | p.M2278VLRG_409t1:c.6832A>G, NM_000426.3:c.6832A>G, NM_001079823.1:c.6832A>G, XM_005266981.1:c.7096A>G, XM_005266982.1:c.7096A>GVOUS10/07/2016
177LAMA2Ex49NM_000426.3:c.6870G>Ap.Lys2290= | p.K2290=LRG_409t1:c.6870G>A, NM_000426.3:c.6870G>A, NM_001079823.1:c.6870G>A, XM_005266981.1:c.7134G>A, XM_005266982.1:c.7134G>AVOUS06/13/2019
178LAMA2Ex49NM_000426.3:c.6955C>Tp.Arg2319* | p.R2319XLRG_409t1:c.6955C>T, NM_000426.3:c.6955C>T, NM_001079823.1:c.6955C>TPathogenic02/23/2016 
179LAMA2Ex50NM_000426.3:c.6993-44T>CBenign** 
180LAMA2Ex50NM_000426.3:c.7111T>Gp.Phe2371Val | p.F2371VNM_000426.3:c.7111T>G, NM_001079823.1:c.7111T>GVOUS05/29/2013
181LAMA2Ex50NM_000426.3:c.7147C>Tp.Arg2383* | p.R2383XNM_000426.3:c.7147C>T, NM_001079823.1:c.7147C>TPathogenic02/27/2013 
182LAMA2Ex50NM_000426.3:c.7155+1G>ALRG_409t1:c.7155+1G>A, NM_000426.3:c.7155+1G>A, NM_001079823.1:c.7155+1G>A, XM_005266981.1:c.7419+1G>A, XM_005266982.1:c.7419+1G>APathogenic06/09/2016 
183LAMA2Ex51NM_000426.3:c.7250A>Gp.His2417Arg | p.H2417RLRG_409t1:c.7250A>G, NM_000426.3:c.7250A>G, NM_001079823.1:c.7250A>G, XM_005266981.1:c.7514A>G, XM_005266982.1:c.7514A>GVOUS10/19/2017
184LAMA2Ex51NM_000426.3:c.7279_7280delCTNM_000426.3:c.7279_7280delCT, NM_001079823.1:c.7279_7280delCTPathogenic11/08/2013 
185LAMA2Ex51NM_000426.3:c.7288A>Cp.Ile2430Leu | p.I2430LLRG_409t1:c.7288A>C, NM_000426.3:c.7288A>C, NM_001079823.1:c.7288A>C, XM_005266981.1:c.7552A>C, XM_005266982.1:c.7552A>CVOUS10/19/2017
186LAMA2Ex51NM_000426.3:c.7300+10T>ANM_000426.3:c.7300+10T>A, NM_001079823.1:c.7300+10T>A, XM_005266981.1:c.7564+10T>A, XM_005266982.1:c.7564+10T>AVOUS04/07/2015
187LAMA2Ex52NM_000426.3:c.7395T>Cp.Asp2465= | p.D2465=NM_000426.3:c.7395T>C, NM_001079823.1:c.7395T>CVOUS07/17/2013
188LAMA2Ex52NM_000426.3:c.7431A>Tp.Arg2477Ser | p.R2477SLRG_409t1:c.7431A>T, NM_000426.3:c.7431A>T, NM_001079823.1:c.7431A>T, XM_005266981.1:c.7695A>T, XM_005266982.1:c.7695A>TBenign03/01/2016 
189LAMA2Ex52NM_000426.3:c.7439+1G>ALRG_409t1:c.7439+1G>A, NM_000426.3:c.7439+1G>A, NM_001079823.1:c.7439+1G>A, XM_005266981.1:c.7703+1G>A, XM_005266982.1:c.7703+1G>APathogenic05/09/2016 
190LAMA2Ex53NM_000426.3:c.7440-20delTVOUS09/20/2012
191LAMA2Ex53NM_000426.3:c.7440-9G>ANM_000426.3:c.7440-9G>A, NM_001079823.1:c.7439+2029G>A, XM_005266981.1:c.7704-9G>A, XM_005266982.1:c.7703+2029G>AVOUS05/20/2014
192LAMA2Ex54NM_000426.3:c.7536delCPathogenic09/11/2012 
193LAMA2Ex54NM_000426.3:c.7572G>Ap.Glu2524= | p.E2524=NM_000426.3:c.7572G>A, NM_001079823.1:c.7560G>A, XM_005266981.1:c.7836G>A, XM_005266982.1:c.7824G>AVOUS**
194LAMA2Ex55NM_000426.3:c.7732C>Tp.Arg2578* | p.R2578XNM_000426.3:c.7732C>T, NM_001079823.1:c.7720C>TPathogenic04/05/2013 
195LAMA2Ex56NM_000426.3:c.7760C>Tp.Ala2587Val | p.A2587VLRG_409t1:c.7760C>T, NM_000426.3:c.7760C>T, NM_001079823.1:c.7748C>TBenign01/20/2016 
196LAMA2Ex56NM_000426.3:c.7810C>Tp.Arg2604* | p.R2604XNM_000426.3:c.7810C>T, NM_001079823.1:c.7798C>T, XM_005266981.1:c.8074C>T, XM_005266982.1:c.8062C>TPathogenic08/05/2014 
197LAMA2Ex56NM_000426.3:c.7830G>Cp.Val2610= | p.V2610=LRG_409t1:c.7830G>C, NM_000426.3:c.7830G>C, NM_001079823.1:c.7818G>CBenign01/20/2016 
198LAMA2Ex56NM_000426.3:c.7845G>Ap.Pro2615= | p.P2615=LRG_409t1:c.7845G>A, NM_000426.3:c.7845G>A, NM_001079823.1:c.7833G>ABenign01/20/2016 
199LAMA2Ex56NM_000426.3:c.7888C>Tp.Arg2630* | p.R2630XPathogenic** 
200LAMA2Ex57NM_000426.3:c.7906A>Gp.Thr2636Ala | p.T2636ANM_000426.3:c.7906A>G, NM_001079823.1:c.7894A>G, XM_005266981.1:c.8170A>G, XM_005266982.1:c.8158A>GBenign01/20/2016 
201LAMA2Ex57NM_000426.3:c.7965C>Ap.Ile2655= | p.I2655=LRG_409t1:c.7965C>A, NM_000426.3:c.7965C>A, NM_001079823.1:c.7953C>A, XM_005266981.1:c.8229C>A, XM_005266982.1:c.8217C>AVOUS03/29/2017
202LAMA2Ex57NM_000426.3:c.7991delGLRG_409t1:c.7991delG, NM_000426.3:c.7991delG, NM_001079823.1:c.7979delG, XM_005266981.1:c.8255delG, XM_005266982.1:c.8243delGPathogenic09/06/2016 
203LAMA2Ex57NM_000426.3:c.8028T>Cp.Asn2676= | p.N2676=Benign** 
204LAMA2Ex58NM_000426.3:c.8124T>Ap.Gly2708= | p.G2708=LRG_409t1:c.8124T>A, NM_000426.3:c.8124T>A, NM_001079823.1:c.8112T>A, XM_005266981.1:c.8388T>A, XM_005266982.1:c.8376T>ABenign06/01/2016 
205LAMA2Ex58NM_000426.3:c.8126G>Tp.Arg2709Leu | p.R2709LLRG_409t1:c.8126G>T, NM_000426.3:c.8126G>T, NM_001079823.1:c.8114G>T, XM_005266981.1:c.8390G>T, XM_005266982.1:c.8378G>TVOUS03/10/2020
206LAMA2Ex58NM_000426.3:c.8126G>Ap.Arg2709His | p.R2709HNM_000426.3:c.8126G>A, NM_001079823.1:c.8114G>AVOUS12/18/2013
207LAMA2Ex58NM_000426.3:c.8155G>Tp.Glu2719* | p.E2719XLRG_409t1:c.8155G>T, NM_000426.3:c.8155G>T, NM_001079823.1:c.8143G>T, XM_005266981.1:c.8419G>T, XM_005266982.1:c.8407G>TPathogenic03/07/2017 
208LAMA2Ex58NM_000426.3:c.8211A>Cp.Pro2737= | p.P2737=LRG_409t1:c.8211A>C, NM_000426.3:c.8211A>C, NM_001079823.1:c.8199A>C, XM_005266981.1:c.8475A>C, XM_005266982.1:c.8463A>CVOUS09/02/2016
209LAMA2Ex58NM_000426.3:c.8244+3_8244+6delAAGTPathogenic** 
210LAMA2Ex59NM_000426.3:c.8282T>Cp.Ile2761Thr | p.I2761TLRG_409t1:c.8282T>C, NM_000426.3:c.8282T>C, NM_001079823.1:c.8270T>CVOUS03/29/2017
211LAMA2Ex60NM_000426.3:c.8467C>Tp.Pro2823Ser | p.P2823SLRG_409t1:c.8467C>T, NM_000426.3:c.8467C>T, NM_001079823.1:c.8455C>T, XM_005266981.1:c.8731C>T, XM_005266982.1:c.8719C>TVOUS10/28/2016
212LAMA2Ex60NM_000426.3:c.8497G>Tp.Asp2833Tyr | p.D2833YNM_000426.3:c.8497G>T, NM_001079823.1:c.8485G>T, XM_005266981.1:c.8761G>T, XM_005266982.1:c.8749G>TVOUS01/23/2015
213LAMA2Ex60NM_000426.3:c.8528A>Gp.Asn2843Ser | p.N2843SBenign** 
214LAMA2Ex61NM_000426.3:c.8548-10T>CBenign11/05/2012 
215LAMA2Ex61NM_000426.3:c.8556_8558delAATNM_000426.3:c.8556_8558delAAT, NM_001079823.1:c.8544_8546delAATVOUS05/21/2013
216LAMA2Ex61NM_000426.3:c.8586T>Cp.Tyr2862= | p.Y2862=VOUS**
217LAMA2Ex61NM_000426.3:c.8669dupTp.Leu2890Phefs*16 | p.L2890FfsX16LRG_409t1:c.8669dupT, NM_000426.3:c.8669dupT, NM_001079823.1:c.8657dupT, XM_005266981.1:c.8933dupT, XM_005266982.1:c.8921dupTPathogenic07/19/2017 
218LAMA2Ex61NM_000426.3:c.8691A>Gp.Arg2897= | p.R2897=Benign** 
219LAMA2Ex61NM_000426.3:c.8692A>Cp.Arg2898= | p.R2898=LRG_409t1:c.8692A>C, NM_000426.3:c.8692A>C, NM_001079823.1:c.8680A>CVOUS04/19/2017
220LAMA2Ex62NM_000426.3:c.8728G>Ap.Val2910Ile | p.V2910ILRG_409t1:c.8728G>A, NM_000426.3:c.8728G>A, NM_001079823.1:c.8716G>A, XM_005266981.1:c.8992G>A, XM_005266982.1:c.8980G>AVOUS10/28/2016
221LAMA2Ex62NM_000426.3:c.8748delAPathogenic** 
222LAMA2Ex62NM_000426.3:c.8755C>Tp.Pro2919Ser | p.P2919SNM_000426.3:c.8755C>T, NM_001079823.1:c.8743C>TBenign04/09/2014 
223LAMA2Ex62NM_000426.3:c.8842G>Ap.Gly2948Ser | p.G2948SLRG_409t1:c.8842G>A, NM_000426.3:c.8842G>A, NM_001079823.1:c.8830G>A, XM_005266981.1:c.9106G>A, XM_005266982.1:c.9094G>AVOUS04/19/2017
224LAMA2Ex62NM_000426.3:c.8857+44C>TVOUS**
225LAMA2Ex63NM_000426.3:c.8918C>Tp.Thr2973Met | p.T2973MLRG_409t1:c.8918C>T, NM_000426.3:c.8918C>T, NM_001079823.1:c.8906C>T, XM_005266981.1:c.9182C>T, XM_005266982.1:c.9170C>TVOUS10/06/2017
226LAMA2Ex63NM_000426.3:c.8920A>Tp.Thr2974Ser | p.T2974SLRG_409t1:c.8920A>T, NM_000426.3:c.8920A>T, NM_001079823.1:c.8908A>T, XM_005266981.1:c.9184A>T, XM_005266982.1:c.9172A>TVOUS12/11/2017
227LAMA2Ex63NM_000426.3:c.8982T>Cp.Asp2994= | p.D2994=NM_000426.3:c.8982T>C, NM_001079823.1:c.8970T>C, XM_005266981.1:c.9246T>C, XM_005266982.1:c.9234T>CBenign01/15/2015 
228LAMA2Ex64NM_000426.3:c.9101_9104dupAACANM_000426.3:c.9101_9104dup, NM_000426.3:c.9104_9107dup, NM_000426.3:c.9104dup, NM_001079823.1:c.9089_9092dup, NM_001079823.1:c.9092_9095dup, NM_001079823.1:c.9092dupPathogenic07/17/2013 
229LAMA2Ex64NM_000426.3:c.9211+6T>CNM_000426.3:c.9211+6T>C, NM_001079823.1:c.9199+6T>C, XM_005266981.1:c.9475+6T>C, XM_005266982.1:c.9463+6T>CVOUS08/05/2014
230LAMA2Ex64NM_000426.3:c.9211+25A>CBenign** 
231LAMA2Ex65NM_000426.3:c.9212-15C>ABenign** 
232LAMA2Ex65NM_000426.3:c.9212-1G>APathogenic11/01/2012 
233LAMA2Ex65NM_000426.3:c.9252C>Gp.Phe3084Leu | p.F3084LVOUS**
234LAMA2Ex65NM_000426.3:c.9340G>Ap.Val3114Ile | p.V3114INM_000426.3:c.9340G>A, NM_001079823.1:c.9328G>A, XM_005266981.1:c.9604G>A, XM_005266982.1:c.9592G>AVOUS09/30/2015

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.