Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1IDUAEx1NM_000203.3:c.2T>Cp.Met1? | p.M1?VOUS**
2IDUAEx1NM_000203.3:c.24C>Ap.Ala8= | p.A8=NM_000203.3:c.24C>A, NM_022042.2:c.*1725G>T, NM_022042.3:c.*1725G>T, NM_134425.1:c.576+4020G>T, NM_134425.2:c.576+4020G>T, NM_213613.2:c.*1725G>T, NM_213613.3:c.*1725G>T, XM_005272276.1:c.24C>ABenign05/24/2019 
3IDUAEx1NM_000203.3:c.46_57delNNNNNNNNNNNNNM_000203.3:c.46_57delNNNNNNNNNNNN, NM_022042.2:c.*1692_*1703delNNNNNNNNNNNN, NM_022042.3:c.*1692_*1703delNNNNNNNNNNNN, NM_134425.1:c.576+3987_576+3998delNNNNNNNNNNNN, NM_134425.2:c.576+3987_576+3998delNNNNNNNNNNNN, NM_213613.2:c.*1692_*1703delNNNNNNNNNNNN, NM_213613.3:c.*1692_*1703delNNNNNNNNNNNN, XM_005272276.1:c.46_57delNNNNNNNNNNNNPathogenic** 
4IDUAEx1NM_000203.3:c.46_57del1Pathogenic** 
5IDUAEx1NM_000203.3:c.46_57delTCGCTCCTGGCCNM_000203.3:c.46_57delTCGCTCCTGGCC, NM_022042.2:c.*1692_*1703delGGCCAGGAGCGA, NM_134425.1:c.576+3987_576+3998delGGCCAGGAGCGA, NM_213613.2:c.*1692_*1703delGGCCAGGAGCGAPathogenic03/22/2016 
6IDUAEx1NM_000203.3:c.53T>Cp.Leu18Pro | p.L18PNM_000203.3:c.53T>C, NM_022042.2:c.*1696A>G, NM_022042.3:c.*1696A>G, NM_134425.1:c.576+3991A>G, NM_134425.2:c.576+3991A>G, NM_213613.2:c.*1696A>G, NM_213613.3:c.*1696A>G, XM_005272276.1:c.53T>CPathogenic12/22/2016 
7IDUAEx1NM_000203.3:c.60G>Ap.Ala20= | p.A20=NM_000203.3:c.60G>A, NM_022042.2:c.*1689C>T, NM_022042.3:c.*1689C>T, NM_134425.1:c.576+3984C>T, NM_134425.2:c.576+3984C>T, NM_213613.2:c.*1689C>T, NM_213613.3:c.*1689C>T, XM_005272276.1:c.60G>ABenign05/24/2019 
8IDUAEx1NM_000203.3:c.65delCPathogenic** 
9IDUAEx1NM_000203.3:c.99T>Gp.His33Gln | p.H33QNM_000203.3:c.99T>G, NM_022042.2:c.*1650A>C, NM_022042.3:c.*1650A>C, NM_134425.1:c.576+3945A>C, NM_134425.2:c.576+3945A>C, NM_213613.2:c.*1650A>C, NM_213613.3:c.*1650A>C, XM_005272276.1:c.99T>GBenign05/24/2019 
10IDUAEx1NM_000203.3:c.152G>Ap.Gly51Asp | p.G51DNM_000203.3:c.152G>A, NM_022042.2:c.*1597C>T, NM_022042.3:c.*1597C>T, NM_134425.1:c.576+3892C>T, NM_134425.2:c.576+3892C>T, NM_213613.2:c.*1597C>T, NM_213613.3:c.*1597C>T, XM_005272276.1:c.152G>APathogenic06/01/2015 
11IDUAEx2NM_000203.3:c.159-19_160delGCCCCTTTGTTGTCCCCAGCCVOUS06/26/2013
12IDUAEx2NM_000203.3:c.164delCPathogenic03/26/2014 
13IDUAEx2NM_000203.3:c.191_192delACNM_000203.3:c.191_192delAC, NM_022042.2:c.*991_*992delGT, NM_022042.3:c.*991_*992delGT, NM_134425.1:c.576+3286_576+3287delGT, NM_134425.2:c.576+3286_576+3287delGT, NM_213613.2:c.*991_*992delGT, NM_213613.3:c.*991_*992delGT, XM_005272276.1:c.158+599_158+600delACPathogenic09/19/2014 
14IDUAEx2NM_000203.3:c.192C>Ap.Tyr64* | p.Y64XPathogenic** 
15IDUAEx2NM_000203.3:c.208C>Tp.Gln70* | p.Q70XNM_000203.3:c.208C>T, NM_022042.2:c.*975G>A, NM_134425.1:c.576+3270G>A, NM_213613.2:c.*975G>APathogenic11/02/2017 
16IDUAEx2NM_000203.3:c.223G>Ap.Ala75Thr | p.A75TPathogenic** 
17IDUAEx2NM_000203.3:c.234C>Tp.Gly78= | p.G78=NM_000203.3:c.234C>T, NM_022042.2:c.*949G>A, NM_022042.3:c.*949G>A, NM_134425.1:c.576+3244G>A, NM_134425.2:c.576+3244G>A, NM_213613.2:c.*949G>A, NM_213613.3:c.*949G>A, XM_005272276.1:c.158+642C>TLikely benign08/17/2016 
18IDUAEx2NM_000203.3:c.235G>Ap.Ala79Thr | p.A79TNM_000203.3:c.235G>A, NM_022042.2:c.*948C>T, NM_022042.3:c.*948C>T, NM_134425.1:c.576+3243C>T, NM_134425.2:c.576+3243C>T, NM_213613.2:c.*948C>T, NM_213613.3:c.*948C>T, XM_005272276.1:c.158+643G>AOther Reportable05/25/2018 
19IDUAEx2NM_000203.3:c.245A>Cp.His82Pro | p.H82PNM_000203.3:c.245A>C, NM_022042.2:c.*938T>G, NM_022042.3:c.*938T>G, NM_134425.1:c.576+3233T>G, NM_134425.2:c.576+3233T>G, NM_213613.2:c.*938T>G, NM_213613.3:c.*938T>G, XM_005272276.1:c.158+653A>CLikely benign06/19/2014 
20IDUAEx2NM_000203.3:c.246C>Gp.His82Gln | p.H82QNM_000203.3:c.246C>G, NM_022042.2:c.*937G>C, NM_022042.3:c.*937G>C, NM_134425.1:c.576+3232G>C, NM_134425.2:c.576+3232G>C, NM_213613.2:c.*937G>C, NM_213613.3:c.*937G>C, XM_005272276.1:c.158+654C>GOther Reportable07/17/2019 
21IDUAEx2NM_000203.3:c.265C>Tp.Arg89Trp | p.R89WPathogenic** 
22IDUAEx2NM_000203.3:c.266G>Ap.Arg89Gln | p.R89QNM_000203.3:c.266G>A, NM_022042.2:c.*917C>T, NM_022042.3:c.*917C>T, NM_134425.1:c.576+3212C>T, NM_134425.2:c.576+3212C>T, NM_213613.2:c.*917C>T, NM_213613.3:c.*917C>T, XM_005272276.1:c.158+674G>APathogenic** 
23IDUAEx2NM_000203.3:c.296C>Tp.Thr99Ile | p.T99INM_000203.3:c.296C>T, NM_022042.2:c.*887G>A, NM_022042.3:c.*887G>A, NM_134425.1:c.576+3182G>A, NM_134425.2:c.576+3182G>A, NM_213613.2:c.*887G>A, NM_213613.3:c.*887G>A, XM_005272276.1:c.158+704C>TBenign11/08/2019 
24IDUAEx2NM_000203.3:c.299G>Ap.Arg100Lys | p.R100KNM_000203.3:c.299G>A, NM_022042.2:c.*884C>T, NM_022042.3:c.*884C>T, NM_134425.1:c.576+3179C>T, NM_134425.2:c.576+3179C>T, NM_213613.2:c.*884C>T, NM_213613.3:c.*884C>T, XM_005272276.1:c.158+707G>AVOUS09/01/2015
25IDUAEx2NM_000203.3:c.299+1G>TNM_000203.3:c.299+1G>T, NM_022042.2:c.*883C>A, NM_022042.3:c.*883C>A, NM_134425.1:c.576+3178C>A, NM_134425.2:c.576+3178C>A, NM_213613.2:c.*883C>A, NM_213613.3:c.*883C>A, XM_005272276.1:c.158+708G>TPathogenic11/01/2012 
26IDUAEx2NM_000203.3:c.299+6C>TNM_000203.3:c.299+6C>T, NM_022042.2:c.*878G>A, NM_022042.3:c.*878G>A, NM_134425.1:c.576+3173G>A, NM_134425.2:c.576+3173G>A, NM_213613.2:c.*878G>A, NM_213613.3:c.*878G>A, XM_005272276.1:c.158+713C>TBenign03/26/2014 
27IDUAEx2NM_000203.3:c.299+7G>ANM_000203.3:c.299+7G>A, NM_022042.2:c.*877C>T, NM_022042.3:c.*877C>T, NM_134425.1:c.576+3172C>T, NM_134425.2:c.576+3172C>T, NM_213613.2:c.*877C>T, NM_213613.3:c.*877C>T, XM_005272276.1:c.158+714G>ALikely benign09/21/2015 
28IDUAEx3NM_000203.3:c.300-44C>TBenign** 
29IDUAEx3NM_000203.3:c.314G>Ap.Arg105Gln | p.R105QNM_000203.3:c.314G>A, XM_005272276.1:c.173G>ABenign12/11/2015 
30IDUAEx3NM_000203.3:c.340C>Ap.Leu114Met | p.L114MNM_000203.3:c.340C>A, XM_005272276.1:c.199C>AVOUS09/13/2019
31IDUAEx3NM_000203.3:c.352C>Tp.Leu118= | p.L118=NM_000203.3:c.352C>T, XM_005272276.1:c.211C>TBenign05/25/2018 
32IDUAEx3NM_000203.3:c.367G>Ap.Glu123Lys | p.E123KNM_000203.3:c.367G>A, XM_005272276.1:c.226G>AVOUS12/30/2014
33IDUAEx4NM_000203.3:c.386-2A>GNM_000203.3:c.386-2A>G, XM_005272276.1:c.245-2A>GPathogenic** 
34IDUAEx5NM_000203.3:c.494-40G>AVOUS**
35IDUAEx5NM_000203.3:c.494-31G>CVOUS**
36IDUAEx5NM_000203.3:c.494-1G>CNM_000203.3:c.494-1G>C, XM_005272276.1:c.353-1G>CPathogenic06/01/2015 
37IDUAEx5NM_000203.3:c.501C>Gp.Tyr167* | p.Y167XPathogenic04/03/2013 
38IDUAEx5NM_000203.3:c.543T>Cp.Asn181= | p.N181=NM_000203.3:c.543T>C, XM_005272276.1:c.402T>CBenign11/02/2017 
39IDUAEx5NM_000203.3:c.544G>Ap.Glu182Lys | p.E182KNM_000203.3:c.544G>A, XM_005272276.1:c.403G>APathogenic** 
40IDUAEx5NM_000203.3:c.581C>Gp.Thr194Ser | p.T194SNM_000203.3:c.581C>G, XM_005272276.1:c.440C>GVOUS04/27/2016
41IDUAEx5NM_000203.3:c.589+20dupGVOUS**
42IDUAEx6NM_000203.3:c.590-45G>CBenign** 
43IDUAEx6NM_000203.3:c.590-45G>ANM_000203.3:c.590-45G>A, XM_005272276.1:c.449-45G>AVOUS02/01/2017
44IDUAEx6NM_000203.3:c.590-8C>TNM_000203.3:c.590-8C>TBenign11/02/2017 
45IDUAEx6NM_000203.3:c.590-7G>APathogenic** 
46IDUAEx6NM_000203.3:c.590G>Ap.Gly197Asp | p.G197DPathogenic** 
47IDUAEx6NM_000203.3:c.613_617dupTGCTCPathogenic** 
48IDUAEx6NM_000203.3:c.630C>Tp.Arg210= | p.R210=VOUS**
49IDUAEx6NM_000203.3:c.639C>Gp.Ser213Arg | p.S213RNM_000203.3:c.639C>G, XM_005272276.1:c.498C>GVOUS11/28/2017
50IDUAEx6NM_000203.3:c.653T>Cp.Leu218Pro | p.L218PNM_000203.3:c.653T>C, XM_005272276.1:c.512T>CPathogenic12/13/2016 
51IDUAEx6NM_000203.3:c.667G>Ap.Asp223Asn | p.D223NNM_000203.3:c.667G>A, XM_005272276.1:c.526G>AOther Reportable10/17/2019 
52IDUAEx6NM_000203.3:c.713T>Ap.Leu238Gln | p.L238QNM_000203.3:c.713T>A, XM_005272276.1:c.572T>APathogenic** 
53IDUAEx6NM_000203.3:c.719A>Gp.His240Arg | p.H240RNM_000203.3:c.719A>G, XM_005272276.1:c.578A>GPathogenic05/24/2019 
54IDUAEx6NM_000203.3:c.767T>Cp.Leu256Pro | p.L256PNM_000203.3:c.767T>CVOUS08/31/2012
55IDUAEx7NM_000203.3:c.793-14_793-13insTGGACTACATCTCCCTCCACAGGAAGGTGCGCCCTGCCCCTCCGT...(con't)NM_000203.3:c.793-14_793-13insTGGACTACATCTCCCTCCACAGGAAGGTGCGCCCTGCCCCTCCGTCCGCCCCGGTGTTCTGCGCCCTCAGCCGCTGTGCCCCGGGCCGCGCTGACCCTGGTGGTGCTGAVOUS**
56IDUAEx7NM_000203.3:c.793G>Cp.Gly265Arg | p.G265RPathogenic** 
57IDUAEx7NM_000203.3:c.845A>Tp.Gln282Leu | p.Q282LNM_000203.3:c.845A>T, XM_005272276.1:c.804A>TVOUS10/20/2015
58IDUAEx7NM_000203.3:c.891C>Tp.Asn297= | p.N297=NM_000203.3:c.891C>TBenign08/27/2013 
59IDUAEx7NM_000203.3:c.901G>Cp.Asp301His | p.D301HVOUS**
60IDUAEx7NM_000203.3:c.923T>Cp.Leu308Pro | p.L308PNM_000203.3:c.923T>C, XM_005272276.1:c.882T>CVOUS06/29/2017
61IDUAEx7NM_000203.3:c.942G>Cp.Ala314= | p.A314=NM_000203.3:c.942G>C, XM_005272276.1:c.901G>CBenign12/11/2015 
62IDUAEx7NM_000203.3:c.965T>Ap.Val322Glu | p.V322ENM_000203.3:c.965T>A, XM_005272276.1:c.924T>AOther Reportable09/10/2019 
63IDUAEx7NM_000203.3:c.972+1G>ANM_000203.3:c.972+1G>A, XM_005272276.1:c.932G>APathogenic11/21/2014 
64IDUAEx7NM_000203.3:c.972+48A>GBenign** 
65IDUAEx8NM_000203.3:c.973-45G>CBenign** 
66IDUAEx8NM_000203.3:c.973-3C>GVOUS**
67IDUAEx8NM_000203.3:c.979G>Cp.Ala327Pro | p.A327PNM_000203.3:c.979G>CPathogenic01/21/2014 
68IDUAEx8NM_000203.3:c.1039A>Cp.Ser347Arg | p.S347RVOUS**
69IDUAEx8NM_000203.3:c.1045_1047delGACVOUS**
70IDUAEx8NM_000203.3:c.1045G>Cp.Asp349His | p.D349HVOUS**
71IDUAEx8NM_000203.3:c.1045G>Tp.Asp349Tyr | p.D349YNM_000203.3:c.1045G>TPathogenic** 
72IDUAEx8NM_000203.3:c.1045G>Ap.Asp349Asn | p.D349NNM_000203.3:c.1045G>APathogenic12/04/2012 
73IDUAEx8NM_000203.3:c.1081G>Ap.Ala361Thr | p.A361TNM_000203.3:c.1081G>A, XM_005272276.1:c.1147G>ABenign11/02/2017 
74IDUAEx8NM_000203.3:c.1087C>Tp.Arg363Cys | p.R363CPathogenic** 
75IDUAEx8NM_000203.3:c.1091C>Tp.Thr364Met | p.T364MPathogenic** 
76IDUAEx8NM_000203.3:c.1121C>Tp.Thr374Ile | p.T374IVOUS**
77IDUAEx8NM_000203.3:c.1139A>Gp.Gln380Arg | p.Q380RNM_000203.3:c.1139A>GPathogenic** 
78IDUAEx8NM_000203.3:c.1148G>Ap.Arg383His | p.R383HPathogenic** 
79IDUAEx8NM_000203.3:c.1163C>Gp.Thr388Arg | p.T388RNM_000203.3:c.1163C>G, XM_005272276.1:c.1229C>GLikely pathogenic01/13/2017 
80IDUAEx8NM_000203.3:c.1163C>Ap.Thr388Lys | p.T388KNM_000203.3:c.1163C>A, XM_005272276.1:c.1229C>ALikely pathogenic12/22/2016 
81IDUAEx8NM_000203.3:c.1164G>Cp.Thr388= | p.T388=NM_000203.3:c.1164G>C, XM_005272276.1:c.1230G>CBenign11/02/2017 
82IDUAEx8NM_000203.3:c.1174C>Tp.Leu392= | p.L392=NM_000203.3:c.1174C>T, XM_005272276.1:c.1240C>TBenign02/03/2017 
83IDUAEx8NM_000203.3:c.1187T>Cp.Leu396Pro | p.L396PVOUS**
84IDUAEx9NM_000203.3:c.1190-20G>CVOUS**
85IDUAEx9NM_000203.3:c.1190-17C>ANM_000203.3:c.1190-17C>AVOUS**
86IDUAEx9NM_000203.3:c.1190-17_1190-16insANM_000203.3:c.1190-17_1190-16insA, XM_005272276.1:c.1256-17_1256-16insABenign11/02/2017 
87IDUAEx9NM_000203.3:c.1190-10delCNM_000203.3:c.1190-10delC, XM_005272276.1:c.1256-10delCBenign06/29/2017 
88IDUAEx9NM_000203.3:c.1190-10dupCNM_000203.3:c.1190-10_1190-9insC, NM_000203.3:c.1190-10dup, NM_000203.3:c.1190-10dupC, XM_005272276.1:c.1256-10_1256-9insC, XM_005272276.1:c.1256-10dupCBenign07/17/2012 
89IDUAEx9NM_000203.3:c.1190-1G>CNM_000203.3:c.1190-1G>C, XM_005272276.1:c.1256-1G>CPathogenic** 
90IDUAEx9NM_000203.3:c.1205G>Ap.Trp402* | p.W402XNM_000203.3:c.1205G>A, XM_005272276.1:c.1271G>APathogenic05/24/2019 
91IDUAEx9NM_000203.3:c.1225G>Cp.Gly409Arg | p.G409RNM_000203.3:c.1225G>C, XM_005272276.1:c.1291G>CBenign03/09/2015 
92IDUAEx9NM_000203.3:c.1230C>Gp.Thr410= | p.T410=NM_000203.3:c.1230C>G, XM_005272276.1:c.1296C>GBenign11/02/2017 
93IDUAEx9NM_000203.3:c.1238_1264delACAGCAACCACACGGTGGGCGTCCTGGp.Asp413_Leu421del | p.D413_L421delNM_000203.3:c.1238_1264delacagcaaccacacggtgggcgtcctgg, XM_005272276.1:c.1304_1330delacagcaaccacacggtgggcgtcctggVOUS08/07/2017
94IDUAEx9NM_000203.3:c.1271C>Ap.Ala424Asp | p.A424DNM_000203.3:c.1271C>A, XM_005272276.1:c.1337C>AVOUS05/19/2016
95IDUAEx9NM_000203.3:c.1276_1282dupCGCCCCNM_000203.3:c.1282_1283insCGCCCC, XM_005272276.1:c.1348_1349insCGCCCCPathogenic** 
96IDUAEx9NM_000203.3:c.1293C>Tp.Ala431= | p.A431=VOUS**
97IDUAEx9NM_000203.3:c.1302G>Cp.Trp434Cys | p.W434CNM_000203.3:c.1302G>CVOUS08/27/2013
98IDUAEx9NM_000203.3:c.1303C>Gp.Arg435Gly | p.R435GVOUS**
99IDUAEx9NM_000203.3:c.1345C>Ap.His449Asn | p.H449NNM_000203.3:c.1345C>A, XM_005272276.1:c.1411C>AVOUS03/09/2017
100IDUAEx9NM_000203.3:c.1360G>Ap.Val454Ile | p.V454INM_000203.3:c.1360G>A, XM_005272276.1:c.1426G>ABenign11/02/2017 
101IDUAEx9NM_000203.3:c.1402+1G>CPathogenic11/01/2012 
102IDUAEx9NM_000203.3:c.1402+1G>TPathogenic** 
103IDUAEx9NM_000203.3:c.1402+36T>CBenign** 
104IDUAEx10NM_000203.3:c.1467C>Tp.Arg489= | p.R489=NM_000203.3:c.1467C>T, XM_005272276.1:c.1533C>TBenign11/02/2017 
105IDUAEx10NM_000203.3:c.1469T>Cp.Leu490Pro | p.L490PPathogenic07/31/2012 
106IDUAEx10NM_000203.3:c.1487C>Tp.Pro496Leu | p.P496LPathogenic** 
107IDUAEx10NM_000203.3:c.1487C>Gp.Pro496Arg | p.P496RNM_000203.3:c.1487C>G, XM_005272276.1:c.1553C>GPathogenic03/30/2017 
108IDUAEx10NM_000203.3:c.1524+41G>TNM_000203.3:c.1524+41G>T, XM_005272276.1:c.1590+41G>TVOUS**
109IDUAEx11NM_000203.3:c.1525-40T>CBenign** 
110IDUAEx11NM_000203.3:c.1525-38T>CBenign** 
111IDUAEx11NM_000203.3:c.1529C>Gp.Pro510Arg | p.P510RNM_000203.3:c.1529C>G, XM_005272276.1:c.1595C>GLikely pathogenic11/24/2014 
112IDUAEx11NM_000203.3:c.1577T>Cp.Leu526Pro | p.L526PNM_000203.3:c.1577T>C, XM_005272276.1:c.1643T>CPathogenic06/13/2019 
113IDUAEx11NM_000203.3:c.1598C>Tp.Pro533Leu | p.P533LNM_000203.3:c.1598C>T, XM_005272276.1:c.1664C>TLikely pathogenic05/08/2017 
114IDUAEx11NM_000203.3:c.1598C>Gp.Pro533Arg | p.P533RNM_000203.3:c.1598C>G, XM_005272276.1:c.1664C>GPathogenic05/08/2017 
115IDUAEx11NM_000203.3:c.1614delGNM_000203.3:c.1614delGPathogenic04/21/2014 
116IDUAEx11NM_000203.3:c.1622G>Tp.Cys541Phe | p.C541FVOUS**
117IDUAEx11NM_000203.3:c.1632delCPathogenic** 
118IDUAEx11NM_000203.3:c.1650+5G>APathogenic12/06/2012 
119IDUAEx12NM_000203.3:c.1664G>Ap.Arg555His | p.R555HVOUS**
120IDUAEx12NM_000203.3:c.1717G>Tp.Val573Leu | p.V573LVOUS**
121IDUAEx13NM_000203.3:c.1728-3C>GVOUS**
122IDUAEx13NM_000203.3:c.1728-1G>CPathogenic** 
123IDUAEx13NM_000203.3:c.1743C>Gp.Tyr581* | p.Y581XNM_000203.3:c.1743C>GPathogenic** 
124IDUAEx13NM_000203.3:c.1757C>Tp.Ser586Phe | p.S586FNM_000203.3:c.1757C>TVOUS**
125IDUAEx13NM_000203.3:c.1771G>Ap.Ala591Thr | p.A591TBenign07/31/2012 
126IDUAEx13NM_000203.3:c.1772C>Tp.Ala591Val | p.A591VNM_000203.3:c.1772C>T, XM_005272276.1:c.1838C>TVOUS10/01/2015
127IDUAEx13NM_000203.3:c.1799delCNM_000203.3:c.1799delC, XM_005272276.1:c.1865delCPathogenic02/10/2016 
128IDUAEx14NM_000203.3:c.1855C>Tp.Arg619* | p.R619XNM_000203.3:c.1855C>T, XM_005272276.1:c.1921C>TPathogenic03/22/2016 
129IDUAEx14NM_000203.3:c.1861C>Tp.Arg621* | p.R621XPathogenic** 
130IDUAEx14NM_000203.3:c.1882C>Tp.Arg628* | p.R628XPathogenic** 
131IDUAEx14NM_000203.3:c.1898C>Tp.Ser633Leu | p.S633LPathogenic** 
132IDUAEx14NM_000203.3:c.1898C>Gp.Ser633Trp | p.S633WNM_000203.3:c.1898C>G, XM_005272276.1:c.1964C>GPathogenic02/10/2016 
133IDUAEx1NM_000203.4:c.11T>Cp.Leu4Pro | p.L4PNM_000203.3:c.11T>C, NM_022042.2:c.*1738A>G, NM_022042.3:c.*1738A>G, NM_134425.1:c.576+4033A>G, NM_134425.2:c.576+4033A>G, NM_213613.2:c.*1738A>G, NM_213613.3:c.*1738A>G, XM_005272276.1:c.11T>CVOUS01/09/2020
134IDUAEx2NM_000203.4:c.227A>Gp.Tyr76Cys | p.Y76CNM_000203.3:c.227A>G, NM_022042.2:c.*956T>C, NM_022042.3:c.*956T>C, NM_134425.1:c.576+3251T>C, NM_134425.2:c.576+3251T>C, NM_213613.2:c.*956T>C, NM_213613.3:c.*956T>C, XM_005272276.1:c.158+635A>GVOUS12/16/2019

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.