Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1JAG1Ex1NM_000214.2:c.3G>Ap.Met1? | p.M1?NM_000214.2:c.3G>APathogenic08/03/2017 
2JAG1Ex1NM_000214.2:c.5G>Tp.Arg2Leu | p.R2LNM_000214.2:c.5G>TVOUS03/10/2020
3JAG1Ex1NM_000214.2:c.11C>Tp.Pro4Leu | p.P4LNM_000214.2:c.11C>TVOUS08/23/2017
4JAG1Ex1NM_000214.2:c.-11_-5delGCGGCGCVOUS06/29/2020
5JAG1Ex1NM_000214.2:c.-19C>TVOUS05/07/2020
6JAG1Ex1NM_000214.2:c.19C>Tp.Arg7Cys | p.R7CNM_000214.2:c.19C>TVOUS11/09/2017
7JAG1Ex1NM_000214.2:c.23G>Ap.Gly8Asp | p.G8DNM_000214.2:c.23G>AVOUS10/22/2019
8JAG1Ex1NM_000214.2:c.27G>Cp.Arg9= | p.R9=NM_000214.2:c.27G>CVOUS12/11/2019
9JAG1Ex1NM_000214.2:c.30delCp.Arg12Alafs*3 | p.R12AfsX3NM_000214.2:c.30delCPathogenic01/09/2018 
10JAG1Ex1NM_000214.2:c.36C>Ap.Arg12= | p.R12=NM_000214.2:c.36C>AVOUS10/23/2015
11JAG1Ex1NM_000214.2:c.41delTp.Leu14Glnfs*32 | p.L14QfsX32NM_000214.2:c.41delTPathogenic08/03/2018 
12JAG1Ex1NM_000214.2:c.56C>Tp.Ala19Val | p.A19VNM_000214.2:c.56C>TVOUS06/09/2016
13JAG1Ex1NM_000214.2:c.59T>Cp.Leu20Pro | p.L20PNM_000214.2:c.59T>CVOUS08/22/2017
14JAG1Ex1NM_000214.2:c.64T>Cp.Cys22Arg | p.C22RNM_000214.2:c.64T>CVOUS06/29/2017
15JAG1Ex2NM_000214.2:c.82-2A>GNM_000214.2:c.82-2A>GPathogenic10/13/2017 
16JAG1Ex2NM_000214.2:c.82G>Cp.Val28Leu | p.V28LNM_000214.2:c.82G>CVOUS08/27/2020
17JAG1Ex2NM_000214.2:c.86G>Cp.Cys29Ser | p.C29SNM_000214.2:c.86G>CVOUS10/07/2019
18JAG1Ex2NM_000214.2:c.96G>Cp.Ser32= | p.S32=NM_000214.2:c.96G>CVOUS04/09/2019
19JAG1Ex2NM_000214.2:c.97G>Ap.Gly33Ser | p.G33SNM_000214.2:c.97G>AVOUS07/17/2019
20JAG1Ex2NM_000214.2:c.100C>Tp.Gln34* | p.Q34XNM_000214.2:c.100C>TPathogenic03/30/2017 
21JAG1Ex2NM_000214.2:c.101A>Cp.Gln34Pro | p.Q34PNM_000214.2:c.101A>CVOUS02/07/2019
22JAG1Ex2NM_000214.2:c.104T>Gp.Phe35Cys | p.F35CNM_000214.2:c.104T>GVOUS07/03/2020
23JAG1Ex2NM_000214.2:c.111G>Ap.Leu37= | p.L37=NM_000214.2:c.111G>AVOUS03/01/2021
24JAG1Ex2NM_000214.2:c.133G>Tp.Val45Leu | p.V45LNM_000214.2:c.133G>TBenign05/08/2020 
25JAG1Ex2NM_000214.2:c.173_176delCCCGNM_000214.2:c.173_176delCCCGPathogenic01/27/2016 
26JAG1Ex2NM_000214.2:c.197G>Ap.Cys66Tyr | p.C66YNM_000214.2:c.197G>AVOUS12/01/2017
27JAG1Ex2NM_000214.2:c.203dupGp.Asp69Argfs*4 | p.D69RfsX4NM_000214.2:c.203dupGPathogenic07/05/2018 
28JAG1Ex2NM_000214.2:c.204C>Tp.Arg68= | p.R68=NM_000214.2:c.204C>TVOUS08/16/2016
29JAG1Ex2NM_000214.2:c.233G>Ap.Cys78Tyr | p.C78YNM_000214.2:c.233G>AVOUS05/08/2019
30JAG1Ex2NM_000214.2:c.243G>Cp.Glu81Asp | p.E81DNM_000214.2:c.243G>CVOUS11/14/2019
31JAG1Ex2NM_000214.2:c.247C>Tp.Gln83* | p.Q83XNM_000214.2:c.247C>TPathogenic12/31/2020 
32JAG1Ex2NM_000214.2:c.248A>Gp.Gln83Arg | p.Q83RNM_000214.2:c.248A>GVOUS08/15/2018
33JAG1Ex2NM_000214.2:c.252C>Tp.Ser84= | p.S84=NM_000214.2:c.252C>TVOUS11/29/2018
34JAG1Ex2NM_000214.2:c.265G>Cp.Gly89Arg | p.G89RNM_000214.2:c.265G>CVOUS09/25/2018
35JAG1Ex2NM_000214.2:c.267G>Ap.Gly89= | p.G89=NM_000214.2:c.267G>ABenign06/21/2019 
36JAG1Ex2NM_000214.2:c.270dupGp.Pro91Alafs*53 | p.P91AfsX53NM_000214.2:c.270dupGPathogenic06/12/2017 
37JAG1Ex2NM_000214.2:c.270G>Tp.Gly90= | p.G90=NM_000214.2:c.270G>TBenign08/11/2016 
38JAG1Ex2NM_000214.2:c.287C>Gp.Ser96* | p.S96XNM_000214.2:c.287C>GPathogenic10/02/2018 
39JAG1Ex2NM_000214.2:c.288A>Gp.Ser96= | p.S96=NM_000214.2:c.288A>GVOUS11/20/2018
40JAG1Ex2NM_000214.2:c.294C>Gp.Ser98= | p.S98=NM_000214.2:c.294C>GVOUS12/04/2019
41JAG1Ex2NM_000214.2:c.294C>Tp.Ser98= | p.S98=NM_000214.2:c.294C>TBenign07/25/2017 
42JAG1Ex2NM_000214.2:c.314A>Gp.Asn105Ser | p.N105SNM_000214.2:c.314A>GVOUS10/13/2017
43JAG1Ex2NM_000214.2:c.316A>Gp.Thr106Ala | p.T106ANM_000214.2:c.316A>GVOUS02/06/2019
44JAG1Ex2NM_000214.2:c.358dupAp.Ile120Asnfs*24 | p.I120NfsX24NM_000214.2:c.358dupAPathogenic05/02/2017 
45JAG1Ex2NM_000214.2:c.360C>Tp.Ile120= | p.I120=NM_000214.2:c.360C>TVOUS02/11/2019
46JAG1Ex2NM_000214.2:c.382T>Cp.Trp128Arg | p.W128RNM_000214.2:c.382T>CVOUS08/22/2018
47JAG1Ex3NM_000214.2:c.388-11_388-8delTTGTVOUS10/08/2020
48JAG1Ex3NM_000214.2:c.388-10T>ANM_000214.2:c.388-10T>AVOUS08/25/2017
49JAG1Ex3NM_000214.2:c.388-4G>CNM_000214.2:c.388-4G>CBenign07/10/2017 
50JAG1Ex3NM_000214.2:c.390dupGNM_000214.2:c.390_391insGPathogenic06/30/2016 
51JAG1Ex3NM_000214.2:c.391T>Cp.Ser131Pro | p.S131PNM_000214.2:c.391T>CVOUS02/19/2021
52JAG1Ex3NM_000214.2:c.396T>Cp.Tyr132= | p.Y132=NM_000214.2:c.396T>CVOUS05/30/2019
53JAG1Ex3NM_000214.2:c.399G>Ap.Thr133= | p.T133=NM_000214.2:c.399G>AVOUS12/15/2020
54JAG1Ex3NM_000214.2:c.400T>Cp.Leu134= | p.L134=NM_000214.2:c.400T>CVOUS04/23/2020
55JAG1Ex3NM_000214.2:c.414G>Ap.Ala138= | p.A138=NM_000214.2:c.414G>ALikely benign07/02/2019 
56JAG1Ex3NM_000214.2:c.424A>Cp.Ser142Arg | p.S142RNM_000214.2:c.424A>CVOUS11/12/2019
57JAG1Ex3NM_000214.2:c.435C>Ap.Thr145= | p.T145=NM_000214.2:c.435C>AVOUS10/05/2020
58JAG1Ex3NM_000214.2:c.439C>Tp.Gln147* | p.Q147XNM_000214.2:c.439C>TPathogenic10/02/2020 
59JAG1Ex3NM_000214.2:c.439+1G>ANM_000214.2:c.439+1G>APathogenic12/12/2019 
60JAG1Ex3NM_000214.2:c.439+10G>ANM_000214.2:c.439+10G>ALikely benign12/19/2019 
61JAG1Ex4NM_000214.2:c.440-15T>CBenign03/09/2020 
62JAG1Ex4NM_000214.2:c.441dupAp.Pro148Thrfs*2 | p.P148TfsX2NM_000214.2:c.441dupAPathogenic11/07/2018 
63JAG1Ex4NM_000214.2:c.455T>Ap.Ile152Asn | p.I152NNM_000214.2:c.455T>AVOUS03/28/2019
64JAG1Ex4NM_000214.2:c.459_460insTp.Lys154* | p.K154XNM_000214.2:c.459_460insTPathogenic02/23/2018 
65JAG1Ex4NM_000214.2:c.473C>Gp.Ser158Trp | p.S158WNM_000214.2:c.473C>GVOUS07/25/2018
66JAG1Ex4NM_000214.2:c.473C>Ap.Ser158* | p.S158XNM_000214.2:c.473C>APathogenic09/05/2019 
67JAG1Ex4NM_000214.2:c.474G>Cp.Ser158= | p.S158=NM_000214.2:c.474G>CVOUS11/09/2017
68JAG1Ex4NM_000214.2:c.488C>Tp.Pro163Leu | p.P163LNM_000214.2:c.488C>TVOUS10/02/2019
69JAG1Ex4NM_000214.2:c.488C>Gp.Pro163Arg | p.P163RNM_000214.2:c.488C>GVOUS02/21/2017
70JAG1Ex4NM_000214.2:c.489C>Tp.Pro163= | p.P163=NM_000214.2:c.489C>TVOUS02/21/2020
71JAG1Ex4NM_000214.2:c.493C>Tp.Arg165Trp | p.R165WNM_000214.2:c.493C>TVOUS09/09/2019
72JAG1Ex4NM_000214.2:c.494G>Ap.Arg165Gln | p.R165QNM_000214.2:c.494G>AVOUS10/02/2017
73JAG1Ex4NM_000214.2:c.500G>Ap.Trp167* | p.W167XNM_000214.2:c.500G>APathogenic09/07/2017 
74JAG1Ex4NM_000214.2:c.506C>Tp.Thr169Met | p.T169MNM_000214.2:c.506C>TVOUS02/21/2020
75JAG1Ex4NM_000214.2:c.521C>Tp.Thr174Met | p.T174MNM_000214.2:c.521C>TVOUS01/17/2017
76JAG1Ex4NM_000214.2:c.522G>Ap.Thr174= | p.T174=NM_000214.2:c.522G>AVOUS05/22/2019
77JAG1Ex4NM_000214.2:c.526G>Ap.Val176Ile | p.V176INM_000214.2:c.526G>ALikely benign02/21/2020 
78JAG1Ex4NM_000214.2:c.550C>Tp.Arg184Cys | p.R184CNM_000214.2:c.550C>TPathogenic10/17/2017 
79JAG1Ex4NM_000214.2:c.551G>Ap.Arg184His | p.R184HNM_000214.2:c.551G>APathogenic12/17/2018 
80JAG1Ex4NM_000214.2:c.552C>Tp.Arg184= | p.R184=NM_000214.2:c.552C>TVOUS06/11/2019
81JAG1Ex4NM_000214.2:c.575A>Gp.Tyr192Cys | p.Y192CNM_000214.2:c.575A>GVOUS08/25/2020
82JAG1Ex4NM_000214.2:c.601C>Tp.Arg201Cys | p.R201CNM_000214.2:c.601C>TVOUS10/05/2017
83JAG1Ex4NM_000214.2:c.622G>Tp.Gly208* | p.G208XNM_000214.2:c.622G>TPathogenic10/19/2020 
84JAG1Ex4NM_000214.2:c.635G>Cp.Cys212Ser | p.C212SNM_000214.2:c.635G>CVOUS07/22/2019
85JAG1Ex4NM_000214.2:c.670T>Cp.Trp224Arg | p.W224RNM_000214.2:c.670T>CVOUS02/21/2020
86JAG1Ex4NM_000214.2:c.681C>Tp.Pro227= | p.P227=NM_000214.2:c.681C>TVOUS04/16/2020
87JAG1Ex4NM_000214.2:c.694+1G>TNM_000214.2:c.694+1G>TPathogenic11/13/2017 
88JAG1Ex5NM_000214.2:c.695-5dupTNM_000214.2:c.695-5dupTVOUS07/03/2017
89JAG1Ex5NM_000214.2:c.695-3C>GNM_000214.2:c.695-3C>GVOUS03/08/2019
90JAG1Ex5NM_000214.2:c.695-2A>GNM_000214.2:c.695-2A>GPathogenic04/19/2019 
91JAG1Ex5NM_000214.2:c.702C>Tp.Cys234= | p.C234=NM_000214.2:c.702C>TVOUS10/12/2017
92JAG1Ex5NM_000214.2:c.703C>Tp.Arg235* | p.R235XNM_000214.2:c.703C>TPathogenic02/20/2020 
93JAG1Ex5NM_000214.2:c.711C>Tp.Gly237= | p.G237=NM_000214.2:c.711C>TVOUS03/13/2017
94JAG1Ex5NM_000214.2:c.732T>Gp.Ser244= | p.S244=NM_000214.2:c.732T>GVOUS03/06/2020
95JAG1Ex5NM_000214.2:c.733T>Cp.Cys245Arg | p.C245RNM_000214.2:c.733T>CVOUS09/11/2020
96JAG1Ex5NM_000214.2:c.749A>Gp.Asp250Gly | p.D250GNM_000214.2:c.749A>GVOUS07/02/2020
97JAG1Ex5NM_000214.2:c.752G>Cp.Cys251Ser | p.C251SNM_000214.2:c.752G>CVOUS10/09/2018
98JAG1Ex5NM_000214.2:c.755+1G>APathogenic05/22/2019 
99JAG1Ex6NM_000214.2:c.756-1G>TNM_000214.2:c.756-1G>TPathogenic04/24/2018 
100JAG1Ex6NM_000214.2:c.771G>Ap.Trp257* | p.W257XNM_000214.2:c.771G>APathogenic06/06/2019 
101JAG1Ex6NM_000214.2:c.776G>Tp.Gly259Val | p.G259VNM_000214.2:c.776G>TVOUS05/08/2018
102JAG1Ex6NM_000214.2:c.785G>Ap.Cys262Tyr | p.C262YNM_000214.2:c.785G>AVOUS08/11/2020
103JAG1Ex6NM_000214.2:c.807G>Cp.Pro269= | p.P269=NM_000214.2:c.807G>CVOUS10/01/2019
104JAG1Ex6NM_000214.2:c.812G>Ap.Cys271Tyr | p.C271YNM_000214.2:c.812G>AVOUS03/23/2020
105JAG1Ex6NM_000214.2:c.813C>Gp.Cys271Trp | p.C271WNM_000214.2:c.813C>GVOUS11/09/2017
106JAG1Ex6NM_000214.2:c.814G>Ap.Val272Ile | p.V272INM_000214.2:c.814G>AVOUS10/22/2020
107JAG1Ex6NM_000214.2:c.822delCp.Ile275Serfs*137 | p.I275SfsX137NM_000214.2:c.822delCPathogenic10/21/2020 
108JAG1Ex6NM_000214.2:c.841C>Tp.Gln281* | p.Q281XNM_000214.2:c.841C>TPathogenic09/17/2019 
109JAG1Ex6NM_000214.2:c.851G>Cp.Cys284Ser | p.C284SNM_000214.2:c.851G>CVOUS05/31/2018
110JAG1Ex6NM_000214.2:c.852_853delTGp.Cys284* | p.C284XNM_000214.2:c.852_853delTGPathogenic10/09/2017 
111JAG1Ex6NM_000214.2:c.878G>Ap.Cys293Tyr | p.C293YNM_000214.2:c.878G>AVOUS02/23/2021
112JAG1Ex6NM_000214.2:c.879_880delTGp.Cys293* | p.C293XNM_000214.2:c.879_880delTGPathogenic03/13/2019 
113JAG1Ex6NM_000214.2:c.886+3A>GNM_000214.2:c.886+3A>GLikely pathogenic05/22/2017 
114JAG1Ex7NM_000214.2:c.894T>Cp.Asn298= | p.N298=NM_000214.2:c.894T>CLikely benign03/20/2020 
115JAG1Ex7NM_000214.2:c.909T>Cp.His303= | p.H303=NM_000214.2:c.909T>CLikely benign07/31/2015 
116JAG1Ex7NM_000214.2:c.914C>Tp.Pro305Leu | p.P305LNM_000214.2:c.914C>TVOUS12/09/2019
117JAG1Ex7NM_000214.2:c.915G>Ap.Pro305= | p.P305=NM_000214.2:c.915G>AVOUS03/08/2019
118JAG1Ex7NM_000214.2:c.929delGNM_000214.2:c.929delGPathogenic01/09/2017 
119JAG1Ex7NM_000214.2:c.931A>Gp.Thr311Ala | p.T311ANM_000214.2:c.931A>GVOUS07/12/2017
120JAG1Ex7NM_000214.2:c.986C>Ap.Ser329* | p.S329XNM_000214.2:c.986C>APathogenic04/03/2018 
121JAG1Ex7NM_000214.2:c.992C>Ap.Pro331His | p.P331HNM_000214.2:c.992C>AVOUS08/12/2016
122JAG1Ex7NM_000214.2:c.996C>Ap.Asn332Lys | p.N332KNM_000214.2:c.996C>AVOUS09/03/2019
123JAG1Ex7NM_000214.2:c.1006+7G>CNM_000214.2:c.1006+7G>CVOUS07/12/2018
124JAG1Ex7NM_000214.2:c.1006+8G>AVOUS04/09/2020
125JAG1Ex8NM_000214.2:c.1014C>Tp.His338= | p.H338=NM_000214.2:c.1014C>TVOUS10/01/2019
126JAG1Ex8NM_000214.2:c.1037_1056dupACAACAGAGGCAGCTGTAAGNM_000214.2:c.1056_1057insACAACAGAGGCAGCTGTAAGPathogenic03/29/2016 
127JAG1Ex8NM_000214.2:c.1043G>Ap.Arg348Lys | p.R348KNM_000214.2:c.1043G>ALikely benign08/15/2019 
128JAG1Ex8NM_000214.2:c.1064C>Tp.Ser355Phe | p.S355FVOUS12/03/2019
129JAG1Ex8NM_000214.2:c.1101C>Tp.Thr367= | p.T367=NM_000214.2:c.1101C>TVOUS05/14/2014
130JAG1Ex8NM_000214.2:c.1120+10A>GNM_000214.2:c.1120+10A>GLikely benign12/01/2016 
131JAG1Ex9NM_000214.2:c.1146C>Tp.Asn382= | p.N382=NM_000214.2:c.1146C>TVOUS08/09/2016
132JAG1Ex9NM_000214.2:c.1155C>Tp.His385= | p.H385=NM_000214.2:c.1155C>TVOUS08/07/2019
133JAG1Ex9NM_000214.2:c.1195G>Ap.Val399Met | p.V399MNM_000214.2:c.1195G>AVOUS04/09/2019
134JAG1Ex9NM_000214.2:c.1204C>Gp.Pro402Ala | p.P402ANM_000214.2:c.1204C>GVOUS04/25/2019
135JAG1Ex9NM_000214.2:c.1205dupCp.Gln403Thrfs*13 | p.Q403TfsX13NM_000214.2:c.1205dupCPathogenic12/13/2019 
136JAG1Ex9NM_000214.2:c.1207C>Tp.Gln403* | p.Q403XNM_000214.2:c.1207C>TPathogenic02/23/2015 
137JAG1Ex9NM_000214.2:c.1209G>Ap.Gln403= | p.Q403=NM_000214.2:c.1209G>AVOUS03/26/2019
138JAG1Ex9NM_000214.2:c.1214C>Gp.Thr405Ser | p.T405SNM_000214.2:c.1214C>GVOUS12/12/2016
139JAG1Ex9NM_000214.2:c.1218_1219insGANM_000214.2:c.1218_1219insGAPathogenic08/25/2016 
140JAG1Ex10NM_000214.2:c.1272C>Tp.Ala424= | p.A424=NM_000214.2:c.1272C>TVOUS01/31/2019
141JAG1Ex10NM_000214.2:c.1277C>Tp.Ser426Phe | p.S426FNM_000214.2:c.1277C>TVOUS02/19/2020
142JAG1Ex10NM_000214.2:c.1307G>Ap.Cys436Tyr | p.C436YNM_000214.2:c.1307G>AVOUS02/01/2018
143JAG1Ex10NM_000214.2:c.1308_1325delCGACTGTCTTCCCGGCTGp.Cys436_Gly441del | p.C436_G441delNM_000214.2:c.1308_1325delCGACTGTCTTCCCGGCTGVOUS04/02/2020
144JAG1Ex10NM_000214.2:c.1308C>Tp.Cys436= | p.C436=NM_000214.2:c.1308C>TVOUS04/11/2017
145JAG1Ex10NM_000214.2:c.1309G>Ap.Asp437Asn | p.D437NNM_000214.2:c.1309G>AVOUS12/11/2017
146JAG1Ex10NM_000214.2:c.1325G>Ap.Trp442* | p.W442XNM_000214.2:c.1325G>APathogenic08/11/2017 
147JAG1Ex10NM_000214.2:c.1326G>Ap.Trp442* | p.W442XNM_000214.2:c.1326G>APathogenic05/11/2015 
148JAG1Ex10NM_000214.2:c.1335G>Ap.Gln445= | p.Q445=NM_000214.2:c.1335G>AVOUS07/09/2019
149JAG1Ex10NM_000214.2:c.1346_1347delTANM_000214.2:c.1346_1347delTAPathogenic02/01/2017 
150JAG1Ex10NM_000214.2:c.1348+3G>ANM_000214.2:c.1348+3G>AVOUS03/06/2020
151JAG1Ex11NM_000214.2:c.1349-3dupTNM_000214.2:c.1349-3dupTBenign11/09/2018 
152JAG1Ex11NM_000214.2:c.1353delTp.Asn452Metfs*46 | p.N452MfsX46NM_000214.2:c.1353delTPathogenic08/25/2020 
153JAG1Ex11NM_000214.2:c.1367G>Ap.Gly456Asp | p.G456DNM_000214.2:c.1367G>AVOUS03/02/2018
154JAG1Ex11NM_000214.2:c.1383C>Tp.Asp461= | p.D461=NM_000214.2:c.1383C>TVOUS12/02/2020
155JAG1Ex11NM_000214.2:c.1384G>Ap.Ala462Thr | p.A462TNM_000214.2:c.1384G>AVOUS12/08/2016
156JAG1Ex11NM_000214.2:c.1389C>Tp.Ser463= | p.S463=NM_000214.2:c.1389C>TLikely benign07/10/2019 
157JAG1Ex11NM_000214.2:c.1393C>Tp.Arg465Trp | p.R465WNM_000214.2:c.1393C>TVOUS07/17/2017
158JAG1Ex11NM_000214.2:c.1394G>Ap.Arg465Gln | p.R465QNM_000214.2:c.1394G>AVOUS12/15/2020
159JAG1Ex11NM_000214.2:c.1395+3A>CNM_000214.2:c.1395+3A>CVOUS06/08/2021
160JAG1Ex11NM_000214.2:c.1395+3A>GNM_000214.2:c.1395+3A>GPathogenic12/05/2018 
161JAG1Ex11NM_000214.2:c.1395+5_1395+7delGTAinsATGNM_000214.2:c.1395+5_1395+7delinsATGVOUS09/08/2017
162JAG1Ex12NM_000214.2:c.1396-9_1396-7delCTCNM_000214.2:c.1396-9_1396-7delCTCVOUS03/06/2019
163JAG1Ex12NM_000214.2:c.1396-2A>GNM_000214.2:c.1396-2A>GPathogenic06/30/2020 
164JAG1Ex12NM_000214.2:c.1409_1410delGTp.Gly470Valfs*15 | p.G470VfsX15NM_000214.2:c.1409_1410delGTPathogenic11/19/2018 
165JAG1Ex12NM_000214.2:c.1415G>Ap.Arg472His | p.R472HNM_000214.2:c.1415G>AVOUS04/15/2020
166JAG1Ex12NM_000214.2:c.1419dupTp.Ile474Tyrfs*12 | p.I474YfsX12NM_000214.2:c.1419dupTPathogenic05/31/2019 
167JAG1Ex12NM_000214.2:c.1430C>Tp.Pro477Leu | p.P477LNM_000214.2:c.1430C>TVOUS09/27/2016
168JAG1Ex12NM_000214.2:c.1439C>Tp.Ala480Val | p.A480VNM_000214.2:c.1439C>TLikely benign11/19/2019 
169JAG1Ex12NM_000214.2:c.1443C>Tp.Gly481= | p.G481=NM_000214.2:c.1443C>TVOUS08/14/2018
170JAG1Ex12NM_000214.2:c.1452_1453delTGp.Cys484* | p.C484XNM_000214.2:c.1452_1453delTGPathogenic05/29/2019 
171JAG1Ex12NM_000214.2:c.1452T>Ap.Cys484* | p.C484XNM_000214.2:c.1452T>APathogenic08/27/2020 
172JAG1Ex12NM_000214.2:c.1456dupAp.Arg486Lysfs*5 | p.R486KfsX5NM_000214.2:c.1456dupAPathogenic12/22/2020 
173JAG1Ex12NM_000214.2:c.1459_1460dupGAp.Asp487Glufs*12 | p.D487EfsX12NM_000214.2:c.1459_1460dupGAPathogenic05/31/2017 
174JAG1Ex12NM_000214.2:c.1464C>Tp.Ile488= | p.I488=NM_000214.2:c.1464C>TVOUS08/27/2019
175JAG1Ex12NM_000214.2:c.1481dupAp.Asn494Lysfs*12 | p.N494KfsX12NM_000214.2:c.1481dupAPathogenic07/28/2020 
176JAG1Ex12NM_000214.2:c.1485_1486delCTp.Cys496Phefs*9 | p.C496FfsX9NM_000214.2:c.1485_1486delCTPathogenic01/23/2020 
177JAG1Ex12NM_000214.2:c.1511A>Gp.Asn504Ser | p.N504SNM_000214.2:c.1511A>GVOUS08/09/2019
178JAG1Ex12NM_000214.2:c.1527C>Ap.Phe509Leu | p.F509LNM_000214.2:c.1527C>AVOUS07/28/2020
179JAG1Ex12NM_000214.2:c.1528C>Tp.Gln510* | p.Q510XNM_000214.2:c.1528C>TPathogenic09/01/2017 
180JAG1Ex12NM_000214.2:c.1537T>Cp.Cys513Arg | p.C513RNM_000214.2:c.1537T>CVOUS04/25/2018
181JAG1Ex12NM_000214.2:c.1538_1539delGTp.Cys513Serfs*17 | p.C513SfsX17NM_000214.2:c.1538_1539delGTPathogenic03/11/2019 
182JAG1Ex12NM_000214.2:c.1556G>Cp.Gly519Ala | p.G519ANM_000214.2:c.1556G>CVOUS09/12/2018
183JAG1Ex12NM_000214.2:c.1563_1564delCTp.Cys522Serfs*8 | p.C522SfsX8NM_000214.2:c.1563_1564delCTPathogenic05/20/2019 
184JAG1Ex13NM_000214.2:c.1575C>Tp.Asp525= | p.D525=NM_000214.2:c.1575C>TVOUS12/05/2016
185JAG1Ex13NM_000214.2:c.1578C>Tp.Ile526= | p.I526=NM_000214.2:c.1578C>TLikely benign12/15/2016 
186JAG1Ex13NM_000214.2:c.1602_1603delCCinsGp.Cys534Trpfs*30 | p.C534WfsX30NM_000214.2:c.1602_1603delinsGPathogenic08/05/2020 
187JAG1Ex13NM_000214.2:c.1602C>Gp.Cys534Trp | p.C534WNM_000214.2:c.1602C>GVOUS08/03/2020
188JAG1Ex13NM_000214.2:c.1603delCp.Gln535Argfs*29 | p.Q535RfsX29NM_000214.2:c.1603delCPathogenic08/03/2020 
189JAG1Ex13NM_000214.2:c.1608C>Tp.Asn536= | p.N536=NM_000214.2:c.1608C>TVOUS02/06/2019
190JAG1Ex13NM_000214.2:c.1627C>Tp.Arg543Cys | p.R543CNM_000214.2:c.1627C>TVOUS10/26/2018
191JAG1Ex13NM_000214.2:c.1628G>Ap.Arg543His | p.R543HNM_000214.2:c.1628G>AVOUS12/01/2020
192JAG1Ex13NM_000214.2:c.1644_1645delCTp.Phe548Leufs*8 | p.F548LfsX8NM_000214.2:c.1644_1645delCTPathogenic03/30/2020 
193JAG1Ex13NM_000214.2:c.1655C>Tp.Pro552Leu | p.P552LNM_000214.2:c.1655C>TLikely benign04/03/2017 
194JAG1Ex13NM_000214.2:c.1659G>Tp.Glu553Asp | p.E553DNM_000214.2:c.1659G>TVOUS03/29/2019
195JAG1Ex13NM_000214.2:c.1689G>Ap.Leu563= | p.L563=NM_000214.2:c.1689G>AVOUS11/06/2017
196JAG1Ex13NM_000214.2:c.1704C>Tp.Arg568= | p.R568=NM_000214.2:c.1704C>TVOUS09/29/2017
197JAG1Ex13NM_000214.2:c.1706C>Tp.Thr569Met | p.T569MNM_000214.2:c.1706C>TVOUS12/10/2018
198JAG1Ex13NM_000214.2:c.1713delCp.Cys572Valfs*3 | p.C572VfsX3NM_000214.2:c.1713delCPathogenic08/24/2020 
199JAG1Ex13NM_000214.2:c.1720+1G>ANM_000214.2:c.1720+1G>APathogenic01/21/2019 
200JAG1Ex13NM_000214.2:c.1720+1delGNM_000214.2:c.1720+1delGPathogenic09/02/2016 
201JAG1Ex14NM_000214.2:c.1748C>Tp.Ala583Val | p.A583VNM_000214.2:c.1748C>TVOUS10/26/2017
202JAG1Ex14NM_000214.2:c.1755C>Tp.Asn585= | p.N585=NM_000214.2:c.1755C>TVOUS03/08/2021
203JAG1Ex14NM_000214.2:c.1797T>Cp.Cys599= | p.C599=Likely benign01/07/2020 
204JAG1Ex14NM_000214.2:c.1806C>Tp.His602= | p.H602=NM_000214.2:c.1806C>TLikely benign09/07/2018 
205JAG1Ex14NM_000214.2:c.1815C>Ap.Cys605* | p.C605XNM_000214.2:c.1815C>APathogenic09/17/2019 
206JAG1Ex14NM_000214.2:c.1826C>Tp.Ser609Leu | p.S609LNM_000214.2:c.1826C>TVOUS05/29/2020
207JAG1Ex14NM_000214.2:c.1827G>Cp.Ser609= | p.S609=NM_000214.2:c.1827G>CVOUS08/21/2020
208JAG1Ex14NM_000214.2:c.1845_1846dupTGp.Asp616Valfs*128 | p.D616VfsX128NM_000214.2:c.1845_1846dupTGPathogenic08/28/2019 
209JAG1Ex14NM_000214.2:c.1865C>Tp.Thr622Met | p.T622MNM_000214.2:c.1865C>TVOUS04/01/2020
210JAG1Ex14NM_000214.2:c.1866G>Ap.Thr622= | p.T622=NM_000214.2:c.1866G>AVOUS06/27/2018
211JAG1Ex15NM_000214.2:c.1899_1900delTGp.Cys633* | p.C633XNM_000214.2:c.1899_1900delTGPathogenic04/16/2019 
212JAG1Ex15NM_000214.2:c.1913G>Ap.Cys638Tyr | p.C638YNM_000214.2:c.1913G>AVOUS07/17/2019
213JAG1Ex15NM_000214.2:c.1920C>Tp.Asn640= | p.N640=NM_000214.2:c.1920C>TVOUS12/15/2020
214JAG1Ex15NM_000214.2:c.1971C>Tp.Asp657= | p.D657=NM_000214.2:c.1971C>TVOUS08/10/2017
215JAG1Ex16NM_000214.2:c.2011T>Cp.Cys671Arg | p.C671RNM_000214.2:c.2011T>CVOUS12/19/2017
216JAG1Ex16NM_000214.2:c.2017C>Ap.Gln673Lys | p.Q673KNM_000214.2:c.2017C>AVOUS11/02/2016
217JAG1Ex16NM_000214.2:c.2043G>Ap.Thr681= | p.T681=NM_000214.2:c.2043G>AVOUS06/26/2020
218JAG1Ex16NM_000214.2:c.2049C>Tp.Arg683= | p.R683=NM_000214.2:c.2049C>TVOUS02/28/2020
219JAG1Ex16NM_000214.2:c.2073T>Cp.Cys691= | p.C691=NM_000214.2:c.2073T>CBenign04/18/2019 
220JAG1Ex16NM_000214.2:c.2091G>Ap.Trp697* | p.W697XNM_000214.2:c.2091G>ALikely pathogenic03/08/2021 
221JAG1Ex16NM_000214.2:c.2096_2100delGAAAGp.Gly699Aspfs*6 | p.G699DfsX6NM_000214.2:c.2096_2100delGAAAGPathogenic09/12/2018 
222JAG1Ex16NM_000214.2:c.2113+5G>ANM_000214.2:c.2113+5G>AVOUS09/08/2017
223JAG1Ex17NM_000214.2:c.2118_2119delCAp.Asp706Glufs*4 | p.D706EfsX4NM_000214.2:c.2118_2119delCAPathogenic10/03/2017 
224JAG1Ex17NM_000214.2:c.2122C>Tp.Gln708* | p.Q708XNM_000214.2:c.2122C>TPathogenic07/05/2016 
225JAG1Ex17NM_000214.2:c.2122_2125delCAGTp.Gln708Valfs*34 | p.Q708VfsX34NM_000214.2:c.2122_2125delCAGTPathogenic03/04/2019 
226JAG1Ex17NM_000214.2:c.2126G>Ap.Cys709Tyr | p.C709YNM_000214.2:c.2126G>AVOUS04/17/2020
227JAG1Ex17NM_000214.2:c.2139G>Ap.Thr713= | p.T713=NM_000214.2:c.2139G>AVOUS07/22/2019
228JAG1Ex17NM_000214.2:c.2148C>Tp.Asn716= | p.N716=NM_000214.2:c.2148C>TVOUS11/27/2018
229JAG1Ex17NM_000214.2:c.2162_2166delATGATp.Tyr721* | p.Y721XNM_000214.2:c.2162_2166delATGATPathogenic03/18/2019 
230JAG1Ex17NM_000214.2:c.2188A>Gp.Met730Val | p.M730VNM_000214.2:c.2188A>GVOUS12/03/2020
231JAG1Ex17NM_000214.2:c.2199C>Tp.Gly733= | p.G733=NM_000214.2:c.2199C>TVOUS11/20/2018
232JAG1Ex17NM_000214.2:c.2225_2226delTANM_000214.2:c.2225_2226delTAPathogenic12/07/2016 
233JAG1Ex17NM_000214.2:c.2227+9A>GVOUS12/03/2020
234JAG1Ex17NM_000214.2:c.2227+17C>TBenign05/24/2019 
235JAG1Ex18NM_000214.2:c.2230C>Tp.Arg744* | p.R744XNM_000214.2:c.2230C>TPathogenic01/06/2020 
236JAG1Ex18NM_000214.2:c.2231G>Ap.Arg744Gln | p.R744QNM_000214.2:c.2231G>ALikely benign03/11/2019 
237JAG1Ex18NM_000214.2:c.2270dupGp.Thr758Hisfs*28 | p.T758HfsX28NM_000214.2:c.2270_2271insG, NM_000214.2:c.2270dupGPathogenic03/29/2016 
238JAG1Ex18NM_000214.2:c.2286C>Tp.Asn762= | p.N762=NM_000214.2:c.2286C>TVOUS02/20/2020
239JAG1Ex18NM_000214.2:c.2289C>Tp.Gly763= | p.G763=NM_000214.2:c.2289C>TVOUS04/16/2020
240JAG1Ex18NM_000214.2:c.2298T>Cp.Phe766= | p.F766=NM_000214.2:c.2298T>CVOUS08/26/2016
241JAG1Ex18NM_000214.2:c.2300C>Tp.Thr767Met | p.T767MNM_000214.2:c.2300C>TVOUS06/29/2020
242JAG1Ex18NM_000214.2:c.2301G>Ap.Thr767= | p.T767=NM_000214.2:c.2301G>ALikely benign12/09/2015 
243JAG1Ex18NM_000214.2:c.2304C>Tp.Cys768= | p.C768=NM_000214.2:c.2304C>TVOUS01/31/2018
244JAG1Ex18NM_000214.2:c.2305G>Ap.Val769Ile | p.V769INM_000214.2:c.2305G>AVOUS06/03/2019
245JAG1Ex18NM_000214.2:c.2307C>Tp.Val769= | p.V769=NM_000214.2:c.2307C>TVOUS03/05/2021
246JAG1Ex18NM_000214.2:c.2310C>Ap.Cys770* | p.C770XNM_000214.2:c.2310C>APathogenic06/02/2016 
247JAG1Ex18NM_000214.2:c.2312A>Gp.Lys771Arg | p.K771RNM_000214.2:c.2312A>GVOUS08/10/2020
248JAG1Ex18NM_000214.2:c.2322G>Ap.Trp774* | p.W774XNM_000214.2:c.2322G>APathogenic05/25/2018 
249JAG1Ex18NM_000214.2:c.2329C>Tp.Pro777Ser | p.P777SNM_000214.2:c.2329C>TBenign11/29/2018 
250JAG1Ex18NM_000214.2:c.2344+7G>AVOUS10/20/2020
251JAG1Ex19NM_000214.2:c.2345-8C>TVOUS08/10/2020
252JAG1Ex19NM_000214.2:c.2345-8_2345-6delCTTNM_000214.2:c.2345-8_2345-6delCTTVOUS10/25/2017
253JAG1Ex19NM_000214.2:c.2345-1G>ANM_000214.2:c.2345-1G>APathogenic10/12/2017 
254JAG1Ex19NM_000214.2:c.2350A>Gp.Asn784Asp | p.N784DNM_000214.2:c.2350A>GVOUS03/20/2020
255JAG1Ex19NM_000214.2:c.2370delCp.Cys791Valfs*29 | p.C791VfsX29NM_000214.2:c.2370delCPathogenic01/28/2021 
256JAG1Ex20NM_000214.2:c.2382C>Tp.Ser794= | p.S794=NM_000214.2:c.2382C>TBenign10/17/2019 
257JAG1Ex20NM_000214.2:c.2383G>Ap.Gly795Ser | p.G795SNM_000214.2:c.2383G>AVOUS08/10/2018
258JAG1Ex20NM_000214.2:c.2393T>Ap.Val798Glu | p.V798ENM_000214.2:c.2393T>AVOUS07/13/2018
259JAG1Ex20NM_000214.2:c.2424T>Ap.Cys808* | p.C808XNM_000214.2:c.2424T>APathogenic08/13/2018 
260JAG1Ex20NM_000214.2:c.2429C>Tp.Pro810Leu | p.P810LNM_000214.2:c.2429C>TVOUS12/05/2017
261JAG1Ex20NM_000214.2:c.2451C>Tp.Cys817= | p.C817=NM_000214.2:c.2451C>TVOUS11/22/2019
262JAG1Ex20NM_000214.2:c.2455A>Gp.Ile819Val | p.I819VNM_000214.2:c.2455A>GVOUS10/03/2019
263JAG1Ex20NM_000214.2:c.2458+2_2458+5delTAAGNM_000214.2:c.2458+2_2458+5delTAAGPathogenic08/24/2020 
264JAG1Ex20NM_000214.2:c.2458+10G>CNM_000214.2:c.2458+10G>CVOUS05/10/2018
265JAG1Ex21NM_000214.2:c.2499G>Ap.Ala833= | p.A833=NM_000214.2:c.2499G>AVOUS12/08/2020
266JAG1Ex21NM_000214.2:c.2517C>Tp.Ile839= | p.I839=NM_000214.2:c.2517C>TVOUS08/26/2019
267JAG1Ex21NM_000214.2:c.2522G>Ap.Gly841Asp | p.G841DNM_000214.2:c.2522G>AVOUS08/01/2017
268JAG1Ex21NM_000214.2:c.2528G>Ap.Arg843Gln | p.R843QNM_000214.2:c.2528G>AVOUS03/19/2020
269JAG1Ex21NM_000214.2:c.2530_2552delTGTGTCCCTCCAGGGCACAGinsGCACATp.Cys844Alafs*29 | p.C844AfsX29NM_000214.2:c.2530_2552delinsGCACATPathogenic08/11/2016 
270JAG1Ex21NM_000214.2:c.2538C>Ap.Cys846* | p.C846XNM_000214.2:c.2538C>APathogenic04/09/2020 
271JAG1Ex21NM_000214.2:c.2557G>Tp.Ala853Ser | p.A853SNM_000214.2:c.2557G>TVOUS05/08/2020
272JAG1Ex21NM_000214.2:c.2559C>Tp.Ala853= | p.A853=NM_000214.2:c.2559C>TBenign05/04/2017 
273JAG1Ex21NM_000214.2:c.2566C>Tp.Gln856* | p.Q856XNM_000214.2:c.2566C>TPathogenic10/20/2020 
274JAG1Ex21NM_000214.2:c.2572+1G>TPathogenic05/18/2020 
275JAG1Ex22NM_000214.2:c.2590A>Gp.Ile864Val | p.I864VNM_000214.2:c.2590A>GVOUS01/20/2020
276JAG1Ex22NM_000214.2:c.2601delGinsTGATGCp.Ser868Aspfs*4 | p.S868DfsX4NM_000214.2:c.2601delinsTGATGCPathogenic05/02/2019 
277JAG1Ex22NM_000214.2:c.2601_2603delGAinsTGATGCAp.Ser868Aspfs*12 | p.S868DfsX12NM_000214.2:c.2601_2603delinsTGATGCAPathogenic09/13/2017 
278JAG1Ex22NM_000214.2:c.2604T>Cp.Ser868= | p.S868=NM_000214.2:c.2604T>CVOUS03/29/2018
279JAG1Ex22NM_000214.2:c.2612C>Gp.Pro871Arg | p.P871RNM_000214.2:c.2612C>GBenign02/05/2016 
280JAG1Ex22NM_000214.2:c.2616T>Cp.Asp872= | p.D872=NM_000214.2:c.2616T>CVOUS06/18/2020
281JAG1Ex22NM_000214.2:c.2639_2640delGTp.Cys880* | p.C880XNM_000214.2:c.2639_2640delGTPathogenic08/08/2019 
282JAG1Ex22NM_000214.2:c.2653T>Cp.Cys885Arg | p.C885RNM_000214.2:c.2653T>CVOUS08/17/2018
283JAG1Ex22NM_000214.2:c.2666G>Ap.Arg889Gln | p.R889QNM_000214.2:c.2666G>AVOUS09/04/2020
284JAG1Ex22NM_000214.2:c.2670C>Tp.Ile890= | p.I890=NM_000214.2:c.2670C>TVOUS08/25/2020
285JAG1Ex22NM_000214.2:c.2671G>Ap.Ala891Thr | p.A891TNM_000214.2:c.2671G>AVOUS03/01/2019
286JAG1Ex22NM_000214.2:c.2672_2682+5delCCTGCTCAAAGGTAGGinsANM_000214.2:c.2672_2682+5delinsAPathogenic08/18/2020 
287JAG1Ex22NM_000214.2:c.2673C>Tp.Ala891= | p.A891=NM_000214.2:c.2673C>TVOUS07/02/2020
288JAG1Ex22NM_000214.2:c.2682+1dupGPathogenic08/06/2020 
289JAG1Ex22NM_000214.2:c.2682+1G>TNM_000214.2:c.2682+1G>TPathogenic09/04/2018 
290JAG1Ex22NM_000214.2:c.2682+8A>GNM_000214.2:c.2682+8A>GVOUS08/11/2016
291JAG1Ex23NM_000214.2:c.2689_2693delTGTGGp.Cys897Profs*53 | p.C897PfsX53NM_000214.2:c.2689_2693delTGTGGPathogenic05/18/2017 
292JAG1Ex23NM_000214.2:c.2698C>Tp.Arg900* | p.R900XNM_000214.2:c.2698C>TPathogenic10/17/2019 
293JAG1Ex23NM_000214.2:c.2706C>Ap.Cys902* | p.C902XNM_000214.2:c.2706C>APathogenic06/21/2016 
294JAG1Ex23NM_000214.2:c.2721delGp.His908Thrfs*37 | p.H908TfsX37NM_000214.2:c.2721delGPathogenic09/25/2018 
295JAG1Ex23NM_000214.2:c.2727_2728dupCGp.Glu910Alafs*36 | p.E910AfsX36NM_000214.2:c.2727_2728dupCGPathogenic12/18/2017 
296JAG1Ex23NM_000214.2:c.2727C>Tp.Ser909= | p.S909=NM_000214.2:c.2727C>TVOUS03/27/2019
297JAG1Ex23NM_000214.2:c.2728dupGNM_000214.2:c.2728_2729insGPathogenic06/18/2015 
298JAG1Ex23NM_000214.2:c.2728_2748delGAGTGCCCCAGCGGGCAGAGCp.Glu910_Ser916del | p.E910_S916delNM_000214.2:c.2728_2748delGAGTGCCCCAGCGGGCAGAGCVOUS07/27/2017
299JAG1Ex23NM_000214.2:c.2739C>Tp.Ser913= | p.S913=NM_000214.2:c.2739C>TVOUS02/01/2019
300JAG1Ex23NM_000214.2:c.2743C>Tp.Gln915* | p.Q915XNM_000214.2:c.2743C>TPathogenic11/22/2017 
301JAG1Ex23NM_000214.2:c.2750G>Ap.Cys917Tyr | p.C917YNM_000214.2:c.2750G>AVOUS01/16/2020
302JAG1Ex23NM_000214.2:c.2752A>Gp.Ile918Val | p.I918VNM_000214.2:c.2752A>GVOUS02/26/2021
303JAG1Ex23NM_000214.2:c.2765_2774delACGACCAGTGp.Asp922Alafs*20 | p.D922AfsX20NM_000214.2:c.2765_2774delACGACCAGTGPathogenic12/30/2020 
304JAG1Ex23NM_000214.2:c.2778C>Tp.Phe926= | p.F926=NM_000214.2:c.2778C>TLikely benign10/08/2019 
305JAG1Ex23NM_000214.2:c.2779G>Ap.Val927Ile | p.V927INM_000214.2:c.2779G>AVOUS03/05/2019
306JAG1Ex23NM_000214.2:c.2781C>Tp.Val927= | p.V927=NM_000214.2:c.2781C>TVOUS02/10/2021
307JAG1Ex23NM_000214.2:c.2801G>Ap.Gly934Asp | p.G934DNM_000214.2:c.2801G>AVOUS02/06/2018
308JAG1Ex23NM_000214.2:c.2803G>Tp.Glu935* | p.E935XNM_000214.2:c.2803G>TPathogenic10/02/2018 
309JAG1Ex23NM_000214.2:c.2805G>Ap.Glu935= | p.E935=NM_000214.2:c.2805G>AVOUS09/21/2017
310JAG1Ex23NM_000214.2:c.2807G>Ap.Cys936Tyr | p.C936YNM_000214.2:c.2807G>AVOUS10/24/2017
311JAG1Ex23NM_000214.2:c.2807G>Cp.Cys936Ser | p.C936SNM_000214.2:c.2807G>CVOUS02/08/2019
312JAG1Ex23NM_000214.2:c.2810G>Ap.Arg937Gln | p.R937QNM_000214.2:c.2810G>ALikely benign11/23/2016 
313JAG1Ex23NM_000214.2:c.2830delGNM_000214.2:c.2830delGPathogenic11/23/2016 
314JAG1Ex23NM_000214.2:c.2859T>Cp.Tyr953= | p.Y953=NM_000214.2:c.2859T>CVOUS09/08/2017
315JAG1Ex23NM_000214.2:c.2874_2875delTGp.Ala959Glufs*7 | p.A959EfsX7NM_000214.2:c.2874_2875delTGPathogenic02/20/2020 
316JAG1Ex23NM_000214.2:c.2877G>Ap.Ala959= | p.A959=NM_000214.2:c.2877G>AVOUS01/03/2020
317JAG1Ex23NM_000214.2:c.2882T>Ap.Ile961Asn | p.I961NNM_000214.2:c.2882T>AVOUS10/29/2018
318JAG1Ex24NM_000214.2:c.2917-7G>ANM_000214.2:c.2917-7G>AVOUS02/07/2020
319JAG1Ex24NM_000214.2:c.2917-3_2917-2delTAPathogenic10/20/2020 
320JAG1Ex24NM_000214.2:c.2917-1G>TPathogenic09/16/2019 
321JAG1Ex24NM_000214.2:c.2927_2928dupCGp.Glu977Argfs*8 | p.E977RfsX8NM_000214.2:c.2927_2928dupCGPathogenic09/17/2020 
322JAG1Ex24NM_000214.2:c.2927C>Tp.Thr976Met | p.T976MNM_000214.2:c.2927C>TVOUS07/24/2018
323JAG1Ex24NM_000214.2:c.2929G>Ap.Glu977Lys | p.E977KNM_000214.2:c.2929G>AVOUS11/19/2020
324JAG1Ex24NM_000214.2:c.2966dupTp.Leu989Phefs*7 | p.L989FfsX7NM_000214.2:c.2966dupTPathogenic08/30/2018 
325JAG1Ex24NM_000214.2:c.2979C>Tp.Ser993= | p.S993=NM_000214.2:c.2979C>TVOUS03/10/2020
326JAG1Ex24NM_000214.2:c.2984_2987delAATAp.Glu995Valfs*40 | p.E995VfsX40NM_000214.2:c.2984_2987delAATAPathogenic01/15/2020 
327JAG1Ex24NM_000214.2:c.2988T>Gp.Tyr996* | p.Y996XNM_000214.2:c.2988T>GPathogenic10/28/2019 
328JAG1Ex24NM_000214.2:c.2996A>Cp.Tyr999Ser | p.Y999SNM_000214.2:c.2996A>CVOUS05/31/2017
329JAG1Ex24NM_000214.2:c.2997C>Tp.Tyr999= | p.Y999=NM_000214.2:c.2997C>TVOUS07/21/2020
330JAG1Ex24NM_000214.2:c.2998A>Gp.Ile1000Val | p.I1000VNM_000214.2:c.2998A>GVOUS04/06/2018
331JAG1Ex24NM_000214.2:c.3000C>Tp.Ile1000= | p.I1000=NM_000214.2:c.3000C>TVOUS08/07/2020
332JAG1Ex24NM_000214.2:c.3001G>Ap.Ala1001Thr | p.A1001TNM_000214.2:c.3001G>AVOUS03/22/2018
333JAG1Ex24NM_000214.2:c.3003T>Ap.Ala1001= | p.A1001=NM_000214.2:c.3003T>AVOUS08/17/2020
334JAG1Ex24NM_000214.2:c.3005_3013delGCGAGCCTTp.Cys1002_Pro1004del | p.C1002_P1004delNM_000214.2:c.3005_3013delGCGAGCCTTVOUS03/06/2020
335JAG1Ex24NM_000214.2:c.3006C>Ap.Cys1002* | p.C1002XNM_000214.2:c.3006C>APathogenic01/28/2021 
336JAG1Ex24NM_000214.2:c.3006C>Tp.Cys1002= | p.C1002=NM_000214.2:c.3006C>TVOUS03/12/2019
337JAG1Ex24NM_000214.2:c.3007_3017dupGAGCCTTCCCCp.Ala1008Leufs*32 | p.A1008LfsX32NM_000214.2:c.3007_3017dupGAGCCTTCCCCPathogenic06/22/2018 
338JAG1Ex24NM_000214.2:c.3009_3025dupGCCTTCCCCTTCAGCGAp.Asn1009Serfs*33 | p.N1009SfsX33NM_000214.2:c.3009_3025dupGCCTTCCCCTTCAGCGAPathogenic12/18/2020 
339JAG1Ex24NM_000214.2:c.3031dupGp.Glu1011Glyfs*9 | p.E1011GfsX9NM_000214.2:c.3031dupGPathogenic02/27/2020 
340JAG1Ex24NM_000214.2:c.3038A>Tp.His1013Leu | p.H1013LNM_000214.2:c.3038A>TVOUS12/22/2020
341JAG1Ex24NM_000214.2:c.3045C>Gp.Ala1015= | p.A1015=NM_000214.2:c.3045C>GVOUS03/29/2016
342JAG1Ex24NM_000214.2:c.3048+1G>ANM_000214.2:c.3048+1G>APathogenic03/29/2019 
343JAG1Ex24NM_000214.2:c.3048+1G>TNM_000214.2:c.3048+1G>TPathogenic10/30/2018 
344JAG1Ex25NM_000214.2:c.3063_3064dupACp.Arg1022Hisfs*15 | p.R1022HfsX15NM_000214.2:c.3063_3064dupACPathogenic06/18/2020 
345JAG1Ex25NM_000214.2:c.3065G>Ap.Arg1022Gln | p.R1022QNM_000214.2:c.3065G>AVOUS08/28/2020
346JAG1Ex25NM_000214.2:c.3109delGp.Asp1037Ilefs*12 | p.D1037IfsX12NM_000214.2:c.3109delGPathogenic08/14/2019 
347JAG1Ex25NM_000214.2:c.3114T>Gp.Leu1038= | p.L1038=NM_000214.2:c.3114T>GBenign04/18/2019 
348JAG1Ex25NM_000214.2:c.3127G>Ap.Asp1043Asn | p.D1043NNM_000214.2:c.3127G>AVOUS08/24/2018
349JAG1Ex25NM_000214.2:c.3132A>Cp.Gly1044= | p.G1044=NM_000214.2:c.3132A>CVOUS03/01/2021
350JAG1Ex25NM_000214.2:c.3141G>Ap.Ser1047= | p.S1047=Likely benign12/20/2019 
351JAG1Ex25NM_000214.2:c.3153C>Tp.Ala1051= | p.A1051=NM_000214.2:c.3153C>TVOUS01/19/2018
352JAG1Ex25NM_000214.2:c.3160G>Tp.Glu1054* | p.E1054XNM_000214.2:c.3160G>TPathogenic11/16/2020 
353JAG1Ex25NM_000214.2:c.3164_3167delTAAGp.Val1055Glufs*7 | p.V1055EfsX7NM_000214.2:c.3164_3167delTAAGPathogenic04/24/2017 
354JAG1Ex25NM_000214.2:c.3165_3184delAAGAGTTCAGAGGCGGCCTCp.Arg1056Glufs*46 | p.R1056EfsX46NM_000214.2:c.3165_3184delAAGAGTTCAGAGGCGGCCTCPathogenic12/13/2017 
355JAG1Ex25NM_000214.2:c.3169G>Cp.Val1057Leu | p.V1057LNM_000214.2:c.3169G>CVOUS08/30/2019
356JAG1Ex26NM_000214.2:c.*2A>GVOUS11/19/2020
357JAG1Ex26NM_000214.2:c.*6C>TNM_000214.2:c.*6C>TLikely benign11/08/2018 
358JAG1Ex26NM_000214.2:c.*7G>ANM_000214.2:c.*7G>AVOUS08/14/2018
359JAG1Ex26NM_000214.2:c.*8C>TVOUS02/19/2021
360JAG1Ex26NM_000214.2:c.*9G>ANM_000214.2:c.*9G>AVOUS03/21/2018
361JAG1Ex26NM_000214.2:c.*1572A>GBenign05/06/2020 
362JAG1Ex26NM_000214.2:c.3200-9G>AVOUS09/03/2019
363JAG1Ex26NM_000214.2:c.3213dupCp.Leu1073Alafs*36 | p.L1073AfsX36NM_000214.2:c.3213dupCPathogenic03/23/2018 
364JAG1Ex26NM_000214.2:c.3261G>Tp.Thr1087= | p.T1087=NM_000214.2:c.3261G>TVOUS05/08/2020
365JAG1Ex26NM_000214.2:c.3280C>Tp.Arg1094Trp | p.R1094WNM_000214.2:c.3280C>TVOUS05/16/2019
366JAG1Ex26NM_000214.2:c.3286C>Tp.Arg1096Trp | p.R1096WNM_000214.2:c.3286C>TVOUS02/06/2018
367JAG1Ex26NM_000214.2:c.3287G>Ap.Arg1096Gln | p.R1096QNM_000214.2:c.3287G>AVOUS09/01/2020
368JAG1Ex26NM_000214.2:c.3289C>Tp.Arg1097Trp | p.R1097WNM_000214.2:c.3289C>TVOUS10/15/2018
369JAG1Ex26NM_000214.2:c.3296C>Tp.Pro1099Leu | p.P1099LNM_000214.2:c.3296C>TLikely benign11/04/2016 
370JAG1Ex26NM_000214.2:c.3307A>Gp.Thr1103Ala | p.T1103ANM_000214.2:c.3307A>GVOUS07/28/2020
371JAG1Ex26NM_000214.2:c.3308C>Tp.Thr1103Ile | p.T1103INM_000214.2:c.3308C>TVOUS05/19/2015
372JAG1Ex26NM_000214.2:c.3308C>Ap.Thr1103Lys | p.T1103KNM_000214.2:c.3308C>AVOUS03/02/2017
373JAG1Ex26NM_000214.2:c.3308_3309delCAinsACp.Thr1103Asn | p.T1103NNM_000214.2:c.3308_3309delinsACVOUS06/26/2018
374JAG1Ex26NM_000214.2:c.3309A>Cp.Thr1103= | p.T1103=NM_000214.2:c.3309A>CVOUS03/02/2017
375JAG1Ex26NM_000214.2:c.3329A>Cp.Asn1110Thr | p.N1110TNM_000214.2:c.3329A>CVOUS05/11/2020
376JAG1Ex26NM_000214.2:c.3342C>Tp.Asn1114= | p.N1114=NM_000214.2:c.3342C>TVOUS07/14/2016
377JAG1Ex26NM_000214.2:c.3343G>Ap.Val1115Met | p.V1115MNM_000214.2:c.3343G>AVOUS11/30/2018
378JAG1Ex26NM_000214.2:c.3346C>Tp.Arg1116Trp | p.R1116WNM_000214.2:c.3346C>TVOUS10/14/2019
379JAG1Ex26NM_000214.2:c.3347G>Ap.Arg1116Gln | p.R1116QNM_000214.2:c.3347G>AVOUS05/02/2017
380JAG1Ex26NM_000214.2:c.3351G>Cp.Glu1117Asp | p.E1117DNM_000214.2:c.3351G>CVOUS12/09/2020
381JAG1Ex26NM_000214.2:c.3398C>Tp.Thr1133Met | p.T1133MNM_000214.2:c.3398C>TVOUS07/10/2020
382JAG1Ex26NM_000214.2:c.3417T>Cp.Tyr1139= | p.Y1139=NM_000214.2:c.3417T>CBenign05/30/2018 
383JAG1Ex26NM_000214.2:c.3467T>Cp.Val1156Ala | p.V1156ANM_000214.2:c.3467T>CVOUS12/14/2020
384JAG1Ex26NM_000214.2:c.3478G>Ap.Asp1160Asn | p.D1160NNM_000214.2:c.3478G>AVOUS05/29/2019
385JAG1Ex26NM_000214.2:c.3507G>Cp.Arg1169= | p.R1169=NM_000214.2:c.3507G>CBenign09/14/2017 
386JAG1Ex26NM_000214.2:c.3515A>Gp.Lys1172Arg | p.K1172RNM_000214.2:c.3515A>GVOUS08/12/2016
387JAG1Ex26NM_000214.2:c.3521C>Tp.Pro1174Leu | p.P1174LNM_000214.2:c.3521C>TVOUS07/14/2019
388JAG1Ex26NM_000214.2:c.3524C>Tp.Ala1175Val | p.A1175VNM_000214.2:c.3524C>TVOUS05/17/2018
389JAG1Ex26NM_000214.2:c.3555C>Tp.Pro1185= | p.P1185=NM_000214.2:c.3555C>TVOUS02/04/2020
390JAG1Ex26NM_000214.2:c.3560A>Gp.Asn1187Ser | p.N1187SNM_000214.2:c.3560A>GVOUS09/11/2019
391JAG1Ex26NM_000214.2:c.3561C>Tp.Asn1187= | p.N1187=NM_000214.2:c.3561C>TVOUS03/05/2019
392JAG1Ex26NM_000214.2:c.3566C>Tp.Thr1189Met | p.T1189MNM_000214.2:c.3566C>TVOUS01/26/2021
393JAG1Ex26NM_000214.2:c.3589A>Gp.Thr1197Ala | p.T1197ANM_000214.2:c.3589A>GVOUS11/15/2019
394JAG1Ex26NM_000214.2:c.3629G>Ap.Ser1210Asn | p.S1210NNM_000214.2:c.3629G>AVOUS10/05/2020
395JAG1Ex26NM_000214.2:c.3638G>Ap.Arg1213Gln | p.R1213QNM_000214.2:c.3638G>AVOUS10/09/2017
396JAG1Ex26NM_000214.2:c.3651C>Tp.Ile1217= | p.I1217=NM_000214.2:c.3651C>TVOUS06/21/2016
397JAG1Ex26NM_000214.2:c.3652G>Ap.Val1218Ile | p.V1218INM_000214.2:c.3652G>AVOUS02/24/2017

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.