Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1GAAEx2NM_000152.3:c.-2C>TNM_000152.3:c.-2C>T, NM_001079803.1:c.-2C>T, NM_001079804.1:c.-2C>T, NM_017950.2:c.*4810C>T, NM_017950.3:c.*4810C>T, XM_005257193.1:c.-2C>T, XM_005257194.1:c.-2C>T, XM_005257491.1:c.*4810C>TLikely benign10/07/2015 
2GAAEx2NM_000152.3:c.5G>Cp.Gly2Ala | p.G2ALRG_673t1:c.5G>C, NM_000152.3:c.5G>C, NM_001079803.1:c.5G>C, NM_001079804.1:c.5G>C, NM_017950.2:c.*4816G>C, NM_017950.3:c.*4816G>C, XM_005257193.1:c.5G>C, XM_005257194.1:c.5G>C, XM_005257491.1:c.*4816G>CVOUS03/23/2017
3GAAEx2NM_000152.3:c.11G>Ap.Arg4Lys | p.R4KLRG_673t1:c.11G>A, NM_000152.3:c.11G>A, NM_001079803.1:c.11G>A, NM_001079804.1:c.11G>A, NM_017950.2:c.*4822G>A, NM_017950.3:c.*4822G>A, XM_005257193.1:c.11G>A, XM_005257194.1:c.11G>A, XM_005257491.1:c.*4822G>AVOUS11/21/2016
4GAAEx2NM_000152.3:c.17C>Tp.Pro6Leu | p.P6LLRG_673t1:c.17C>T, NM_000152.3:c.17C>T, NM_001079803.1:c.17C>T, NM_001079804.1:c.17C>T, NM_017950.2:c.*4828C>T, NM_017950.3:c.*4828C>T, XM_005257193.1:c.17C>T, XM_005257194.1:c.17C>T, XM_005257491.1:c.*4828C>TVOUS01/05/2017
5GAAEx2NM_000152.3:c.18G>Cp.Pro6= | p.P6=LRG_673t1:c.18G>C, NM_000152.3:c.18G>C, NM_001079803.1:c.18G>C, NM_001079804.1:c.18G>C, NM_017950.2:c.*4829G>C, NM_017950.3:c.*4829G>C, XM_005257193.1:c.18G>C, XM_005257194.1:c.18G>C, XM_005257491.1:c.*4829G>CVOUS07/14/2017
6GAAEx2NM_000152.3:c.18G>Ap.Pro6= | p.P6=LRG_673t1:c.18G>A, NM_000152.3:c.18G>A, NM_001079803.1:c.18G>A, NM_001079804.1:c.18G>A, NM_017950.2:c.*4829G>A, NM_017950.3:c.*4829G>A, XM_005257193.1:c.18G>A, XM_005257194.1:c.18G>A, XM_005257491.1:c.*4829G>AVOUS07/30/2018
7GAAEx2NM_000152.3:c.25T>Cp.Ser9Pro | p.S9PNM_000152.3:c.25T>C, NM_001079803.1:c.25T>C, NM_001079804.1:c.25T>C, NM_017950.2:c.*4836T>C, NM_017950.3:c.*4836T>C, XM_005257193.1:c.25T>C, XM_005257194.1:c.25T>C, XM_005257491.1:c.*4836T>CVOUS10/02/2015
8GAAEx2NM_000152.3:c.-32-13T>GLRG_673t1:c.-32-13T>G, NM_000152.3:c.-32-13T>G, NM_001079803.1:c.-32-13T>G, NM_001079804.1:c.-32-13T>G, NM_017950.2:c.*4767T>G, NM_017950.3:c.*4767T>G, XM_005257193.1:c.-32-13T>G, XM_005257194.1:c.-32-13T>G, XM_005257491.1:c.*4767T>GPathogenic06/19/2019 
9GAAEx2NM_000152.3:c.32G>Ap.Arg11Gln | p.R11QNM_000152.3:c.32G>A, NM_001079803.1:c.32G>A, NM_001079804.1:c.32G>A, NM_017950.2:c.*4843G>A, NM_017950.3:c.*4843G>A, XM_005257193.1:c.32G>A, XM_005257194.1:c.32G>A, XM_005257491.1:c.*4843G>AVOUS10/07/2015
10GAAEx2NM_000152.3:c.67A>Gp.Thr23Ala | p.T23ALRG_673t1:c.67A>G, NM_000152.3:c.67A>G, NM_001079803.1:c.67A>G, NM_001079804.1:c.67A>G, NM_017950.2:c.*4878A>G, NM_017950.3:c.*4878A>G, XM_005257193.1:c.67A>G, XM_005257194.1:c.67A>G, XM_005257491.1:c.*4878A>GVOUS02/13/2018
11GAAEx2NM_000152.3:c.70G>Ap.Ala24Thr | p.A24TLRG_673t1:c.70G>A, NM_000152.3:c.70G>A, NM_001079803.1:c.70G>A, NM_001079804.1:c.70G>A, NM_017950.2:c.*4881G>A, NM_017950.3:c.*4881G>A, XM_005257193.1:c.70G>A, XM_005257194.1:c.70G>A, XM_005257491.1:c.*4881G>AVOUS08/16/2016
12GAAEx2NM_000152.3:c.74C>Tp.Ala25Val | p.A25VLRG_673t1:c.74C>T, NM_000152.3:c.74C>T, NM_001079803.1:c.74C>T, NM_001079804.1:c.74C>T, NM_017950.2:c.*4885C>T, NM_017950.3:c.*4885C>T, XM_005257193.1:c.74C>T, XM_005257194.1:c.74C>T, XM_005257491.1:c.*4885C>TVOUS10/03/2016
13GAAEx2NM_000152.3:c.76C>Tp.Leu26Phe | p.L26FLRG_673t1:c.76C>T, NM_000152.3:c.76C>T, NM_001079803.1:c.76C>T, NM_001079804.1:c.76C>T, NM_017950.2:c.*4887C>T, NM_017950.3:c.*4887C>T, XM_005257193.1:c.76C>T, XM_005257194.1:c.76C>T, XM_005257491.1:c.*4887C>TVOUS07/17/2017
14GAAEx2NM_000152.3:c.83G>Tp.Gly28Val | p.G28VNM_000152.3:c.83G>T, NM_001079803.1:c.83G>T, NM_001079804.1:c.83G>T, NM_017950.2:c.*4894G>T, NM_017950.3:c.*4894G>T, XM_005257193.1:c.83G>T, XM_005257194.1:c.83G>T, XM_005257491.1:c.*4894G>TVOUS09/30/2015
15GAAEx2NM_000152.3:c.116C>Tp.Pro39Leu | p.P39LLRG_673t1:c.116C>T, NM_000152.3:c.116C>T, NM_001079803.1:c.116C>T, NM_001079804.1:c.116C>T, NM_017950.2:c.*4927C>T, NM_017950.3:c.*4927C>T, XM_005257193.1:c.116C>T, XM_005257194.1:c.116C>T, XM_005257491.1:c.*4927C>TVOUS10/13/2017
16GAAEx2NM_000152.3:c.118C>Tp.Arg40* | p.R40XLRG_673t1:c.118C>T, NM_000152.3:c.118C>T, NM_001079803.1:c.118C>T, NM_001079804.1:c.118C>T, NM_017950.2:c.*4929C>T, NM_017950.3:c.*4929C>T, XM_005257193.1:c.118C>T, XM_005257194.1:c.118C>T, XM_005257491.1:c.*4929C>TPathogenic** 
17GAAEx2NM_000152.3:c.212A>Gp.His71Arg | p.H71RLRG_673t1:c.212A>G, NM_000152.3:c.212A>G, NM_001079803.1:c.212A>G, NM_001079804.1:c.212A>G, NM_017950.2:c.*5023A>G, NM_017950.3:c.*5023A>G, XM_005257193.1:c.212A>G, XM_005257194.1:c.212A>G, XM_005257491.1:c.*5023A>GVOUS02/28/2017
18GAAEx2NM_000152.3:c.216C>Tp.Pro72= | p.P72=LRG_673t1:c.216C>T, NM_000152.3:c.216C>T, NM_001079803.1:c.216C>T, NM_001079804.1:c.216C>T, NM_017950.2:c.*5027C>T, NM_017950.3:c.*5027C>T, XM_005257193.1:c.216C>T, XM_005257194.1:c.216C>T, XM_005257491.1:c.*5027C>TVOUS08/25/2017
19GAAEx2NM_000152.3:c.247G>Ap.Asp83Asn | p.D83NLRG_673t1:c.247G>A, NM_000152.3:c.247G>A, NM_001079803.1:c.247G>A, NM_001079804.1:c.247G>A, NM_017950.2:c.*5058G>A, NM_017950.3:c.*5058G>A, XM_005257193.1:c.247G>A, XM_005257194.1:c.247G>A, XM_005257491.1:c.*5058G>AVOUS09/06/2016
20GAAEx2NM_000152.3:c.249C>Tp.Asp83= | p.D83=LRG_673t1:c.249C>T, NM_000152.3:c.249C>T, NM_001079803.1:c.249C>T, NM_001079804.1:c.249C>T, NM_017950.2:c.*5060C>T, NM_017950.3:c.*5060C>T, XM_005257193.1:c.249C>T, XM_005257194.1:c.249C>T, XM_005257491.1:c.*5060C>TVOUS02/24/2017
21GAAEx2NM_000152.3:c.250G>Ap.Val84Ile | p.V84ILRG_673t1:c.250G>A, NM_000152.3:c.250G>A, NM_001079803.1:c.250G>A, NM_001079804.1:c.250G>A, NM_017950.2:c.*5061G>A, NM_017950.3:c.*5061G>A, XM_005257193.1:c.250G>A, XM_005257194.1:c.250G>A, XM_005257491.1:c.*5061G>AVOUS01/25/2018
22GAAEx2NM_000152.3:c.257C>Gp.Pro86Arg | p.P86RLRG_673t1:c.257C>G, NM_000152.3:c.257C>G, NM_001079803.1:c.257C>G, NM_001079804.1:c.257C>G, NM_017950.2:c.*5068C>G, NM_017950.3:c.*5068C>G, XM_005257193.1:c.257C>G, XM_005257194.1:c.257C>G, XM_005257491.1:c.*5068C>GBenign10/05/2016 
23GAAEx2NM_000152.3:c.258dupCp.Asn87Glnfs*9 | p.N87QfsX9LRG_673t1:c.258dupC, NM_000152.3:c.258_259insC, NM_000152.3:c.258dupC, NM_001079803.1:c.258_259insC, NM_001079803.1:c.258dupC, NM_001079804.1:c.258_259insC, NM_001079804.1:c.258dupC, NM_017950.2:c.*5069_*5070insC, NM_017950.2:c.*5069dupC, NM_017950.3:c.*5069_*5070insC, NM_017950.3:c.*5069dupC, XM_005257193.1:c.258_259insC, XM_005257193.1:c.258dupC, XM_005257194.1:c.258_259insC, XM_005257194.1:c.258dupC, XM_005257491.1:c.*5069_*5070insC, XM_005257491.1:c.*5069dupCPathogenic01/16/2019 
24GAAEx2NM_000152.3:c.258C>Ap.Pro86= | p.P86=LRG_673t1:c.258C>A, NM_000152.3:c.258C>A, NM_001079803.1:c.258C>A, NM_001079804.1:c.258C>A, NM_017950.2:c.*5069C>A, NM_017950.3:c.*5069C>A, XM_005257193.1:c.258C>A, XM_005257194.1:c.258C>A, XM_005257491.1:c.*5069C>ABenign07/21/2015 
25GAAEx2NM_000152.3:c.265C>Tp.Arg89Cys | p.R89CLRG_673t1:c.265C>T, NM_000152.3:c.265C>T, NM_001079803.1:c.265C>T, NM_001079804.1:c.265C>T, NM_017950.2:c.*5076C>T, NM_017950.3:c.*5076C>T, XM_005257193.1:c.265C>T, XM_005257194.1:c.265C>T, XM_005257491.1:c.*5076C>TVOUS05/17/2019
26GAAEx2NM_000152.3:c.266G>Ap.Arg89His | p.R89HLRG_673t1:c.266G>A, NM_000152.3:c.266G>A, NM_001079803.1:c.266G>A, NM_001079804.1:c.266G>A, NM_017950.2:c.*5077G>A, NM_017950.3:c.*5077G>A, XM_005257193.1:c.266G>A, XM_005257194.1:c.266G>A, XM_005257491.1:c.*5077G>AVOUS09/13/2016
27GAAEx2NM_000152.3:c.271_272delGAinsAGNM_000152.3:c.271_272delinsAG, NM_001079803.1:c.271_272delinsAG, NM_001079804.1:c.271_272delinsAG, NM_017950.2:c.*5082_*5083delinsAG, NM_017950.3:c.*5082_*5083delinsAG, NP_000143.2:Asp91Ser, XM_005257193.1:c.271_272delinsAG, XM_005257194.1:c.271_272delinsAG, XM_005257491.1:c.*5082_*5083delinsAGVOUS05/12/2014
28GAAEx2NM_000152.3:c.271G>Ap.Asp91Asn | p.D91NLRG_673t1:c.271G>A, NM_000152.3:c.271G>A, NM_001079803.1:c.271G>A, NM_001079804.1:c.271G>A, NM_017950.2:c.*5082G>A, NM_017950.3:c.*5082G>A, XM_005257193.1:c.271G>A, XM_005257194.1:c.271G>A, XM_005257491.1:c.*5082G>AOther Reportable04/29/2019 
29GAAEx2NM_000152.3:c.276C>Ap.Cys92* | p.C92XLRG_673t1:c.276C>A, NM_000152.3:c.276C>A, NM_001079803.1:c.276C>A, NM_001079804.1:c.276C>A, NM_017950.2:c.*5087C>A, NM_017950.3:c.*5087C>A, XM_005257193.1:c.276C>A, XM_005257194.1:c.276C>A, XM_005257491.1:c.*5087C>APathogenic09/17/2019 
30GAAEx2NM_000152.3:c.297C>Tp.Thr99= | p.T99=LRG_673t1:c.297C>T, NM_000152.3:c.297C>T, NM_001079803.1:c.297C>T, NM_001079804.1:c.297C>T, NM_017950.2:c.*5108C>T, NM_017950.3:c.*5108C>T, XM_005257193.1:c.297C>T, XM_005257194.1:c.297C>T, XM_005257491.1:c.*5108C>TVOUS11/17/2016
31GAAEx2NM_000152.3:c.307T>Gp.Cys103Gly | p.C103GLRG_673t1:c.307T>G, NM_000152.3:c.307T>G, NM_001079803.1:c.307T>G, NM_001079804.1:c.307T>G, NM_017950.2:c.*5118T>G, NM_017950.3:c.*5118T>G, XM_005257193.1:c.307T>G, XM_005257194.1:c.307T>G, XM_005257491.1:c.*5118T>GPathogenic07/21/2019 
32GAAEx2NM_000152.3:c.310G>Ap.Glu104Lys | p.E104KLRG_673t1:c.310G>A, NM_000152.3:c.310G>A, NM_001079803.1:c.310G>A, NM_001079804.1:c.310G>A, NM_017950.2:c.*5121G>A, NM_017950.3:c.*5121G>A, XM_005257193.1:c.310G>A, XM_005257194.1:c.310G>A, XM_005257491.1:c.*5121G>AVOUS12/25/2016
33GAAEx2NM_000152.3:c.317G>Ap.Arg106His | p.R106HLRG_673t1:c.317G>A, NM_000152.3:c.317G>A, NM_001079803.1:c.317G>A, NM_001079804.1:c.317G>A, NM_017950.2:c.*5128G>A, NM_017950.3:c.*5128G>A, XM_005257193.1:c.317G>A, XM_005257194.1:c.317G>A, XM_005257491.1:c.*5128G>AVOUS03/01/2016
34GAAEx2NM_000152.3:c.318C>Tp.Arg106= | p.R106=NM_000152.3:c.318C>T, NM_001079803.1:c.318C>T, NM_001079804.1:c.318C>T, NM_017950.2:c.*5129C>T, NM_017950.3:c.*5129C>T, XM_005257193.1:c.318C>T, XM_005257194.1:c.318C>T, XM_005257491.1:c.*5129C>TVOUS12/02/2016
35GAAEx2NM_000152.3:c.324T>Cp.Cys108= | p.C108=LRG_673t1:c.324T>C, NM_000152.3:c.324T>C, NM_001079803.1:c.324T>C, NM_001079804.1:c.324T>C, NM_017950.2:c.*5135T>C, NM_017950.3:c.*5135T>C, XM_005257193.1:c.324T>C, XM_005257194.1:c.324T>C, XM_005257491.1:c.*5135T>CBenign07/02/2019 
36GAAEx2NM_000152.3:c.351G>Ap.Leu117= | p.L117=NM_000152.3:c.351G>A, NM_001079803.1:c.351G>A, NM_001079804.1:c.351G>A, NM_017950.2:c.*5162G>A, NM_017950.3:c.*5162G>A, XM_005257193.1:c.351G>A, XM_005257194.1:c.351G>A, XM_005257491.1:c.*5162G>ALikely benign10/07/2015 
37GAAEx2NM_000152.3:c.362A>Gp.Gln121Arg | p.Q121RNM_000152.3:c.362A>G, NM_001079803.1:c.362A>G, NM_001079804.1:c.362A>G, NM_017950.2:c.*5173A>G, NM_017950.3:c.*5173A>G, XM_005257193.1:c.362A>G, XM_005257194.1:c.362A>G, XM_005257491.1:c.*5173A>GVOUS05/31/2016
38GAAEx2NM_000152.3:c.368G>Ap.Gly123Glu | p.G123ENM_000152.3:c.368G>A, NM_001079803.1:c.368G>A, NM_001079804.1:c.368G>A, NM_017950.2:c.*5179G>A, NM_017950.3:c.*5179G>A, XM_005257193.1:c.368G>A, XM_005257194.1:c.368G>A, XM_005257491.1:c.*5179G>ALikely benign10/07/2015 
39GAAEx2NM_000152.3:c.370C>Gp.Gln124Glu | p.Q124ELRG_673t1:c.370C>G, NM_000152.3:c.370C>G, NM_001079803.1:c.370C>G, NM_001079804.1:c.370C>G, NM_017950.2:c.*5181C>G, NM_017950.3:c.*5181C>G, XM_005257193.1:c.370C>G, XM_005257194.1:c.370C>G, XM_005257491.1:c.*5181C>GVOUS02/07/2018
40GAAEx2NM_000152.3:c.379_380delTGp.Cys127Leufs*18 | p.C127LfsX18LRG_673t1:c.379_380delTG, NM_000152.3:c.379_380delTG, NM_001079803.1:c.379_380delTG, NM_001079804.1:c.379_380delTG, NM_017950.2:c.*5190_*5191delTG, NM_017950.3:c.*5190_*5191delTG, XM_005257193.1:c.379_380delTG, XM_005257194.1:c.379_380delTG, XM_005257491.1:c.*5190_*5191delTGPathogenic01/12/2018 
41GAAEx2NM_000152.3:c.412C>Gp.Leu138Val | p.L138VLRG_673t1:c.412C>G, NM_000152.3:c.412C>G, NM_001079803.1:c.412C>G, NM_001079804.1:c.412C>G, NM_017950.2:c.*5223C>G, NM_017950.3:c.*5223C>G, XM_005257193.1:c.412C>G, XM_005257194.1:c.412C>G, XM_005257491.1:c.*5223C>GVOUS09/17/2016
42GAAEx2NM_000152.3:c.444C>Tp.Tyr148= | p.Y148=NM_000152.3:c.444C>T, NM_001079803.1:c.444C>T, NM_001079804.1:c.444C>T, NM_017950.2:c.*5255C>T, NM_017950.3:c.*5255C>T, XM_005257193.1:c.444C>T, XM_005257194.1:c.444C>T, XM_005257491.1:c.*5255C>TVOUS01/22/2016
43GAAEx2NM_000152.3:c.447G>Ap.Thr149= | p.T149=LRG_673t1:c.447G>A, NM_000152.3:c.447G>A, NM_001079803.1:c.447G>A, NM_001079804.1:c.447G>A, NM_017950.2:c.*5258G>A, NM_017950.3:c.*5258G>A, XM_005257193.1:c.447G>A, XM_005257194.1:c.447G>A, XM_005257491.1:c.*5258G>ABenign05/06/2015 
44GAAEx2NM_000152.3:c.460C>Tp.Arg154Cys | p.R154CLRG_673t1:c.460C>T, NM_000152.3:c.460C>T, NM_001079803.1:c.460C>T, NM_001079804.1:c.460C>T, NM_017950.2:c.*5271C>T, NM_017950.3:c.*5271C>T, XM_005257193.1:c.460C>T, XM_005257194.1:c.460C>T, XM_005257491.1:c.*5271C>TVOUS11/17/2016
45GAAEx2NM_000152.3:c.468C>Tp.Thr156= | p.T156=LRG_673t1:c.468C>T, NM_000152.3:c.468C>T, NM_001079803.1:c.468C>T, NM_001079804.1:c.468C>T, NM_017950.2:c.*5279C>T, NM_017950.3:c.*5279C>T, XM_005257193.1:c.468C>T, XM_005257194.1:c.468C>T, XM_005257491.1:c.*5279C>TVOUS09/22/2016
46GAAEx2NM_000152.3:c.482_483delCCp.Pro161Glnfs*15 | p.P161QfsX15LRG_673t1:c.482_483delCC, NM_000152.3:c.482_483delCC, NM_001079803.1:c.482_483delCC, NM_001079804.1:c.482_483delCC, NM_017950.2:c.*5293_*5294delCC, NM_017950.3:c.*5293_*5294delCC, XM_005257193.1:c.482_483delCC, XM_005257194.1:c.482_483delCC, XM_005257491.1:c.*5293_*5294delCCPathogenic02/14/2018 
47GAAEx2NM_000152.3:c.510C>Tp.Asp170= | p.D170=LRG_673t1:c.510C>T, NM_000152.3:c.510C>T, NM_001079803.1:c.510C>T, NM_001079804.1:c.510C>T, NM_017950.2:c.*5321C>T, NM_017950.3:c.*5321C>T, XM_005257193.1:c.510C>T, XM_005257194.1:c.510C>T, XM_005257491.1:c.*5321C>TVOUS05/29/2019
48GAAEx2NM_000152.3:c.525delTp.Glu176Argfs*45 | p.E176RfsX45LRG_673t1:c.525delT, NM_000152.3:c.525delT, NM_001079803.1:c.525delT, NM_001079804.1:c.525delT, NM_017950.2:c.*5336delT, NM_017950.3:c.*5336delT, XM_005257193.1:c.525delT, XM_005257194.1:c.525delT, XM_005257491.1:c.*5336delTPathogenic08/21/2019 
49GAAEx2NM_000152.3:c.534C>Gp.Arg178= | p.R178=LRG_673t1:c.534C>G, NM_000152.3:c.534C>G, NM_001079803.1:c.534C>G, NM_001079804.1:c.534C>G, NM_017950.2:c.*5345C>G, NM_017950.3:c.*5345C>G, XM_005257193.1:c.534C>G, XM_005257194.1:c.534C>G, XM_005257491.1:c.*5345C>GVOUS03/17/2016
50GAAEx2NM_000152.3:c.545C>Gp.Thr182Arg | p.T182RLRG_673t1:c.545C>G, NM_000152.3:c.545C>G, NM_001079803.1:c.545C>G, NM_001079804.1:c.545C>G, NM_017950.2:c.*5356C>G, NM_017950.3:c.*5356C>G, XM_005257193.1:c.545C>G, XM_005257194.1:c.545C>G, XM_005257491.1:c.*5356C>GVOUS10/09/2017
51GAAEx2NM_000152.3:c.546G>Tp.Thr182= | p.T182=LRG_673t1:c.546G>T, NM_000152.3:c.546G>T, NM_001079803.1:c.546G>T, NM_001079804.1:c.546G>T, NM_017950.2:c.*5357G>T, NM_017950.3:c.*5357G>T, XM_005257193.1:c.546G>T, XM_005257194.1:c.546G>T, XM_005257491.1:c.*5357G>TPathogenic10/01/2019 
52GAAEx2NM_000152.3:c.546G>Cp.Thr182= | p.T182=LRG_673t1:c.546G>C, NM_000152.3:c.546G>C, NM_001079803.1:c.546G>C, NM_001079804.1:c.546G>C, NM_017950.2:c.*5357G>C, NM_017950.3:c.*5357G>C, XM_005257193.1:c.546G>C, XM_005257194.1:c.546G>C, XM_005257491.1:c.*5357G>CPathogenic07/06/2015 
53GAAEx2NM_000152.3:c.546G>Ap.Thr182= | p.T182=LRG_673t1:c.546G>A, NM_000152.3:c.546G>A, NM_001079803.1:c.546G>A, NM_001079804.1:c.546G>A, NM_017950.2:c.*5357G>A, NM_017950.3:c.*5357G>A, XM_005257193.1:c.546G>A, XM_005257194.1:c.546G>A, XM_005257491.1:c.*5357G>APathogenic11/22/2017 
54GAAEx2NM_000152.3:c.546+1_546+4delGTGGNM_000152.3:c.546+1_546+4delGTGG, NM_001079803.1:c.546+1_546+4delGTGG, NM_001079804.1:c.546+1_546+4delGTGG, NM_017950.2:c.*5358_*5361delGTGG, NM_017950.3:c.*5358_*5361delGTGG, XM_005257193.1:c.546+1_546+4delGTGG, XM_005257194.1:c.546+1_546+4delGTGG, XM_005257491.1:c.*5358_*5361delGTGGPathogenic** 
55GAAEx2NM_000152.3:c.546+1G>TPathogenic10/23/2019 
56GAAEx2NM_000152.3:c.546+3G>ANM_000152.3:c.546+3G>A, NM_001079803.1:c.546+3G>A, NM_001079804.1:c.546+3G>A, NM_017950.2:c.*5360G>A, NM_017950.3:c.*5360G>A, XM_005257193.1:c.546+3G>A, XM_005257194.1:c.546+3G>A, XM_005257491.1:c.*5360G>AVOUS02/13/2018
57GAAEx2NM_000152.3:c.546+6C>TNM_000152.3:c.546+6C>T, NM_001079803.1:c.546+6C>T, NM_001079804.1:c.546+6C>T, NM_017950.2:c.*5363C>T, NM_017950.3:c.*5363C>T, XM_005257193.1:c.546+6C>T, XM_005257194.1:c.546+6C>T, XM_005257491.1:c.*5363C>TVOUS11/07/2015
58GAAEx2NM_000152.3:c.546+8G>ALRG_673t1:c.546+8G>A, NM_000152.3:c.546+8G>A, NM_001079803.1:c.546+8G>A, NM_001079804.1:c.546+8G>A, NM_017950.2:c.*5365G>A, NM_017950.3:c.*5365G>A, XM_005257193.1:c.546+8G>A, XM_005257194.1:c.546+8G>A, XM_005257491.1:c.*5365G>AVOUS10/03/2016
59GAAEx2NM_000152.3:c.546+18G>ANM_000152.3:c.546+18G>A, NM_001079803.1:c.546+18G>A, NM_001079804.1:c.546+18G>A, NM_017950.2:c.*5375G>A, NM_017950.3:c.*5375G>A, XM_005257193.1:c.546+18G>A, XM_005257194.1:c.546+18G>A, XM_005257491.1:c.*5375G>ABenign07/30/2015 
60GAAEx3NM_000152.3:c.547-67C>GLRG_673t1:c.547-67C>G, NM_000152.3:c.547-67C>G, NM_001079803.1:c.547-67C>G, NM_001079804.1:c.547-67C>G, XM_005257193.1:c.547-67C>G, XM_005257194.1:c.547-67C>GBenign07/31/2019 
61GAAEx3NM_000152.3:c.547-39T>GLRG_673t1:c.547-39T>G, NM_000152.3:c.547-39T>G, NM_001079803.1:c.547-39T>G, NM_001079804.1:c.547-39T>G, XM_005257193.1:c.547-39T>G, XM_005257194.1:c.547-39T>GBenign08/07/2017 
62GAAEx3NM_000152.3:c.547-4C>GNM_000152.3:c.547-4C>G, NM_001079803.1:c.547-4C>G, NM_001079804.1:c.547-4C>G, XM_005257194.1:c.547-4C>GBenign07/02/2019 
63GAAEx3NM_000152.3:c.576G>Cp.Glu192Asp | p.E192DNM_000152.3:c.576G>C, NM_001079803.1:c.576G>C, NM_001079804.1:c.576G>C, XM_005257193.1:c.576G>C, XM_005257194.1:c.576G>CVOUS02/23/2016
64GAAEx3NM_000152.3:c.596A>Gp.His199Arg | p.H199RLRG_673t1:c.596A>G, NM_000152.3:c.596A>G, NM_001079803.1:c.596A>G, NM_001079804.1:c.596A>G, XM_005257193.1:c.596A>G, XM_005257194.1:c.596A>GBenign07/02/2019 
65GAAEx3NM_000152.3:c.598_616dupGTCCACAGCCGGGCACCGTp.Ser206Leufs*22 | p.S206LfsX22LRG_673t1:c.598_616dupgtccacagccgggcaccgt, NM_000152.3:c.598_616dupgtccacagccgggcaccgt, NM_001079803.1:c.598_616dupgtccacagccgggcaccgt, NM_001079804.1:c.598_616dupgtccacagccgggcaccgt, XM_005257193.1:c.598_616dupgtccacagccgggcaccgt, XM_005257194.1:c.598_616dupgtccacagccgggcaccgtPathogenic11/01/2019 
66GAAEx3NM_000152.3:c.600C>Tp.Val200= | p.V200=NM_000152.3:c.600C>T, NM_001079803.1:c.600C>T, NM_001079804.1:c.600C>T, XM_005257193.1:c.600C>T, XM_005257194.1:c.600C>TVOUS11/04/2015
67GAAEx3NM_000152.3:c.614C>Tp.Pro205Leu | p.P205LLRG_673t1:c.614C>T, NM_000152.3:c.614C>T, NM_001079803.1:c.614C>T, NM_001079804.1:c.614C>T, XM_005257193.1:c.614C>T, XM_005257194.1:c.614C>TVOUS03/29/2016
68GAAEx3NM_000152.3:c.615G>Ap.Pro205= | p.P205=LRG_673t1:c.615G>A, NM_000152.3:c.615G>A, NM_001079803.1:c.615G>A, NM_001079804.1:c.615G>A, XM_005257193.1:c.615G>A, XM_005257194.1:c.615G>AVOUS04/15/2015
69GAAEx3NM_000152.3:c.642C>Tp.Ser214= | p.S214=LRG_673t1:c.642C>T, NM_000152.3:c.642C>T, NM_001079803.1:c.642C>T, NM_001079804.1:c.642C>T, XM_005257193.1:c.642C>T, XM_005257194.1:c.642C>TBenign06/28/2019 
70GAAEx3NM_000152.3:c.655G>Ap.Gly219Arg | p.G219RLRG_673t1:c.655G>A, NM_000152.3:c.655G>A, NM_001079803.1:c.655G>A, NM_001079804.1:c.655G>A, XM_005257193.1:c.655G>A, XM_005257194.1:c.655G>APathogenic11/19/2019 
71GAAEx3NM_000152.3:c.658G>Tp.Val220Leu | p.V220LLRG_673t1:c.658G>T, NM_000152.3:c.658G>T, NM_001079803.1:c.658G>T, NM_001079804.1:c.658G>T, XM_005257193.1:c.658G>T, XM_005257194.1:c.658G>TVOUS10/30/2018
72GAAEx3NM_000152.3:c.663C>Tp.Ile221= | p.I221=LRG_673t1:c.663C>T, NM_000152.3:c.663C>T, NM_001079803.1:c.663C>T, NM_001079804.1:c.663C>T, XM_005257193.1:c.663C>T, XM_005257194.1:c.663C>TVOUS04/27/2017
73GAAEx3NM_000152.3:c.664G>Ap.Val222Met | p.V222MLRG_673t1:c.664G>A, NM_000152.3:c.664G>A, NM_001079803.1:c.664G>A, NM_001079804.1:c.664G>A, XM_005257193.1:c.664G>A, XM_005257194.1:c.664G>ABenign08/23/2016 
74GAAEx3NM_000152.3:c.667C>Tp.Arg223Cys | p.R223CLRG_673t1:c.667C>T, NM_000152.3:c.667C>T, NM_001079803.1:c.667C>T, NM_001079804.1:c.667C>T, XM_005257193.1:c.667C>T, XM_005257194.1:c.667C>TVOUS06/08/2016
75GAAEx3NM_000152.3:c.668G>Ap.Arg223His | p.R223HLRG_673t1:c.668G>A, NM_000152.3:c.668G>A, NM_001079803.1:c.668G>A, NM_001079804.1:c.668G>A, XM_005257193.1:c.668G>A, XM_005257194.1:c.668G>ABenign07/02/2019 
76GAAEx3NM_000152.3:c.670C>Tp.Arg224Trp | p.R224WNM_000152.3:c.670C>T, NM_001079803.1:c.670C>T, NM_001079804.1:c.670C>T, XM_005257193.1:c.670C>T, XM_005257194.1:c.670C>TVOUS11/07/2016
77GAAEx3NM_000152.3:c.676C>Gp.Leu226Val | p.L226VLRG_673t1:c.676C>G, NM_000152.3:c.676C>G, NM_001079803.1:c.676C>G, NM_001079804.1:c.676C>G, XM_005257193.1:c.676C>G, XM_005257194.1:c.676C>GLikely benign09/10/2015 
78GAAEx3NM_000152.3:c.685C>Tp.Arg229Cys | p.R229CNM_000152.3:c.685C>T, NM_001079803.1:c.685C>T, NM_001079804.1:c.685C>T, XM_005257193.1:c.685C>T, XM_005257194.1:c.685C>TVOUS04/06/2017
79GAAEx3NM_000152.3:c.688G>Ap.Val230Met | p.V230MNM_000152.3:c.688G>A, NM_001079803.1:c.688G>A, NM_001079804.1:c.688G>A, XM_005257193.1:c.688G>A, XM_005257194.1:c.688G>AVOUS08/02/2018
80GAAEx3NM_000152.3:c.692+9T>CLRG_673t1:c.692+9T>C, NM_000152.3:c.692+9T>C, NM_001079803.1:c.692+9T>C, NM_001079804.1:c.692+9T>C, XM_005257193.1:c.692+9T>C, XM_005257194.1:c.692+9T>CVOUS06/02/2016
81GAAEx4NM_000152.3:c.693-49C>TLRG_673t1:c.693-49C>T, NM_000152.3:c.693-49C>T, NM_001079803.1:c.693-49C>T, NM_001079804.1:c.693-49C>T, XM_005257193.1:c.693-49C>T, XM_005257194.1:c.693-49C>TBenign** 
82GAAEx4NM_000152.3:c.693-48T>CBenign** 
83GAAEx4NM_000152.3:c.693-5delCLRG_673t1:c.693-5delC, NM_000152.3:c.693-5delC, NM_001079803.1:c.693-5delC, NM_001079804.1:c.693-5delC, XM_005257193.1:c.693-5delC, XM_005257194.1:c.693-5delCVOUS**
84GAAEx4NM_000152.3:c.693-4G>TNM_000152.3:c.693-4G>T, NM_001079803.1:c.693-4G>T, NM_001079804.1:c.693-4G>T, XM_005257193.1:c.693-4G>T, XM_005257194.1:c.693-4G>TVOUS07/18/2018
85GAAEx4NM_000152.3:c.693-1G>CPathogenic10/16/2019 
86GAAEx4NM_000152.3:c.702G>Ap.Thr234= | p.T234=LRG_673t1:c.702G>A, NM_000152.3:c.702G>A, NM_001079803.1:c.702G>A, NM_001079804.1:c.702G>A, XM_005257193.1:c.702G>A, XM_005257194.1:c.702G>AVOUS06/07/2016
87GAAEx4NM_000152.3:c.705G>Ap.Thr235= | p.T235=NM_000152.3:c.705G>A, NM_001079803.1:c.705G>A, NM_001079804.1:c.705G>A, XM_005257193.1:c.705G>A, XM_005257194.1:c.705G>AVOUS08/20/2015
88GAAEx4NM_000152.3:c.711G>Ap.Ala237= | p.A237=LRG_673t1:c.711G>A, NM_000152.3:c.711G>A, NM_001079803.1:c.711G>A, NM_001079804.1:c.711G>A, XM_005257193.1:c.711G>A, XM_005257194.1:c.711G>AVOUS04/25/2017
89GAAEx4NM_000152.3:c.722_723delTTp.Phe241Cysfs*88 | p.F241CfsX88LRG_673t1:c.722_723delTT, NM_000152.3:c.722_723delTT, NM_001079803.1:c.722_723delTT, NM_001079804.1:c.722_723delTT, XM_005257193.1:c.722_723delTT, XM_005257194.1:c.722_723delTTPathogenic10/01/2018 
90GAAEx4NM_000152.3:c.725C>Tp.Ala242Val | p.A242VLRG_673t1:c.725C>T, NM_000152.3:c.725C>T, NM_001079803.1:c.725C>T, NM_001079804.1:c.725C>T, XM_005257193.1:c.725C>T, XM_005257194.1:c.725C>TVOUS04/18/2018
91GAAEx4NM_000152.3:c.726G>Ap.Ala242= | p.A242=NM_000152.3:c.726G>A, NM_001079803.1:c.726G>A, NM_001079804.1:c.726G>A, XM_005257193.1:c.726G>A, XM_005257194.1:c.726G>AVOUS01/18/2018
92GAAEx4NM_000152.3:c.736delCLRG_673t1:c.736delC, NM_000152.3:c.736delC, NM_001079803.1:c.736delC, NM_001079804.1:c.736delC, XM_005257193.1:c.736delC, XM_005257194.1:c.736delCPathogenic06/06/2016 
93GAAEx4NM_000152.3:c.749C>Tp.Thr250Ile | p.T250ILRG_673t1:c.749C>T, NM_000152.3:c.749C>T, NM_001079803.1:c.749C>T, NM_001079804.1:c.749C>T, XM_005257193.1:c.749C>T, XM_005257194.1:c.749C>TVOUS09/26/2019
94GAAEx4NM_000152.3:c.766_785delTATATCACAGGCCTCGCCGAinsCp.Tyr256Argfs*6 | p.Y256RfsX6LRG_673t1:c.766_785delinsC, NM_000152.3:c.766_785delinsC, NM_001079803.1:c.766_785delinsC, NM_001079804.1:c.766_785delinsC, XM_005257193.1:c.766_785delinsC, XM_005257194.1:c.766_785delinsCPathogenic09/03/2019 
95GAAEx4NM_000152.3:c.768_769insTNM_000152.3:c.768_769insT, NM_001079803.1:c.768_769insT, NM_001079804.1:c.768_769insT, XM_005257193.1:c.768_769insT, XM_005257194.1:c.768_769insTPathogenic** 
96GAAEx4NM_000152.3:c.784G>Ap.Glu262Lys | p.E262KLRG_673t1:c.784G>A, NM_000152.3:c.784G>A, NM_001079803.1:c.784G>A, NM_001079804.1:c.784G>A, XM_005257193.1:c.784G>A, XM_005257194.1:c.784G>APathogenic06/19/2019 
97GAAEx4NM_000152.3:c.794G>Ap.Ser265Asn | p.S265NLRG_673t1:c.794G>A, NM_000152.3:c.794G>A, NM_001079803.1:c.794G>A, NM_001079804.1:c.794G>A, XM_005257193.1:c.794G>A, XM_005257194.1:c.794G>AVOUS11/03/2016
98GAAEx4NM_000152.3:c.834G>Ap.Leu278= | p.L278=LRG_673t1:c.834G>A, NM_000152.3:c.834G>A, NM_001079803.1:c.834G>A, NM_001079804.1:c.834G>A, XM_005257193.1:c.834G>A, XM_005257194.1:c.834G>AVOUS11/17/2017
99GAAEx4NM_000152.3:c.841C>Tp.Arg281Trp | p.R281WNM_000152.3:c.841C>T, NM_001079803.1:c.841C>T, NM_001079804.1:c.841C>T, XM_005257193.1:c.841C>T, XM_005257194.1:c.841C>TVOUS12/20/2018
100GAAEx4NM_000152.3:c.851C>Gp.Ala284Gly | p.A284GLRG_673t1:c.851C>G, NM_000152.3:c.851C>G, NM_001079803.1:c.851C>G, NM_001079804.1:c.851C>G, XM_005257193.1:c.851C>G, XM_005257194.1:c.851C>GVOUS02/26/2018
101GAAEx4NM_000152.3:c.852G>Ap.Ala284= | p.A284=LRG_673t1:c.852G>A, NM_000152.3:c.852G>A, NM_001079803.1:c.852G>A, NM_001079804.1:c.852G>A, XM_005257193.1:c.852G>A, XM_005257194.1:c.852G>ABenign03/20/2019 
102GAAEx4NM_000152.3:c.853C>Tp.Pro285Ser | p.P285SLRG_673t1:c.853C>T, NM_000152.3:c.853C>T, NM_001079803.1:c.853C>T, NM_001079804.1:c.853C>T, XM_005257193.1:c.853C>T, XM_005257194.1:c.853C>TPathogenic06/13/2018 
103GAAEx4NM_000152.3:c.858+4C>GNM_000152.3:c.858+4C>G, NM_001079803.1:c.858+4C>G, NM_001079804.1:c.858+4C>G, XM_005257193.1:c.858+4C>G, XM_005257194.1:c.858+4C>GVOUS10/09/2015
104GAAEx4NM_000152.3:c.858+5_858+6insGCAGCGGNM_000152.3:c.858+5_858+6insGCAGCGG, NM_001079803.1:c.858+5_858+6insGCAGCGG, NM_001079804.1:c.858+5_858+6insGCAGCGG, XM_005257193.1:c.858+5_858+6insGCAGCGG, XM_005257194.1:c.858+5_858+6insGCAGCGGBenign** 
105GAAEx4NM_000152.3:c.858+6_858+7insCAGCGGGNM_000152.3:c.858+6_858+7insCAGCGGG, NM_001079803.1:c.858+6_858+7insCAGCGGG, NM_001079804.1:c.858+6_858+7insCAGCGGG, XM_005257193.1:c.858+6_858+7insCAGCGGG, XM_005257194.1:c.858+6_858+7insCAGCGGGBenign** 
106GAAEx4NM_000152.3:c.858+7_858+8insAGCGGGCNM_000152.3:c.858+7_858+8insAGCGGGC, NM_001079803.1:c.858+7_858+8insAGCGGGC, NM_001079804.1:c.858+7_858+8insAGCGGGC, XM_005257194.1:c.858+7_858+8insAGCGGGCBenign10/11/2019 
107GAAEx4NM_000152.3:c.858+7_858+8insAGTGGGCLRG_673t1:c.858+7_858+8insAGTGGGC, NM_000152.3:c.858+7_858+8insAGTGGGC, NM_001079803.1:c.858+7_858+8insAGTGGGC, NM_001079804.1:c.858+7_858+8insAGTGGGC, XM_005257193.1:c.858+7_858+8insAGTGGGC, XM_005257194.1:c.858+7_858+8insAGTGGGCVOUS05/18/2016
108GAAEx4NM_000152.3:c.858+7_858+8insAGCAGGCLRG_673t1:c.858+7_858+8insAGCAGGC, NM_000152.3:c.858+7_858+8insAGCAGGC, NM_001079803.1:c.858+7_858+8insAGCAGGC, NM_001079804.1:c.858+7_858+8insAGCAGGC, XM_005257193.1:c.858+7_858+8insAGCAGGC, XM_005257194.1:c.858+7_858+8insAGCAGGCBenign09/04/2018 
109GAAEx4NM_000152.3:c.858+8C>GBenign** 
110GAAEx4NM_000152.3:c.858+8G>ANM_000152.3:c.858+8G>A, NM_001079803.1:c.858+8G>A, NM_001079804.1:c.858+8G>A, XM_005257194.1:c.858+8G>ABenign12/06/2013 
111GAAEx4NM_000152.3:c.858+10C>TLRG_673t1:c.858+10C>T, NM_000152.3:c.858+10C>T, NM_001079803.1:c.858+10C>T, NM_001079804.1:c.858+10C>T, XM_005257193.1:c.858+10C>T, XM_005257194.1:c.858+10C>TVOUS10/28/2016
112GAAEx4NM_000152.3:c.858+17_858+23delCGGGCGGLRG_673t1:c.858+17_858+23delCGGGCGG, NM_000152.3:c.858+17_858+23delCGGGCGG, NM_001079803.1:c.858+17_858+23delCGGGCGG, NM_001079804.1:c.858+17_858+23delCGGGCGG, XM_005257193.1:c.858+17_858+23delCGGGCGG, XM_005257194.1:c.858+17_858+23delCGGGCGGBenign01/10/2019 
113GAAEx4NM_000152.3:c.858+17_858+23dupCGGGCGGLRG_673t1:c.858+17_858+23dupCGGGCGG, NM_000152.3:c.858+17_858+23dup, NM_000152.3:c.858+17_858+23dupCGGGCGG, NM_001079803.1:c.858+17_858+23dup, NM_001079803.1:c.858+17_858+23dupCGGGCGG, NM_001079804.1:c.858+17_858+23dup, NM_001079804.1:c.858+17_858+23dupCGGGCGG, XM_005257193.1:c.858+17_858+23dupCGGGCGG, XM_005257194.1:c.858+17_858+23dupCGGGCGGBenign12/06/2013 
114GAAEx4NM_000152.3:c.858+24_858+25insCGGGCGGLRG_673t1:c.858+24_858+25insCGGGCGG, NM_000152.3:c.858+24_858+25insCGGGCGG, NM_001079803.1:c.858+24_858+25insCGGGCGG, NM_001079804.1:c.858+24_858+25insCGGGCGG, XM_005257194.1:c.858+24_858+25insCGGGCGGBenign** 
115GAAEx4NM_000152.3:c.858+30T>CNM_000152.3:c.858+30T>C, NM_001079803.1:c.858+30T>C, NM_001079804.1:c.858+30T>CBenign12/06/2013 
116GAAEx5NM_000152.3:c.861C>Tp.Pro287= | p.P287=NM_000152.3:c.861C>T, NM_001079803.1:c.861C>T, NM_001079804.1:c.861C>T, XM_005257193.1:c.861C>T, XM_005257194.1:c.861C>TVOUS12/08/2015
117GAAEx5NM_000152.3:c.866C>Tp.Ala289Val | p.A289VNM_000152.3:c.866C>T, NM_001079803.1:c.866C>T, NM_001079804.1:c.866C>T, XM_005257193.1:c.866C>T, XM_005257194.1:c.866C>TVOUS01/11/2018
118GAAEx5NM_000152.3:c.868A>Gp.Asn290Asp | p.N290DLRG_673t1:c.868A>G, NM_000152.3:c.868A>G, NM_001079803.1:c.868A>G, NM_001079804.1:c.868A>G, XM_005257193.1:c.868A>G, XM_005257194.1:c.868A>GVOUS01/30/2018
119GAAEx5NM_000152.3:c.875A>Gp.Tyr292Cys | p.Y292CLRG_673t1:c.875A>G, NM_000152.3:c.875A>G, NM_001079803.1:c.875A>G, NM_001079804.1:c.875A>G, XM_005257193.1:c.875A>G, XM_005257194.1:c.875A>GPathogenic11/22/2017 
120GAAEx5NM_000152.3:c.877G>Ap.Gly293Arg | p.G293RLRG_673t1:c.877G>A, NM_000152.3:c.877G>A, NM_001079803.1:c.877G>A, NM_001079804.1:c.877G>A, XM_005257193.1:c.877G>A, XM_005257194.1:c.877G>APathogenic07/24/2019 
121GAAEx5NM_000152.3:c.883C>Ap.His295Asn | p.H295NLRG_673t1:c.883C>A, NM_000152.3:c.883C>A, NM_001079803.1:c.883C>A, NM_001079804.1:c.883C>A, XM_005257193.1:c.883C>A, XM_005257194.1:c.883C>AVOUS10/02/2018
122GAAEx5NM_000152.3:c.900G>Ap.Ala300= | p.A300=LRG_673t1:c.900G>A, NM_000152.3:c.900G>A, NM_001079803.1:c.900G>A, NM_001079804.1:c.900G>A, XM_005257193.1:c.900G>A, XM_005257194.1:c.900G>AVOUS11/16/2017
123GAAEx5NM_000152.3:c.906G>Ap.Glu302= | p.E302=LRG_673t1:c.906G>A, NM_000152.3:c.906G>A, NM_001079803.1:c.906G>A, NM_001079804.1:c.906G>A, XM_005257193.1:c.906G>A, XM_005257194.1:c.906G>AVOUS01/25/2017
124GAAEx5NM_000152.3:c.910G>Ap.Gly304Ser | p.G304SNM_000152.3:c.910G>A, NM_001079803.1:c.910G>A, NM_001079804.1:c.910G>A, XM_005257193.1:c.910G>A, XM_005257194.1:c.910G>AVOUS01/26/2016
125GAAEx5NM_000152.3:c.913G>Ap.Gly305Arg | p.G305RLRG_673t1:c.913G>A, NM_000152.3:c.913G>A, NM_001079803.1:c.913G>A, NM_001079804.1:c.913G>A, XM_005257193.1:c.913G>A, XM_005257194.1:c.913G>AVOUS12/19/2016
126GAAEx5NM_000152.3:c.915G>Ap.Gly305= | p.G305=LRG_673t1:c.915G>A, NM_000152.3:c.915G>A, NM_001079803.1:c.915G>A, NM_001079804.1:c.915G>A, XM_005257193.1:c.915G>A, XM_005257194.1:c.915G>AVOUS08/10/2018
127GAAEx5NM_000152.3:c.917C>Tp.Ser306Leu | p.S306LNM_000152.3:c.917C>T, NM_001079803.1:c.917C>T, NM_001079804.1:c.917C>T, XM_005257193.1:c.917C>T, XM_005257194.1:c.917C>TBenign05/28/2014 
128GAAEx5NM_000152.3:c.921A>Tp.Ala307= | p.A307=LRG_673t1:c.921A>T, NM_000152.3:c.921A>T, NM_001079803.1:c.921A>T, NM_001079804.1:c.921A>T, XM_005257193.1:c.921A>T, XM_005257194.1:c.921A>TBenign05/16/2019 
129GAAEx5NM_000152.3:c.924C>Ap.His308Gln | p.H308QLRG_673t1:c.924C>A, NM_000152.3:c.924C>A, NM_001079803.1:c.924C>A, NM_001079804.1:c.924C>A, XM_005257193.1:c.924C>A, XM_005257194.1:c.924C>AVOUS10/27/2017
130GAAEx5NM_000152.3:c.925G>Ap.Gly309Arg | p.G309RLRG_673t1:c.925G>A, NM_000152.3:c.925G>A, NM_001079803.1:c.925G>A, NM_001079804.1:c.925G>A, XM_005257193.1:c.925G>A, XM_005257194.1:c.925G>APathogenic04/29/2019 
131GAAEx5NM_000152.3:c.927G>Ap.Gly309= | p.G309=LRG_673t1:c.927G>A, NM_000152.3:c.927G>A, NM_001079803.1:c.927G>A, NM_001079804.1:c.927G>A, XM_005257193.1:c.927G>A, XM_005257194.1:c.927G>AVOUS06/02/2016
132GAAEx5NM_000152.3:c.934delCNM_000152.3:c.934delC, NM_001079803.1:c.934delC, NM_001079804.1:c.934delC, XM_005257193.1:c.934delC, XM_005257194.1:c.934delCPathogenic08/07/2015 
133GAAEx5NM_000152.3:c.952A>Tp.Met318Leu | p.M318LLRG_673t1:c.952A>T, NM_000152.3:c.952A>T, NM_001079803.1:c.952A>T, NM_001079804.1:c.952A>T, XM_005257193.1:c.952A>T, XM_005257194.1:c.952A>TVOUS08/29/2016
134GAAEx5NM_000152.3:c.953T>Cp.Met318Thr | p.M318TLRG_673t1:c.953T>C, NM_000152.3:c.953T>C, NM_001079803.1:c.953T>C, NM_001079804.1:c.953T>C, XM_005257193.1:c.953T>C, XM_005257194.1:c.953T>CPathogenic08/27/2019 
135GAAEx5NM_000152.3:c.955+12G>ANM_000152.3:c.955+12G>A, NM_001079803.1:c.955+12G>A, NM_001079804.1:c.955+12G>A, XM_005257194.1:c.955+12G>ABenign07/02/2019 
136GAAEx6NM_000152.3:c.985delAp.Ser329Alafs*63 | p.S329AfsX63LRG_673t1:c.985delA, NM_000152.3:c.985delA, NM_001079803.1:c.985delA, NM_001079804.1:c.985delA, XM_005257193.1:c.985delA, XM_005257194.1:c.985delAPathogenic05/17/2019 
137GAAEx6NM_000152.3:c.993G>Ap.Arg331= | p.R331=LRG_673t1:c.993G>A, NM_000152.3:c.993G>A, NM_001079803.1:c.993G>A, NM_001079804.1:c.993G>A, XM_005257193.1:c.993G>A, XM_005257194.1:c.993G>AVOUS08/12/2016
138GAAEx6NM_000152.3:c.1000G>Tp.Gly334Cys | p.G334CNM_000152.3:c.1000G>T, NM_001079803.1:c.1000G>T, NM_001079804.1:c.1000G>T, XM_005257193.1:c.1000G>T, XM_005257194.1:c.1000G>TVOUS11/25/2015
139GAAEx6NM_000152.3:c.1019A>Gp.Tyr340Cys | p.Y340CLRG_673t1:c.1019A>G, NM_000152.3:c.1019A>G, NM_001079803.1:c.1019A>G, NM_001079804.1:c.1019A>G, XM_005257193.1:c.1019A>G, XM_005257194.1:c.1019A>GVOUS01/30/2019
140GAAEx6NM_000152.3:c.1030_1031delGGp.Gly344Profs*161 | p.G344PfsX161LRG_673t1:c.1030_1031delGG, NM_000152.3:c.1030_1031delGG, NM_001079803.1:c.1030_1031delGG, NM_001079804.1:c.1030_1031delGG, XM_005257193.1:c.1030_1031delGG, XM_005257194.1:c.1030_1031delGGPathogenic05/14/2018 
141GAAEx6NM_000152.3:c.1047C>Tp.Ser349= | p.S349=LRG_673t1:c.1047C>T, NM_000152.3:c.1047C>T, NM_001079803.1:c.1047C>T, NM_001079804.1:c.1047C>T, XM_005257193.1:c.1047C>T, XM_005257194.1:c.1047C>TVOUS07/10/2018
142GAAEx6NM_000152.3:c.1051delGNM_000152.3:c.1051delG, NM_001079803.1:c.1051delG, NM_001079804.1:c.1051delG, XM_005257193.1:c.1051delG, XM_005257194.1:c.1051delGPathogenic02/16/2016 
143GAAEx6NM_000152.3:c.1053G>Tp.Val351= | p.V351=LRG_673t1:c.1053G>T, NM_000152.3:c.1053G>T, NM_001079803.1:c.1053G>T, NM_001079804.1:c.1053G>T, XM_005257193.1:c.1053G>T, XM_005257194.1:c.1053G>TVOUS03/07/2016
144GAAEx6NM_000152.3:c.1064T>Cp.Leu355Pro | p.L355PNM_000152.3:c.1064T>C, NM_001079803.1:c.1064T>C, NM_001079804.1:c.1064T>C, XM_005257193.1:c.1064T>C, XM_005257194.1:c.1064T>CPathogenic10/29/2015 
145GAAEx6NM_000152.3:c.1075G>Ap.Gly359Arg | p.G359RLRG_673t1:c.1075G>A, NM_000152.3:c.1075G>A, NM_001079803.1:c.1075G>A, NM_001079804.1:c.1075G>A, XM_005257193.1:c.1075G>A, XM_005257194.1:c.1075G>ALikely pathogenic07/22/2019 
146GAAEx6NM_000152.3:c.1075+4G>ANM_000152.3:c.1075+4G>A, NM_001079803.1:c.1075+4G>A, NM_001079804.1:c.1075+4G>A, XM_005257193.1:c.1075+4G>A, XM_005257194.1:c.1075+4G>AVOUS05/31/2016
147GAAEx6NM_000152.3:c.1075+9T>CLRG_673t1:c.1075+9T>C, NM_000152.3:c.1075+9T>C, NM_001079803.1:c.1075+9T>C, NM_001079804.1:c.1075+9T>C, XM_005257193.1:c.1075+9T>C, XM_005257194.1:c.1075+9T>CVOUS09/15/2016
148GAAEx6NM_000152.3:c.1075+13C>TLRG_673t1:c.1075+13C>T, NM_000152.3:c.1075+13C>T, NM_001079803.1:c.1075+13C>T, NM_001079804.1:c.1075+13C>T, XM_005257194.1:c.1075+13C>TBenign12/18/2018 
149GAAEx6NM_000152.3:c.1075+21G>AVOUS**
150GAAEx7NM_000152.3:c.1082C>Gp.Pro361Arg | p.P361RLRG_673t1:c.1082C>G, NM_000152.3:c.1082C>G, NM_001079803.1:c.1082C>G, NM_001079804.1:c.1082C>G, XM_005257193.1:c.1082C>G, XM_005257194.1:c.1082C>GVOUS07/12/2016
151GAAEx7NM_000152.3:c.1083G>Ap.Pro361= | p.P361=LRG_673t1:c.1083G>A, NM_000152.3:c.1083G>A, NM_001079803.1:c.1083G>A, NM_001079804.1:c.1083G>A, XM_005257193.1:c.1083G>A, XM_005257194.1:c.1083G>AVOUS03/23/2017
152GAAEx7NM_000152.3:c.1109G>Ap.Gly370Asp | p.G370DLRG_673t1:c.1109G>A, NM_000152.3:c.1109G>A, NM_001079803.1:c.1109G>A, NM_001079804.1:c.1109G>A, XM_005257193.1:c.1109G>A, XM_005257194.1:c.1109G>AVOUS08/06/2019
153GAAEx7NM_000152.3:c.1114dupCp.His372Profs*134 | p.H372PfsX134LRG_673t1:c.1114dupC, NM_000152.3:c.1114dupC, NM_001079803.1:c.1114dupC, NM_001079804.1:c.1114dupC, XM_005257193.1:c.1114dupC, XM_005257194.1:c.1114dupCPathogenic11/26/2019 
154GAAEx7NM_000152.3:c.1123C>Tp.Arg375Cys | p.R375CLRG_673t1:c.1123C>T, NM_000152.3:c.1123C>T, NM_001079803.1:c.1123C>T, NM_001079804.1:c.1123C>T, XM_005257193.1:c.1123C>T, XM_005257194.1:c.1123C>TVOUS05/05/2017
155GAAEx7NM_000152.3:c.1124G>Tp.Arg375Leu | p.R375LNM_000152.3:c.1124G>T, NM_001079803.1:c.1124G>T, NM_001079804.1:c.1124G>T, XM_005257193.1:c.1124G>T, XM_005257194.1:c.1124G>TPathogenic03/20/2019 
156GAAEx7NM_000152.3:c.1128_1129delGGinsCp.Trp376Cysfs*16 | p.W376CfsX16LRG_673t1:c.1128_1129delinsC, NM_000152.3:c.1128_1129delinsC, NM_001079803.1:c.1128_1129delinsC, NM_001079804.1:c.1128_1129delinsC, XM_005257193.1:c.1128_1129delinsC, XM_005257194.1:c.1128_1129delinsCPathogenic04/03/2017 
157GAAEx7NM_000152.3:c.1129G>Cp.Gly377Arg | p.G377RLRG_673t1:c.1129G>C, NM_000152.3:c.1129G>C, NM_001079803.1:c.1129G>C, NM_001079804.1:c.1129G>C, XM_005257193.1:c.1129G>C, XM_005257194.1:c.1129G>CPathogenic04/03/2017 
158GAAEx7NM_000152.3:c.1130delGp.Gly377Alafs*15 | p.G377AfsX15LRG_673t1:c.1130delG, NM_000152.3:c.1130delG, NM_001079803.1:c.1130delG, NM_001079804.1:c.1130delG, XM_005257193.1:c.1130delG, XM_005257194.1:c.1130delGPathogenic04/03/2017 
159GAAEx7NM_000152.3:c.1134C>Gp.Tyr378* | p.Y378XLRG_673t1:c.1134C>G, NM_000152.3:c.1134C>G, NM_001079803.1:c.1134C>G, NM_001079804.1:c.1134C>G, XM_005257193.1:c.1134C>G, XM_005257194.1:c.1134C>GPathogenic01/19/2018 
160GAAEx7NM_000152.3:c.1143delCp.Ala382Leufs*10 | p.A382LfsX10LRG_673t1:c.1143delC, NM_000152.3:c.1143delC, NM_001079803.1:c.1143delC, NM_001079804.1:c.1143delC, XM_005257193.1:c.1143delC, XM_005257194.1:c.1143delCPathogenic02/02/2017 
161GAAEx7NM_000152.3:c.1143C>Tp.Thr381= | p.T381=NM_000152.3:c.1143C>T, NM_001079803.1:c.1143C>T, NM_001079804.1:c.1143C>T, XM_005257193.1:c.1143C>T, XM_005257194.1:c.1143C>TVOUS05/05/2017
162GAAEx7NM_000152.3:c.1147A>Gp.Ile383Val | p.I383VNM_000152.3:c.1147A>G, NM_001079803.1:c.1147A>G, NM_001079804.1:c.1147A>G, XM_005257193.1:c.1147A>G, XM_005257194.1:c.1147A>GVOUS05/19/2015
163GAAEx7NM_000152.3:c.1153delCp.Arg385Alafs*7 | p.R385AfsX7LRG_673t1:c.1153delC, NM_000152.3:c.1153delC, NM_001079803.1:c.1153delC, NM_001079804.1:c.1153delC, XM_005257193.1:c.1153delC, XM_005257194.1:c.1153delCPathogenic04/17/2017 
164GAAEx7NM_000152.3:c.1188C>Gp.Phe396Leu | p.F396LLRG_673t1:c.1188C>G, NM_000152.3:c.1188C>G, NM_001079803.1:c.1188C>G, NM_001079804.1:c.1188C>G, XM_005257193.1:c.1188C>G, XM_005257194.1:c.1188C>GVOUS08/09/2016
165GAAEx7NM_000152.3:c.1192C>Tp.Leu398= | p.L398=LRG_673t1:c.1192C>T, NM_000152.3:c.1192C>T, NM_001079803.1:c.1192C>T, NM_001079804.1:c.1192C>T, XM_005257193.1:c.1192C>T, XM_005257194.1:c.1192C>TVOUS03/23/2016
166GAAEx7NM_000152.3:c.1192dupCp.Leu398Profs*108 | p.L398PfsX108LRG_673t1:c.1192dupC, NM_000152.3:c.1192dupC, NM_001079803.1:c.1192dupC, NM_001079804.1:c.1192dupC, XM_005257193.1:c.1192dupC, XM_005257194.1:c.1192dupCPathogenic05/10/2019 
167GAAEx7NM_000152.3:c.1194+3G>CNM_000152.3:c.1194+3G>C, NM_001079803.1:c.1194+3G>C, NM_001079804.1:c.1194+3G>C, XM_005257193.1:c.1194+3G>C, XM_005257194.1:c.1194+3G>CVOUS05/22/2015
168GAAEx8NM_000152.3:c.1195-18A>GBenign** 
169GAAEx8NM_000152.3:c.1195-4G>TNM_000152.3:c.1195-4G>T, NM_001079803.1:c.1195-4G>T, NM_001079804.1:c.1195-4G>T, XM_005257193.1:c.1195-4G>T, XM_005257194.1:c.1195-4G>TVOUS10/22/2015
170GAAEx8NM_000152.3:c.1203G>Ap.Gln401= | p.Q401=LRG_673t1:c.1203G>A, NM_000152.3:c.1203G>A, NM_001079803.1:c.1203G>A, NM_001079804.1:c.1203G>A, XM_005257193.1:c.1203G>A, XM_005257194.1:c.1203G>ABenign07/02/2019 
171GAAEx8NM_000152.3:c.1211A>Tp.Asp404Val | p.D404VNM_000152.3:c.1211A>T, NM_001079803.1:c.1211A>T, NM_001079804.1:c.1211A>T, XM_005257193.1:c.1211A>T, XM_005257194.1:c.1211A>TVOUS11/25/2015
172GAAEx8NM_000152.3:c.1219T>Cp.Tyr407His | p.Y407HNM_000152.3:c.1219T>C, NM_001079803.1:c.1219T>C, NM_001079804.1:c.1219T>CVOUS08/07/2015
173GAAEx8NM_000152.3:c.1240T>Cp.Phe414Leu | p.F414LNM_000152.3:c.1240T>C, NM_001079803.1:c.1240T>C, NM_001079804.1:c.1240T>C, XM_005257193.1:c.1240T>C, XM_005257194.1:c.1240T>CVOUS09/22/2015
174GAAEx8NM_000152.3:c.1257_1289delTGGCTTCCGGGACTTCCCGGCCATGGTGCAGGAp.Asp419_Gln429del | p.D419_Q429delLRG_673t1:c.1257_1289delTGGCTTCCGGGACTTCCCGGCCATGGTGCAGGA, NM_000152.3:c.1257_1289delTGGCTTCCGGGACTTCCCGGCCATGGTGCAGGA, NM_001079803.1:c.1257_1289delTGGCTTCCGGGACTTCCCGGCCATGGTGCAGGA, NM_001079804.1:c.1257_1289delTGGCTTCCGGGACTTCCCGGCCATGGTGCAGGA, XM_005257193.1:c.1257_1289delTGGCTTCCGGGACTTCCCGGCCATGGTGCAGGA, XM_005257194.1:c.1257_1289delTGGCTTCCGGGACTTCCCGGCCATGGTGCAGGAVOUS08/03/2018
175GAAEx8NM_000152.3:c.1265G>Ap.Arg422Gln | p.R422QNM_000152.3:c.1265G>A, NM_001079803.1:c.1265G>A, NM_001079804.1:c.1265G>A, XM_005257193.1:c.1265G>A, XM_005257194.1:c.1265G>AVOUS10/22/2015
176GAAEx8NM_000152.3:c.1273C>Tp.Pro425Ser | p.P425SLRG_673t1:c.1273C>T, NM_000152.3:c.1273C>T, NM_001079803.1:c.1273C>T, NM_001079804.1:c.1273C>T, XM_005257193.1:c.1273C>T, XM_005257194.1:c.1273C>TVOUS12/28/2016
177GAAEx8NM_000152.3:c.1285C>Gp.Gln429Glu | p.Q429ELRG_673t1:c.1285C>G, NM_000152.3:c.1285C>G, NM_001079803.1:c.1285C>G, NM_001079804.1:c.1285C>G, XM_005257193.1:c.1285C>G, XM_005257194.1:c.1285C>GBenign09/19/2016 
178GAAEx8NM_000152.3:c.1286A>Gp.Gln429Arg | p.Q429RNM_000152.3:c.1286A>G, NM_001079803.1:c.1286A>G, NM_001079804.1:c.1286A>G, XM_005257193.1:c.1286A>G, XM_005257194.1:c.1286A>GBenign11/12/2015 
179GAAEx8NM_000152.3:c.1288G>Ap.Glu430Lys | p.E430KLRG_673t1:c.1288G>A, NM_000152.3:c.1288G>A, NM_001079803.1:c.1288G>A, NM_001079804.1:c.1288G>A, XM_005257193.1:c.1288G>A, XM_005257194.1:c.1288G>AVOUS05/02/2017
180GAAEx8NM_000152.3:c.1293_1312delGCACCAGGGCGGCCGGCGCTp.Gln433Aspfs*66 | p.Q433DfsX66LRG_673t1:c.1293_1312delGCACCAGGGCGGCCGGCGCT, NM_000152.3:c.1293_1312delGCACCAGGGCGGCCGGCGCT, NM_001079803.1:c.1293_1312delGCACCAGGGCGGCCGGCGCT, NM_001079804.1:c.1293_1312delGCACCAGGGCGGCCGGCGCT, XM_005257193.1:c.1293_1312delGCACCAGGGCGGCCGGCGCT, XM_005257194.1:c.1293_1312delGCACCAGGGCGGCCGGCGCTPathogenic10/10/2019 
181GAAEx8NM_000152.3:c.1309C>Tp.Arg437Cys | p.R437CLRG_673t1:c.1309C>T, NM_000152.3:c.1309C>T, NM_001079803.1:c.1309C>T, NM_001079804.1:c.1309C>T, XM_005257193.1:c.1309C>T, XM_005257194.1:c.1309C>TPathogenic05/26/2020 
182GAAEx8NM_000152.3:c.1316T>Ap.Met439Lys | p.M439KLRG_673t1:c.1316T>A, NM_000152.3:c.1316T>A, NM_001079803.1:c.1316T>A, NM_001079804.1:c.1316T>A, XM_005257193.1:c.1316T>A, XM_005257194.1:c.1316T>APathogenic10/29/2019 
183GAAEx8NM_000152.3:c.1320G>Tp.Met440Ile | p.M440INM_000152.3:c.1320G>T, NM_001079803.1:c.1320G>T, NM_001079804.1:c.1320G>T, XM_005257193.1:c.1320G>T, XM_005257194.1:c.1320G>TVOUS07/06/2015
184GAAEx8NM_000152.3:c.1324G>Ap.Val442Met | p.V442MLRG_673t1:c.1324G>A, NM_000152.3:c.1324G>A, NM_001079803.1:c.1324G>A, NM_001079804.1:c.1324G>A, XM_005257193.1:c.1324G>A, XM_005257194.1:c.1324G>AVOUS10/06/2016
185GAAEx8NM_000152.3:c.1326+1G>ALRG_673t1:c.1326+1G>A, NM_000152.3:c.1326+1G>A, NM_001079803.1:c.1326+1G>A, NM_001079804.1:c.1326+1G>A, XM_005257193.1:c.1326+1G>A, XM_005257194.1:c.1326+1G>APathogenic07/20/2018 
186GAAEx9NM_000152.3:c.1327-18A>GNM_000152.3:c.1327-18A>G, NM_001079803.1:c.1327-18A>G, NM_001079804.1:c.1327-18A>G, XM_005257194.1:c.1327-18A>GBenign07/02/2019 
187GAAEx9NM_000152.3:c.1327-2A>GNM_000152.3:c.1327-2A>G, NM_001079803.1:c.1327-2A>G, NM_001079804.1:c.1327-2A>G, XM_005257193.1:c.1327-2A>G, XM_005257194.1:c.1327-2A>GPathogenic** 
188GAAEx9NM_000152.3:c.1332T>Cp.Pro444= | p.P444=NM_000152.3:c.1332T>C, NM_001079803.1:c.1332T>C, NM_001079804.1:c.1332T>C, XM_005257193.1:c.1332T>C, XM_005257194.1:c.1332T>CBenign02/02/2016 
189GAAEx9NM_000152.3:c.1343G>Cp.Ser448Thr | p.S448TNM_000152.3:c.1343G>C, NM_001079803.1:c.1343G>C, NM_001079804.1:c.1343G>C, XM_005257193.1:c.1343G>C, XM_005257194.1:c.1343G>CLikely benign10/07/2015 
190GAAEx9NM_000152.3:c.1347G>Ap.Ser449= | p.S449=LRG_673t1:c.1347G>A, NM_000152.3:c.1347G>A, NM_001079803.1:c.1347G>A, NM_001079804.1:c.1347G>A, XM_005257193.1:c.1347G>A, XM_005257194.1:c.1347G>AVOUS06/14/2016
191GAAEx9NM_000152.3:c.1352C>Gp.Pro451Arg | p.P451RNM_000152.3:c.1352C>G, NM_001079803.1:c.1352C>G, NM_001079804.1:c.1352C>G, XM_005257193.1:c.1352C>G, XM_005257194.1:c.1352C>GLikely benign01/13/2016 
192GAAEx9NM_000152.3:c.1356C>Tp.Ala452= | p.A452=NM_000152.3:c.1356C>T, NM_001079803.1:c.1356C>T, NM_001079804.1:c.1356C>T, XM_005257193.1:c.1356C>T, XM_005257194.1:c.1356C>TVOUS02/16/2016
193GAAEx9NM_000152.3:c.1374C>Tp.Tyr458= | p.Y458=LRG_673t1:c.1374C>T, NM_000152.3:c.1374C>T, NM_001079803.1:c.1374C>T, NM_001079804.1:c.1374C>T, XM_005257193.1:c.1374C>T, XM_005257194.1:c.1374C>TBenign07/02/2019 
194GAAEx9NM_000152.3:c.1375G>Cp.Asp459His | p.D459HLRG_673t1:c.1375G>C, NM_000152.3:c.1375G>C, NM_001079803.1:c.1375G>C, NM_001079804.1:c.1375G>C, XM_005257193.1:c.1375G>C, XM_005257194.1:c.1375G>CVOUS10/10/2016
195GAAEx9NM_000152.3:c.1375G>Ap.Asp459Asn | p.D459NLRG_673t1:c.1375G>A, NM_000152.3:c.1375G>A, NM_001079803.1:c.1375G>A, NM_001079804.1:c.1375G>A, XM_005257193.1:c.1375G>A, XM_005257194.1:c.1375G>ALikely pathogenic03/07/2019 
196GAAEx9NM_000152.3:c.1378G>Ap.Glu460Lys | p.E460KLRG_673t1:c.1378G>A, NM_000152.3:c.1378G>A, NM_001079803.1:c.1378G>A, NM_001079804.1:c.1378G>A, XM_005257193.1:c.1378G>A, XM_005257194.1:c.1378G>AVOUS05/04/2017
197GAAEx9NM_000152.3:c.1381G>Ap.Gly461Ser | p.G461SLRG_673t1:c.1381G>A, NM_000152.3:c.1381G>A, NM_001079803.1:c.1381G>A, NM_001079804.1:c.1381G>A, XM_005257193.1:c.1381G>A, XM_005257194.1:c.1381G>AVOUS04/29/2019
198GAAEx9NM_000152.3:c.1387C>Tp.Arg463Trp | p.R463WLRG_673t1:c.1387C>T, NM_000152.3:c.1387C>T, NM_001079803.1:c.1387C>T, NM_001079804.1:c.1387C>T, XM_005257193.1:c.1387C>T, XM_005257194.1:c.1387C>TVOUS07/18/2016
199GAAEx9NM_000152.3:c.1402A>Tp.Ile468Phe | p.I468FNM_000152.3:c.1402A>T, NM_001079803.1:c.1402A>T, NM_001079804.1:c.1402A>T, XM_005257193.1:c.1402A>T, XM_005257194.1:c.1402A>TVOUS01/08/2016
200GAAEx9NM_000152.3:c.1410C>Tp.Asn470= | p.N470=NM_000152.3:c.1410C>T, NM_001079803.1:c.1410C>T, NM_001079804.1:c.1410C>T, XM_005257193.1:c.1410C>T, XM_005257194.1:c.1410C>TVOUS12/17/2015
201GAAEx9NM_000152.3:c.1416C>Tp.Thr472= | p.T472=LRG_673t1:c.1416C>T, NM_000152.3:c.1416C>T, NM_001079803.1:c.1416C>T, NM_001079804.1:c.1416C>T, XM_005257193.1:c.1416C>T, XM_005257194.1:c.1416C>TVOUS05/04/2017
202GAAEx9NM_000152.3:c.1416C>Gp.Thr472= | p.T472=LRG_673t1:c.1416C>G, NM_000152.3:c.1416C>G, NM_001079803.1:c.1416C>G, NM_001079804.1:c.1416C>G, XM_005257193.1:c.1416C>G, XM_005257194.1:c.1416C>GVOUS11/03/2017
203GAAEx9NM_000152.3:c.1418G>Ap.Gly473Asp | p.G473DLRG_673t1:c.1418G>A, NM_000152.3:c.1418G>A, NM_001079803.1:c.1418G>A, NM_001079804.1:c.1418G>A, XM_005257193.1:c.1418G>A, XM_005257194.1:c.1418G>AVOUS07/27/2018
204GAAEx9NM_000152.3:c.1418G>Cp.Gly473Ala | p.G473ALRG_673t1:c.1418G>C, NM_000152.3:c.1418G>C, NM_001079803.1:c.1418G>C, NM_001079804.1:c.1418G>C, XM_005257193.1:c.1418G>C, XM_005257194.1:c.1418G>CVOUS06/14/2016
205GAAEx9NM_000152.3:c.1425G>Ap.Pro475= | p.P475=NM_000152.3:c.1425G>A, NM_001079803.1:c.1425G>A, NM_001079804.1:c.1425G>A, XM_005257193.1:c.1425G>A, XM_005257194.1:c.1425G>AVOUS07/15/2015
206GAAEx9NM_000152.3:c.1431delTPathogenic** 
207GAAEx9NM_000152.3:c.1434G>Ap.Gly478= | p.G478=NM_000152.3:c.1434G>A, NM_001079803.1:c.1434G>A, NM_001079804.1:c.1434G>A, XM_005257193.1:c.1434G>A, XM_005257194.1:c.1434G>AVOUS02/03/2016
208GAAEx9NM_000152.3:c.1437+8G>ALRG_673t1:c.1437+8G>A, NM_000152.3:c.1437+8G>A, NM_001079803.1:c.1437+8G>A, NM_001079804.1:c.1437+8G>A, XM_005257193.1:c.1437+8G>A, XM_005257194.1:c.1437+8G>AVOUS11/21/2018
209GAAEx10NM_000152.3:c.1438-19G>CNM_000152.3:c.1438-19G>C, NM_001079803.1:c.1438-19G>C, NM_001079804.1:c.1438-19G>C, XM_005257194.1:c.1438-19G>CBenign07/02/2019 
210GAAEx10NM_000152.3:c.1438-15_1438-1delCCTCTCGTTGTCCAGLRG_673t1:c.1438-15_1438-1delCCTCTCGTTGTCCAG, NM_000152.3:c.1438-15_1438-1delCCTCTCGTTGTCCAG, NM_001079803.1:c.1438-15_1438-1delCCTCTCGTTGTCCAG, NM_001079804.1:c.1438-15_1438-1delCCTCTCGTTGTCCAG, XM_005257193.1:c.1438-15_1438-1delCCTCTCGTTGTCCAG, XM_005257194.1:c.1438-15_1438-1delCCTCTCGTTGTCCAGVOUS08/21/2018
211GAAEx10NM_000152.3:c.1438-9G>ALRG_673t1:c.1438-9G>A, NM_000152.3:c.1438-9G>A, NM_001079803.1:c.1438-9G>A, NM_001079804.1:c.1438-9G>A, XM_005257193.1:c.1438-9G>A, XM_005257194.1:c.1438-9G>AVOUS05/02/2017
212GAAEx10NM_000152.3:c.1438-7_1438-5delTGTLRG_673t1:c.1438-7_1438-5delTGT, NM_000152.3:c.1438-7_1438-5delTGT, NM_001079803.1:c.1438-7_1438-5delTGT, NM_001079804.1:c.1438-7_1438-5delTGT, XM_005257193.1:c.1438-7_1438-5delTGT, XM_005257194.1:c.1438-7_1438-5delTGTVOUS09/22/2016
213GAAEx10NM_000152.3:c.1438-1G>CLRG_673t1:c.1438-1G>C, NM_000152.3:c.1438-1G>C, NM_001079803.1:c.1438-1G>C, NM_001079804.1:c.1438-1G>C, XM_005257193.1:c.1438-1G>C, XM_005257194.1:c.1438-1G>CPathogenic05/02/2017 
214GAAEx10NM_000152.3:c.1441T>Cp.Trp481Arg | p.W481RLRG_673t1:c.1441T>C, NM_000152.3:c.1441T>C, NM_001079803.1:c.1441T>C, NM_001079804.1:c.1441T>C, XM_005257193.1:c.1441T>C, XM_005257194.1:c.1441T>CPathogenic07/15/2019 
215GAAEx10NM_000152.3:c.1447G>Ap.Gly483Arg | p.G483RLRG_673t1:c.1447G>A, NM_000152.3:c.1447G>A, NM_001079803.1:c.1447G>A, NM_001079804.1:c.1447G>A, XM_005257193.1:c.1447G>A, XM_005257194.1:c.1447G>AVOUS12/08/2015
216GAAEx10NM_000152.3:c.1456G>Cp.Ala486Pro | p.A486PLRG_673t1:c.1456G>C, NM_000152.3:c.1456G>C, NM_001079803.1:c.1456G>C, NM_001079804.1:c.1456G>C, XM_005257193.1:c.1456G>C, XM_005257194.1:c.1456G>CPathogenic10/30/2019 
217GAAEx10NM_000152.3:c.1465G>Ap.Asp489Asn | p.D489NLRG_673t1:c.1465G>A, NM_000152.3:c.1465G>A, NM_001079803.1:c.1465G>A, NM_001079804.1:c.1465G>A, XM_005257193.1:c.1465G>A, XM_005257194.1:c.1465G>APathogenic09/14/2017 
218GAAEx10NM_000152.3:c.1482A>Gp.Thr494= | p.T494=NM_000152.3:c.1482A>G, NM_001079803.1:c.1482A>G, NM_001079804.1:c.1482A>G, XM_005257193.1:c.1482A>G, XM_005257194.1:c.1482A>GVOUS01/03/2019
219GAAEx10NM_000152.3:c.1504A>Gp.Met502Val | p.M502VLRG_673t1:c.1504A>G, NM_000152.3:c.1504A>G, NM_001079803.1:c.1504A>G, NM_001079804.1:c.1504A>G, XM_005257193.1:c.1504A>G, XM_005257194.1:c.1504A>GVOUS12/07/2016
220GAAEx10NM_000152.3:c.1536C>Tp.Phe512= | p.F512=NM_000152.3:c.1536C>T, NM_001079803.1:c.1536C>T, NM_001079804.1:c.1536C>T, XM_005257193.1:c.1536C>T, XM_005257194.1:c.1536C>TVOUS08/22/2017
221GAAEx10NM_000152.3:c.1548G>Ap.Trp516* | p.W516XLRG_673t1:c.1548G>A, NM_000152.3:c.1548G>A, NM_001079803.1:c.1548G>A, NM_001079804.1:c.1548G>A, XM_005257193.1:c.1548G>A, XM_005257194.1:c.1548G>APathogenic06/08/2018 
222GAAEx10NM_000152.3:c.1551+1G>CPathogenic11/14/2019 
223GAAEx10NM_000152.3:c.1551+42G>ALRG_673t1:c.1551+42G>A, NM_000152.3:c.1551+42G>A, NM_001079803.1:c.1551+42G>A, NM_001079804.1:c.1551+42G>A, XM_005257193.1:c.1551+42G>A, XM_005257194.1:c.1551+42G>ABenign02/01/2017 
224GAAEx10NM_000152.3:c.1551+49C>ANM_000152.3:c.1551+49C>A, NM_001079803.1:c.1551+49C>A, NM_001079804.1:c.1551+49C>A, XM_005257193.1:c.1551+49C>A, XM_005257194.1:c.1551+49C>ABenign** 
225GAAEx11NM_000152.3:c.1552-13G>ANM_000152.3:c.1552-13G>A, NM_001079803.1:c.1552-13G>A, NM_001079804.1:c.1552-13G>A, XM_005257193.1:c.1552-13G>A, XM_005257194.1:c.1552-13G>ALikely benign12/16/2015 
226GAAEx11NM_000152.3:c.1552-3C>GLRG_673t1:c.1552-3C>G, NM_000152.3:c.1552-3C>G, NM_001079803.1:c.1552-3C>G, NM_001079804.1:c.1552-3C>G, XM_005257193.1:c.1552-3C>G, XM_005257194.1:c.1552-3C>GLikely pathogenic03/16/2017 
227GAAEx11NM_000152.3:c.1556T>Cp.Met519Thr | p.M519TLRG_673t1:c.1556T>C, NM_000152.3:c.1556T>C, NM_001079803.1:c.1556T>C, NM_001079804.1:c.1556T>C, XM_005257193.1:c.1556T>C, XM_005257194.1:c.1556T>CVOUS12/22/2016
228GAAEx11NM_000152.3:c.1560C>Tp.Asn520= | p.N520=LRG_673t1:c.1560C>T, NM_000152.3:c.1560C>T, NM_001079803.1:c.1560C>T, NM_001079804.1:c.1560C>T, XM_005257193.1:c.1560C>T, XM_005257194.1:c.1560C>TVOUS08/08/2016
229GAAEx11NM_000152.3:c.1564C>Gp.Pro522Ala | p.P522ALRG_673t1:c.1564C>G, NM_000152.3:c.1564C>G, NM_001079803.1:c.1564C>G, NM_001079804.1:c.1564C>G, XM_005257193.1:c.1564C>G, XM_005257194.1:c.1564C>GPathogenic06/05/2018 
230GAAEx11NM_000152.3:c.1572C>Ap.Asn524Lys | p.N524KLRG_673t1:c.1572C>A, NM_000152.3:c.1572C>A, NM_001079803.1:c.1572C>A, NM_001079804.1:c.1572C>A, XM_005257193.1:c.1572C>A, XM_005257194.1:c.1572C>AVOUS06/12/2018
231GAAEx11NM_000152.3:c.1581G>Ap.Arg527= | p.R527=LRG_673t1:c.1581G>A, NM_000152.3:c.1581G>A, NM_001079803.1:c.1581G>A, NM_001079804.1:c.1581G>A, XM_005257193.1:c.1581G>A, XM_005257194.1:c.1581G>ABenign11/15/2019 
232GAAEx11NM_000152.3:c.1583G>Cp.Gly528Ala | p.G528ANM_000152.3:c.1583G>C, NM_001079803.1:c.1583G>C, NM_001079804.1:c.1583G>C, XM_005257193.1:c.1583G>C, XM_005257194.1:c.1583G>CVOUS09/03/2014
233GAAEx11NM_000152.3:c.1593C>Tp.Asp531= | p.D531=LRG_673t1:c.1593C>T, NM_000152.3:c.1593C>T, NM_001079803.1:c.1593C>T, NM_001079804.1:c.1593C>T, XM_005257193.1:c.1593C>T, XM_005257194.1:c.1593C>TVOUS12/01/2016
234GAAEx11NM_000152.3:c.1594G>Ap.Gly532Ser | p.G532SLRG_673t1:c.1594G>A, NM_000152.3:c.1594G>A, NM_001079803.1:c.1594G>A, NM_001079804.1:c.1594G>A, XM_005257193.1:c.1594G>A, XM_005257194.1:c.1594G>AVOUS08/20/2019
235GAAEx11NM_000152.3:c.1599C>Tp.Cys533= | p.C533=NM_000152.3:c.1599C>T, NM_001079803.1:c.1599C>T, NM_001079804.1:c.1599C>T, XM_005257193.1:c.1599C>T, XM_005257194.1:c.1599C>TVOUS11/04/2015
236GAAEx11NM_000152.3:c.1607A>Gp.Asn536Ser | p.N536SLRG_673t1:c.1607A>G, NM_000152.3:c.1607A>G, NM_001079803.1:c.1607A>G, NM_001079804.1:c.1607A>G, XM_005257193.1:c.1607A>G, XM_005257194.1:c.1607A>GVOUS05/09/2016
237GAAEx11NM_000152.3:c.1629C>Tp.Tyr543= | p.Y543=LRG_673t1:c.1629C>T, NM_000152.3:c.1629C>T, NM_001079803.1:c.1629C>T, NM_001079804.1:c.1629C>T, XM_005257193.1:c.1629C>T, XM_005257194.1:c.1629C>TVOUS11/27/2017
238GAAEx11NM_000152.3:c.1630G>Ap.Val544Met | p.V544MLRG_673t1:c.1630G>A, NM_000152.3:c.1630G>A, NM_001079803.1:c.1630G>A, NM_001079804.1:c.1630G>A, XM_005257193.1:c.1630G>A, XM_005257194.1:c.1630G>AVOUS07/20/2018
239GAAEx11NM_000152.3:c.1636+43G>TBenign** 
240GAAEx12NM_000152.3:c.1637G>Tp.Gly546Val | p.G546VVOUS06/06/2016
241GAAEx12NM_000152.3:c.1642G>Tp.Val548Phe | p.V548FLRG_673t1:c.1642G>T, NM_000152.3:c.1642G>T, NM_001079803.1:c.1642G>T, NM_001079804.1:c.1642G>T, XM_005257193.1:c.1642G>T, XM_005257194.1:c.1642G>TVOUS06/08/2018
242GAAEx12NM_000152.3:c.1650dupGc.1650_1651dupGPathogenic** 
243GAAEx12NM_000152.3:c.1655T>Cp.Leu552Pro | p.L552PLRG_673t1:c.1655T>C, NM_000152.3:c.1655T>C, NM_001079803.1:c.1655T>C, NM_001079804.1:c.1655T>C, XM_005257193.1:c.1655T>C, XM_005257194.1:c.1655T>CPathogenic06/18/2019 
244GAAEx12NM_000152.3:c.1661C>Tp.Ala554Val | p.A554VLRG_673t1:c.1661C>T, NM_000152.3:c.1661C>T, NM_001079803.1:c.1661C>T, NM_001079804.1:c.1661C>T, XM_005257193.1:c.1661C>T, XM_005257194.1:c.1661C>TVOUS12/10/2016
245GAAEx12NM_000152.3:c.1692T>Gp.Phe564Leu | p.F564LLRG_673t1:c.1692T>G, NM_000152.3:c.1692T>G, NM_001079803.1:c.1692T>G, NM_001079804.1:c.1692T>G, XM_005257193.1:c.1692T>G, XM_005257194.1:c.1692T>GVOUS07/08/2016
246GAAEx12NM_000152.3:c.1712T>Cp.Leu571Pro | p.L571PNM_000152.3:c.1712T>C, NM_001079803.1:c.1712T>C, NM_001079804.1:c.1712T>C, XM_005257193.1:c.1712T>C, XM_005257194.1:c.1712T>CVOUS09/08/2015
247GAAEx12NM_000152.3:c.1722C>Tp.Leu574= | p.L574=LRG_673t1:c.1722C>T, NM_000152.3:c.1722C>T, NM_001079803.1:c.1722C>T, NM_001079804.1:c.1722C>T, XM_005257193.1:c.1722C>T, XM_005257194.1:c.1722C>TVOUS04/15/2015
248GAAEx12NM_000152.3:c.1725C>Tp.Tyr575= | p.Y575=NM_000152.3:c.1725C>T, NM_001079803.1:c.1725C>T, NM_001079804.1:c.1725C>T, XM_005257193.1:c.1725C>T, XM_005257194.1:c.1725C>TVOUS11/22/2016
249GAAEx12NM_000152.3:c.1726G>Ap.Gly576Ser | p.G576SLRG_673t1:c.1726G>A, NM_000152.3:c.1726G>A, NM_001079803.1:c.1726G>A, NM_001079804.1:c.1726G>A, XM_005257193.1:c.1726G>A, XM_005257194.1:c.1726G>AOther Reportable10/21/2019 
250GAAEx12NM_000152.3:c.1754+1G>ALRG_673t1:c.1754+1G>A, NM_000152.3:c.1754+1G>A, NM_001079803.1:c.1754+1G>A, NM_001079804.1:c.1754+1G>A, XM_005257193.1:c.1754+1G>A, XM_005257194.1:c.1754+1G>APathogenic05/01/2019 
251GAAEx12NM_000152.3:c.1754+12G>ANM_000152.3:c.1754+12G>A, NM_001079803.1:c.1754+12G>A, NM_001079804.1:c.1754+12G>A, XM_005257193.1:c.1754+12G>A, XM_005257194.1:c.1754+12G>ABenign10/16/2019 
252GAAEx13NM_000152.3:c.1757C>Tp.Ala586Val | p.A586VLRG_673t1:c.1757C>T, NM_000152.3:c.1757C>T, NM_001079803.1:c.1757C>T, NM_001079804.1:c.1757C>T, XM_005257193.1:c.1757C>T, XM_005257194.1:c.1757C>TVOUS03/05/2017
253GAAEx13NM_000152.3:c.1758G>Ap.Ala586= | p.A586=LRG_673t1:c.1758G>A, NM_000152.3:c.1758G>A, NM_001079803.1:c.1758G>A, NM_001079804.1:c.1758G>A, XM_005257193.1:c.1758G>A, XM_005257194.1:c.1758G>ALikely benign10/11/2017 
254GAAEx13NM_000152.3:c.1781G>Cp.Arg594Pro | p.R594PLRG_673t1:c.1781G>C, NM_000152.3:c.1781G>C, NM_001079803.1:c.1781G>C, NM_001079804.1:c.1781G>C, XM_005257193.1:c.1781G>C, XM_005257194.1:c.1781G>CVOUS07/08/2016
255GAAEx13NM_000152.3:c.1796C>Ap.Ser599Tyr | p.S599YLRG_673t1:c.1796C>A, NM_000152.3:c.1796C>A, NM_001079803.1:c.1796C>A, NM_001079804.1:c.1796C>A, XM_005257193.1:c.1796C>A, XM_005257194.1:c.1796C>ALikely pathogenic12/19/2018 
256GAAEx13NM_000152.3:c.1799G>Ap.Arg600His | p.R600HPathogenic** 
257GAAEx13NM_000152.3:c.1802C>Tp.Ser601Leu | p.S601LNM_000152.3:c.1802C>T, NM_001079803.1:c.1802C>T, NM_001079804.1:c.1802C>T, XM_005257193.1:c.1802C>T, XM_005257194.1:c.1802C>TPathogenic11/19/2014 
258GAAEx13NM_000152.3:c.1802C>Gp.Ser601Trp | p.S601WLRG_673t1:c.1802C>G, NM_000152.3:c.1802C>G, NM_001079803.1:c.1802C>G, NM_001079804.1:c.1802C>G, XM_005257193.1:c.1802C>G, XM_005257194.1:c.1802C>GLikely pathogenic11/15/2019 
259GAAEx13NM_000152.3:c.1802C>Ap.Ser601* | p.S601XLRG_673t1:c.1802C>A, NM_000152.3:c.1802C>A, NM_001079803.1:c.1802C>A, NM_001079804.1:c.1802C>A, XM_005257193.1:c.1802C>A, XM_005257194.1:c.1802C>APathogenic08/19/2019 
260GAAEx13NM_000152.3:c.1822C>Tp.Arg608* | p.R608XLRG_673t1:c.1822C>T, NM_000152.3:c.1822C>T, NM_001079803.1:c.1822C>T, NM_001079804.1:c.1822C>T, XM_005257193.1:c.1822C>T, XM_005257194.1:c.1822C>TPathogenic10/01/2019 
261GAAEx13NM_000152.3:c.1823G>Ap.Arg608Gln | p.R608QLRG_673t1:c.1823G>A, NM_000152.3:c.1823G>A, NM_001079803.1:c.1823G>A, NM_001079804.1:c.1823G>A, XM_005257193.1:c.1823G>A, XM_005257194.1:c.1823G>AVOUS07/31/2018
262GAAEx13NM_000152.3:c.1826dupAp.Tyr609* | p.Y609XLRG_673t1:c.1826dupA, NM_000152.3:c.1826_1827dupA, NM_000152.3:c.1826dupA, NM_001079803.1:c.1826dupA, NM_001079804.1:c.1826dupA, XM_005257193.1:c.1826dupA, XM_005257194.1:c.1826dupAPathogenic08/20/2018 
263GAAEx13NM_000152.3:c.1827delCp.Tyr609* | p.Y609XLRG_673t1:c.1827delC, NM_000152.3:c.1827delC, NM_001079803.1:c.1827delC, NM_001079804.1:c.1827delC, XM_005257193.1:c.1827delC, XM_005257194.1:c.1827delCPathogenic03/13/2017 
264GAAEx13NM_000152.3:c.1827_1828insAp.Ala610Serfs*26 | p.A610SfsX26LRG_673t1:c.1827_1828insA, NM_000152.3:c.1827_1828insA, NM_001079803.1:c.1827_1828insA, NM_001079804.1:c.1827_1828insA, XM_005257193.1:c.1827_1828insA, XM_005257194.1:c.1827_1828insAPathogenic** 
265GAAEx13NM_000152.3:c.1828G>Ap.Ala610Thr | p.A610TNM_000152.3:c.1828G>A, NM_001079803.1:c.1828G>A, NM_001079804.1:c.1828G>A, XM_005257193.1:c.1828G>A, XM_005257194.1:c.1828G>AVOUS07/30/2018
266GAAEx13NM_000152.3:c.1830C>Tp.Ala610= | p.A610=NM_000152.3:c.1830C>T, NM_001079803.1:c.1830C>T, NM_001079804.1:c.1830C>T, XM_005257193.1:c.1830C>T, XM_005257194.1:c.1830C>TLikely benign10/19/2016 
267GAAEx13NM_000152.3:c.1835A>Cp.His612Pro | p.H612PLRG_673t1:c.1835A>C, NM_000152.3:c.1835A>C, NM_001079803.1:c.1835A>C, NM_001079804.1:c.1835A>C, XM_005257193.1:c.1835A>C, XM_005257194.1:c.1835A>CVOUS07/23/2018
268GAAEx13NM_000152.3:c.1841C>Tp.Thr614Met | p.T614MLRG_673t1:c.1841C>T, NM_000152.3:c.1841C>T, NM_001079803.1:c.1841C>T, NM_001079804.1:c.1841C>T, XM_005257193.1:c.1841C>T, XM_005257194.1:c.1841C>TVOUS02/25/2016
269GAAEx13NM_000152.3:c.1841C>Ap.Thr614Lys | p.T614KLRG_673t1:c.1841C>A, NM_000152.3:c.1841C>A, NM_001079803.1:c.1841C>A, NM_001079804.1:c.1841C>A, XM_005257194.1:c.1841C>APathogenic02/28/2018 
270GAAEx13NM_000152.3:c.1842G>Ap.Thr614= | p.T614=LRG_673t1:c.1842G>A, NM_000152.3:c.1842G>A, NM_001079803.1:c.1842G>A, NM_001079804.1:c.1842G>A, XM_005257193.1:c.1842G>A, XM_005257194.1:c.1842G>AVOUS08/01/2016
271GAAEx13NM_000152.3:c.1847dupAp.Asp616Glufs*20 | p.D616EfsX20LRG_673t1:c.1847dupA, NM_000152.3:c.1847dupA, NM_001079803.1:c.1847dupA, NM_001079804.1:c.1847dupA, XM_005257193.1:c.1847dupA, XM_005257194.1:c.1847dupAPathogenic09/09/2019 
272GAAEx13NM_000152.3:c.1848C>Tp.Asp616= | p.D616=NM_000152.3:c.1848C>T, NM_001079803.1:c.1848C>T, NM_001079804.1:c.1848C>T, XM_005257193.1:c.1848C>T, XM_005257194.1:c.1848C>TVOUS10/30/2015
273GAAEx13NM_000152.3:c.1849G>Ap.Val617Met | p.V617MLRG_673t1:c.1849G>A, NM_000152.3:c.1849G>A, NM_001079803.1:c.1849G>A, NM_001079804.1:c.1849G>A, XM_005257193.1:c.1849G>A, XM_005257194.1:c.1849G>AVOUS01/16/2017
274GAAEx13NM_000152.3:c.1851G>Ap.Val617= | p.V617=NM_000152.3:c.1851G>A, NM_001079803.1:c.1851G>A, NM_001079804.1:c.1851G>A, XM_005257193.1:c.1851G>A, XM_005257194.1:c.1851G>AVOUS11/11/2015
275GAAEx13NM_000152.3:c.1857C>Gp.Ser619Arg | p.S619RLRG_673t1:c.1857C>G, NM_000152.3:c.1857C>G, NM_001079803.1:c.1857C>G, NM_001079804.1:c.1857C>G, XM_005257193.1:c.1857C>G, XM_005257194.1:c.1857C>GPathogenic09/27/2019 
276GAAEx13NM_000152.3:c.1860C>Tp.Ser620= | p.S620=LRG_673t1:c.1860C>T, NM_000152.3:c.1860C>T, NM_001079803.1:c.1860C>T, NM_001079804.1:c.1860C>T, XM_005257193.1:c.1860C>T, XM_005257194.1:c.1860C>TVOUS11/06/2017
277GAAEx13NM_000152.3:c.1880C>Tp.Ser627Phe | p.S627FLRG_673t1:c.1880C>T, NM_000152.3:c.1880C>T, NM_001079803.1:c.1880C>T, NM_001079804.1:c.1880C>T, XM_005257193.1:c.1880C>T, XM_005257194.1:c.1880C>TPathogenic06/08/2018 
278GAAEx13NM_000152.3:c.1884G>Cp.Val628= | p.V628=LRG_673t1:c.1884G>C, NM_000152.3:c.1884G>C, NM_001079803.1:c.1884G>C, NM_001079804.1:c.1884G>C, XM_005257193.1:c.1884G>C, XM_005257194.1:c.1884G>CVOUS10/07/2016
279GAAEx13NM_000152.3:c.1886C>Tp.Pro629Leu | p.P629LLRG_673t1:c.1886C>T, NM_000152.3:c.1886C>T, NM_001079803.1:c.1886C>T, NM_001079804.1:c.1886C>T, XM_005257193.1:c.1886C>T, XM_005257194.1:c.1886C>TVOUS08/28/2016
280GAAEx13NM_000152.3:c.1888+5G>TNM_000152.3:c.1888+5G>T, NM_001079803.1:c.1888+5G>T, NM_001079804.1:c.1888+5G>T, XM_005257193.1:c.1888+5G>T, XM_005257194.1:c.1888+5G>TVOUS11/13/2017
281GAAEx13NM_000152.3:c.1888+10_1888+11insCLRG_673t1:c.1888+10_1888+11insC, NM_000152.3:c.1888+10_1888+11insC, NM_001079803.1:c.1888+10_1888+11insC, NM_001079804.1:c.1888+10_1888+11insC, XM_005257193.1:c.1888+10_1888+11insC, XM_005257194.1:c.1888+10_1888+11insCVOUS06/23/2017
282GAAEx13NM_000152.3:c.1888+21G>ANM_000152.3:c.1888+21G>A, NM_001079803.1:c.1888+21G>A, NM_001079804.1:c.1888+21G>A, XM_005257193.1:c.1888+21G>A, XM_005257194.1:c.1888+21G>ABenign** 
283GAAEx14NM_000152.3:c.1889-5C>TNM_000152.3:c.1889-5C>T, NM_001079803.1:c.1889-5C>T, NM_001079804.1:c.1889-5C>T, XM_005257193.1:c.1889-5C>T, XM_005257194.1:c.1889-5C>TVOUS05/13/2015
284GAAEx14NM_000152.3:c.1910_1918delTGGGGGTGCp.Leu637_Val639del | p.L637_V639delLRG_673t1:c.1910_1918delTGGGGGTGC, NM_000152.3:c.1910_1918delTGGGGGTGC, NM_001079803.1:c.1910_1918delTGGGGGTGC, NM_001079804.1:c.1910_1918delTGGGGGTGC, XM_005257193.1:c.1910_1918delTGGGGGTGC, XM_005257194.1:c.1910_1918delTGGGGGTGCVOUS04/25/2019
285GAAEx14NM_000152.3:c.1912G>Tp.Gly638Trp | p.G638WNM_000152.3:c.1912G>T, NM_001079803.1:c.1912G>T, NM_001079804.1:c.1912G>T, XM_005257193.1:c.1912G>T, XM_005257194.1:c.1912G>TPathogenic12/18/2018 
286GAAEx14NM_000152.3:c.1920T>Gp.Pro640= | p.P640=NM_000152.3:c.1920T>G, NM_001079803.1:c.1920T>G, NM_001079804.1:c.1920T>G, XM_005257193.1:c.1920T>G, XM_005257194.1:c.1920T>GVOUS11/11/2015
287GAAEx14NM_000152.3:c.1927G>Ap.Gly643Arg | p.G643RLRG_673t1:c.1927G>A, NM_000152.3:c.1927G>A, NM_001079803.1:c.1927G>A, NM_001079804.1:c.1927G>A, XM_005257193.1:c.1927G>A, XM_005257194.1:c.1927G>APathogenic05/10/2019 
288GAAEx14NM_000152.3:c.1930G>Cp.Ala644Pro | p.A644PNM_000152.3:c.1930G>C, NM_001079803.1:c.1930G>C, NM_001079804.1:c.1930G>C, XM_005257193.1:c.1930G>C, XM_005257194.1:c.1930G>CVOUS02/29/2016
289GAAEx14NM_000152.3:c.1935C>Ap.Asp645Glu | p.D645ELRG_673t1:c.1935C>A, NM_000152.3:c.1935C>A, NM_001079803.1:c.1935C>A, NM_001079804.1:c.1935C>A, XM_005257193.1:c.1935C>A, XM_005257194.1:c.1935C>APathogenic08/20/2019 
290GAAEx14NM_000152.3:c.1940G>Tp.Cys647Phe | p.C647FLRG_673t1:c.1940G>T, NM_000152.3:c.1940G>T, NM_001079803.1:c.1940G>T, NM_001079804.1:c.1940G>T, XM_005257193.1:c.1940G>T, XM_005257194.1:c.1940G>TVOUS05/30/2019
291GAAEx14NM_000152.3:c.1947C>Tp.Phe649= | p.F649=NM_000152.3:c.1947C>T, NM_001079803.1:c.1947C>T, NM_001079804.1:c.1947C>T, XM_005257193.1:c.1947C>T, XM_005257194.1:c.1947C>TVOUS09/14/2015
292GAAEx14NM_000152.3:c.1964A>Gp.Glu655Gly | p.E655GLRG_673t1:c.1964A>G, NM_000152.3:c.1964A>G, NM_001079803.1:c.1964A>G, NM_001079804.1:c.1964A>G, XM_005257193.1:c.1964A>G, XM_005257194.1:c.1964A>GVOUS02/13/2018
293GAAEx14NM_000152.3:c.1979G>Ap.Arg660His | p.R660HLRG_673t1:c.1979G>A, NM_000152.3:c.1979G>A, NM_001079803.1:c.1979G>A, NM_001079804.1:c.1979G>A, XM_005257193.1:c.1979G>A, XM_005257194.1:c.1979G>APathogenic02/27/2017 
294GAAEx14NM_000152.3:c.2012T>Gp.Met671Arg | p.M671RPathogenic09/25/2012 
295GAAEx14NM_000152.3:c.2014C>Tp.Arg672Trp | p.R672WLRG_673t1:c.2014C>T, NM_000152.3:c.2014C>T, NM_001079803.1:c.2014C>T, NM_001079804.1:c.2014C>T, XM_005257193.1:c.2014C>T, XM_005257194.1:c.2014C>TPathogenic08/20/2018 
296GAAEx14NM_000152.3:c.2040+7T>GLRG_673t1:c.2040+7T>G, NM_000152.3:c.2040+7T>G, NM_001079803.1:c.2040+7T>G, NM_001079804.1:c.2040+7T>G, XM_005257193.1:c.2040+7T>G, XM_005257194.1:c.2040+7T>GVOUS10/12/2016
297GAAEx14NM_000152.3:c.2040+17G>AVOUS11/14/2019
298GAAEx14NM_000152.3:c.2040+20A>GNM_000152.3:c.2040+20A>G, NM_001079803.1:c.2040+20A>G, NM_001079804.1:c.2040+20A>G, XM_005257194.1:c.2040+20A>GBenign07/02/2019 
299GAAEx15NM_000152.3:c.2041-4G>TLRG_673t1:c.2041-4G>T, NM_000152.3:c.2041-4G>T, NM_001079803.1:c.2041-4G>T, NM_001079804.1:c.2041-4G>T, XM_005257193.1:c.2041-4G>T, XM_005257194.1:c.2041-4G>TVOUS04/04/2018
300GAAEx15NM_000152.3:c.2041-1G>APathogenic07/02/2019 
301GAAEx15NM_000152.3:c.2051C>Tp.Pro684Leu | p.P684LNM_000152.3:c.2051C>T, NM_001079803.1:c.2051C>T, NM_001079804.1:c.2051C>T, XM_005257193.1:c.2051C>T, XM_005257194.1:c.2051C>TVOUS08/16/2018
302GAAEx15NM_000152.3:c.2052G>Ap.Pro684= | p.P684=LRG_673t1:c.2052G>A, NM_000152.3:c.2052G>A, NM_001079803.1:c.2052G>A, NM_001079804.1:c.2052G>A, XM_005257193.1:c.2052G>A, XM_005257194.1:c.2052G>AVOUS10/26/2016
303GAAEx15NM_000152.3:c.2052G>Cp.Pro684= | p.P684=LRG_673t1:c.2052G>C, NM_000152.3:c.2052G>C, NM_001079803.1:c.2052G>C, NM_001079804.1:c.2052G>C, XM_005257193.1:c.2052G>C, XM_005257194.1:c.2052G>CVOUS07/19/2018
304GAAEx15NM_000152.3:c.2064C>Tp.Ser688= | p.S688=LRG_673t1:c.2064C>T, NM_000152.3:c.2064C>T, NM_001079803.1:c.2064C>T, NM_001079804.1:c.2064C>T, XM_005257193.1:c.2064C>T, XM_005257194.1:c.2064C>TVOUS06/17/2016
305GAAEx15NM_000152.3:c.2065G>Ap.Glu689Lys | p.E689KLRG_673t1:c.2065G>A, NM_000152.3:c.2065G>A, NM_001079803.1:c.2065G>A, NM_001079804.1:c.2065G>A, XM_005257193.1:c.2065G>A, XM_005257194.1:c.2065G>AOther Reportable10/21/2019 
306GAAEx15NM_000152.3:c.2066_2070dupAGCCGPathogenic10/23/2012 
307GAAEx15NM_000152.3:c.2078dupAp.Ala694Glyfs*43 | p.A694GfsX43LRG_673t1:c.2078dupA, NM_000152.3:c.2078dupA, NM_001079803.1:c.2078dupA, NM_001079804.1:c.2078dupA, XM_005257193.1:c.2078dupA, XM_005257194.1:c.2078dupAPathogenic05/22/2018 
308GAAEx15NM_000152.3:c.2082C>Gp.Ala694= | p.A694=LRG_673t1:c.2082C>G, NM_000152.3:c.2082C>G, NM_001079803.1:c.2082C>G, NM_001079804.1:c.2082C>G, XM_005257193.1:c.2082C>G, XM_005257194.1:c.2082C>GVOUS09/26/2019
309GAAEx15NM_000152.3:c.2092G>Ap.Ala698Thr | p.A698TNM_000152.3:c.2092G>A, NM_001079803.1:c.2092G>A, NM_001079804.1:c.2092G>A, XM_005257193.1:c.2092G>A, XM_005257194.1:c.2092G>AVOUS11/16/2017
310GAAEx15NM_000152.3:c.2104C>Tp.Arg702Cys | p.R702CLRG_673t1:c.2104C>T, NM_000152.3:c.2104C>T, NM_001079803.1:c.2104C>T, NM_001079804.1:c.2104C>T, XM_005257193.1:c.2104C>T, XM_005257194.1:c.2104C>TPathogenic04/29/2019 
311GAAEx15NM_000152.3:c.2105G>Ap.Arg702His | p.R702HLRG_673t1:c.2105G>A, NM_000152.3:c.2105G>A, NM_001079803.1:c.2105G>A, NM_001079804.1:c.2105G>A, XM_005257193.1:c.2105G>A, XM_005257194.1:c.2105G>ALikely pathogenic06/27/2017 
312GAAEx15NM_000152.3:c.2105G>Cp.Arg702Pro | p.R702PLRG_673t1:c.2105G>C, NM_000152.3:c.2105G>C, NM_001079803.1:c.2105G>C, NM_001079804.1:c.2105G>C, XM_005257193.1:c.2105G>C, XM_005257194.1:c.2105G>CLikely pathogenic09/04/2019 
313GAAEx15NM_000152.3:c.2105G>Tp.Arg702Leu | p.R702LLRG_673t1:c.2105G>T, NM_000152.3:c.2105G>T, NM_001079803.1:c.2105G>T, NM_001079804.1:c.2105G>T, XM_005257194.1:c.2105G>TLikely pathogenic06/19/2013 
314GAAEx15NM_000152.3:c.2109C>Tp.Tyr703= | p.Y703=LRG_673t1:c.2109C>T, NM_000152.3:c.2109C>T, NM_001079803.1:c.2109C>T, NM_001079804.1:c.2109C>T, XM_005257193.1:c.2109C>T, XM_005257194.1:c.2109C>TVOUS06/01/2018
315GAAEx15NM_000152.3:c.2122C>Tp.His708Tyr | p.H708YNM_000152.3:c.2122C>T, NM_001079803.1:c.2122C>T, NM_001079804.1:c.2122C>T, XM_005257193.1:c.2122C>T, XM_005257194.1:c.2122C>TVOUS08/18/2015
316GAAEx15NM_000152.3:c.2132C>Gp.Thr711Arg | p.T711RLRG_673t1:c.2132C>G, NM_000152.3:c.2132C>G, NM_001079803.1:c.2132C>G, NM_001079804.1:c.2132C>G, XM_005257193.1:c.2132C>G, XM_005257194.1:c.2132C>GVOUS07/10/2017
317GAAEx15NM_000152.3:c.2133A>Gp.Thr711= | p.T711=LRG_673t1:c.2133A>G, NM_000152.3:c.2133A>G, NM_001079803.1:c.2133A>G, NM_001079804.1:c.2133A>G, XM_005257193.1:c.2133A>G, XM_005257194.1:c.2133A>GBenign04/30/2019 
318GAAEx15NM_000152.3:c.2140delCNM_000152.3:c.2140delC, NM_001079803.1:c.2140delC, NM_001079804.1:c.2140delC, XM_005257193.1:c.2140delC, XM_005257194.1:c.2140delCPathogenic08/12/2015 
319GAAEx15NM_000152.3:c.2152G>Ap.Val718Ile | p.V718INM_000152.3:c.2152G>A, NM_001079803.1:c.2152G>A, NM_001079804.1:c.2152G>A, XM_005257193.1:c.2152G>A, XM_005257194.1:c.2152G>AVOUS03/29/2018
320GAAEx15NM_000152.3:c.2155G>Tp.Ala719Ser | p.A719SLRG_673t1:c.2155G>T, NM_000152.3:c.2155G>T, NM_001079803.1:c.2155G>T, NM_001079804.1:c.2155G>T, XM_005257193.1:c.2155G>T, XM_005257194.1:c.2155G>TVOUS03/03/2016
321GAAEx15NM_000152.3:c.2155G>Ap.Ala719Thr | p.A719TLRG_673t1:c.2155G>A, NM_000152.3:c.2155G>A, NM_001079803.1:c.2155G>A, NM_001079804.1:c.2155G>A, XM_005257193.1:c.2155G>A, XM_005257194.1:c.2155G>AVOUS03/04/2016
322GAAEx15NM_000152.3:c.2156C>Ap.Ala719Glu | p.A719ENM_000152.3:c.2156C>A, NM_001079803.1:c.2156C>A, NM_001079804.1:c.2156C>A, XM_005257193.1:c.2156C>A, XM_005257194.1:c.2156C>AVOUS03/09/2017
323GAAEx15NM_000152.3:c.2157G>Ap.Ala719= | p.A719=NM_000152.3:c.2157G>A, NM_001079803.1:c.2157G>A, NM_001079804.1:c.2157G>A, XM_005257193.1:c.2157G>A, XM_005257194.1:c.2157G>AVOUS01/15/2015
324GAAEx15NM_000152.3:c.2161G>Cp.Glu721Gln | p.E721QNM_000152.3:c.2161G>C, NM_001079803.1:c.2161G>C, NM_001079804.1:c.2161G>C, XM_005257193.1:c.2161G>C, XM_005257194.1:c.2161G>CVOUS11/25/2015
325GAAEx15NM_000152.3:c.2164A>Tp.Thr722Ser | p.T722SLRG_673t1:c.2164A>T, NM_000152.3:c.2164A>T, NM_001079803.1:c.2164A>T, NM_001079804.1:c.2164A>T, XM_005257193.1:c.2164A>T, XM_005257194.1:c.2164A>TVOUS07/31/2018
326GAAEx15NM_000152.3:c.2171C>Ap.Ala724Asp | p.A724DLRG_673t1:c.2171C>A, NM_000152.3:c.2171C>A, NM_001079803.1:c.2171C>A, NM_001079804.1:c.2171C>A, XM_005257193.1:c.2171C>A, XM_005257194.1:c.2171C>ALikely pathogenic11/06/2019 
327GAAEx16NM_000152.3:c.2190-4G>ALRG_673t1:c.2190-4G>A, NM_000152.3:c.2190-4G>A, NM_001079803.1:c.2190-4G>A, NM_001079804.1:c.2190-4G>A, XM_005257193.1:c.2190-4G>A, XM_005257194.1:c.2190-4G>AVOUS11/02/2016
328GAAEx16NM_000152.3:c.2213G>Ap.Trp738* | p.W738XLRG_673t1:c.2213G>A, NM_000152.3:c.2213G>A, NM_001079803.1:c.2213G>A, NM_001079804.1:c.2213G>A, XM_005257193.1:c.2213G>A, XM_005257194.1:c.2213G>APathogenic03/13/2019 
329GAAEx16NM_000152.3:c.2222A>Tp.Asp741Val | p.D741VLRG_673t1:c.2222A>T, NM_000152.3:c.2222A>T, NM_001079803.1:c.2222A>T, NM_001079804.1:c.2222A>T, XM_005257193.1:c.2222A>T, XM_005257194.1:c.2222A>TVOUS09/06/2016
330GAAEx16NM_000152.3:c.2228A>Gp.Gln743Arg | p.Q743RLRG_673t1:c.2228A>G, NM_000152.3:c.2228A>G, NM_001079803.1:c.2228A>G, NM_001079804.1:c.2228A>G, XM_005257193.1:c.2228A>G, XM_005257194.1:c.2228A>GVOUS03/25/2019
331GAAEx16NM_000152.3:c.2236T>Cp.Trp746Arg | p.W746RLRG_673t1:c.2236T>C, NM_000152.3:c.2236T>C, NM_001079803.1:c.2236T>C, NM_001079804.1:c.2236T>C, XM_005257193.1:c.2236T>C, XM_005257194.1:c.2236T>CLikely pathogenic01/13/2017 
332GAAEx16NM_000152.3:c.2237G>Cp.Trp746Ser | p.W746SLRG_673t1:c.2237G>C, NM_000152.3:c.2237G>C, NM_001079803.1:c.2237G>C, NM_001079804.1:c.2237G>C, XM_005257193.1:c.2237G>C, XM_005257194.1:c.2237G>CVOUS03/20/2019
333GAAEx16NM_000152.3:c.2237G>Ap.Trp746* | p.W746XLRG_673t1:c.2237G>A, NM_000152.3:c.2237G>A, NM_001079803.1:c.2237G>A, NM_001079804.1:c.2237G>A, XM_005257193.1:c.2237G>A, XM_005257194.1:c.2237G>APathogenic06/13/2018 
334GAAEx16NM_000152.3:c.2237G>Tp.Trp746Leu | p.W746LNM_000152.3:c.2237G>T, NM_001079803.1:c.2237G>T, NM_001079804.1:c.2237G>T, XM_005257193.1:c.2237G>T, XM_005257194.1:c.2237G>TVOUS05/16/2018
335GAAEx16NM_000152.3:c.2238G>Cp.Trp746Cys | p.W746CLRG_673t1:c.2238G>C, NM_000152.3:c.2238G>C, NM_001079803.1:c.2238G>C, NM_001079804.1:c.2238G>C, XM_005257193.1:c.2238G>C, XM_005257194.1:c.2238G>CPathogenic08/16/2019 
336GAAEx16NM_000152.3:c.2238G>Ap.Trp746* | p.W746XLRG_673t1:c.2238G>A, NM_000152.3:c.2238G>A, NM_001079803.1:c.2238G>A, NM_001079804.1:c.2238G>A, XM_005257193.1:c.2238G>A, XM_005257194.1:c.2238G>APathogenic08/29/2019 
337GAAEx16NM_000152.3:c.2242dupGp.Glu748Glyfs*48 | p.E748GfsX48** ERROR **, LRG_673t1:c.2242_2243insG, LRG_673t1:c.2242dupG, NM_000152.3:c.2242_2243insG, NM_000152.3:c.2242dupG, NM_001079803.1:c.2242_2243insG, NM_001079803.1:c.2242dupG, NM_001079804.1:c.2242_2243insG, NM_001079804.1:c.2242dupG, XM_005257193.1:c.2242_2243insG, XM_005257193.1:c.2242dupG, XM_005257194.1:c.2242_2243insG, XM_005257194.1:c.2242dupGPathogenic01/31/2017 
338GAAEx16NM_000152.3:c.2253C>Tp.Leu751= | p.L751=LRG_673t1:c.2253C>T, NM_000152.3:c.2253C>T, NM_001079803.1:c.2253C>T, NM_001079804.1:c.2253C>T, XM_005257193.1:c.2253C>T, XM_005257194.1:c.2253C>TVOUS02/07/2018
339GAAEx16NM_000152.3:c.2256C>Tp.Ile752= | p.I752=LRG_673t1:c.2256C>T, NM_000152.3:c.2256C>T, NM_001079803.1:c.2256C>T, NM_001079804.1:c.2256C>T, XM_005257193.1:c.2256C>T, XM_005257194.1:c.2256C>TVOUS03/14/2018
340GAAEx16NM_000152.3:c.2261dupCp.Val755Serfs*41 | p.V755SfsX41LRG_673t1:c.2261dupC, NM_000152.3:c.2261dupC, NM_001079803.1:c.2261dupC, NM_001079804.1:c.2261dupC, XM_005257193.1:c.2261dupC, XM_005257194.1:c.2261dupCPathogenic09/24/2019 
341GAAEx16NM_000152.3:c.2269C>Tp.Gln757* | p.Q757XLRG_673t1:c.2269C>T, NM_000152.3:c.2269C>T, NM_001079803.1:c.2269C>T, NM_001079804.1:c.2269C>T, XM_005257193.1:c.2269C>T, XM_005257194.1:c.2269C>TPathogenic06/12/2019 
342GAAEx16NM_000152.3:c.2275G>Ap.Gly759Arg | p.G759RNM_000152.3:c.2275G>A, NM_001079803.1:c.2275G>A, NM_001079804.1:c.2275G>A, XM_005257193.1:c.2275G>A, XM_005257194.1:c.2275G>AVOUS06/11/2018
343GAAEx16NM_000152.3:c.2294G>Ap.Gly765Asp | p.G765DVOUS**
344GAAEx16NM_000152.3:c.2297A>Gp.Tyr766Cys | p.Y766CLRG_673t1:c.2297A>G, NM_000152.3:c.2297A>G, NM_001079803.1:c.2297A>G, NM_001079804.1:c.2297A>G, XM_005257193.1:c.2297A>G, XM_005257194.1:c.2297A>GVOUS01/04/2016
345GAAEx16NM_000152.3:c.2323C>Ap.Leu775Met | p.L775MNM_000152.3:c.2323C>A, NM_001079803.1:c.2323C>A, NM_001079804.1:c.2323C>A, XM_005257193.1:c.2323C>A, XM_005257194.1:c.2323C>AVOUS11/04/2015
346GAAEx16NM_000152.3:c.2330_2331+4dupCGGTGALRG_673t1:c.2330_2331+4dupCGGTGA, NM_000152.3:c.2330_2331+4dupCGGTGA, NM_001079803.1:c.2330_2331+4dupCGGTGA, NM_001079804.1:c.2330_2331+4dupCGGTGA, XM_005257193.1:c.2330_2331+4dupCGGTGA, XM_005257194.1:c.2330_2331+4dupCGGTGAVOUS08/19/2019
347GAAEx16NM_000152.3:c.2331+2T>APathogenic08/30/2019 
348GAAEx16NM_000152.3:c.2331+20G>ANM_000152.3:c.2331+20G>A, NM_001079803.1:c.2331+20G>A, NM_001079804.1:c.2331+20G>A, XM_005257194.1:c.2331+20G>ABenign07/02/2019 
349GAAEx16NM_000152.3:c.2331+24T>CBenign** 
350GAAEx17NM_000152.3:c.2332-12A>TLRG_673t1:c.2332-12A>T, NM_000152.3:c.2332-12A>T, NM_001079803.1:c.2332-12A>T, NM_001079804.1:c.2332-12A>T, XM_005257193.1:c.2332-12A>T, XM_005257194.1:c.2332-12A>TVOUS09/10/2012
351GAAEx17NM_000152.3:c.2332-10C>GLRG_673t1:c.2332-10C>G, NM_000152.3:c.2332-10C>G, NM_001079803.1:c.2332-10C>G, NM_001079804.1:c.2332-10C>G, XM_005257193.1:c.2332-10C>G, XM_005257194.1:c.2332-10C>GVOUS07/02/2018
352GAAEx17NM_000152.3:c.2338G>Ap.Val780Ile | p.V780ILRG_673t1:c.2338G>A, NM_000152.3:c.2338G>A, NM_001079803.1:c.2338G>A, NM_001079804.1:c.2338G>A, XM_005257193.1:c.2338G>A, XM_005257194.1:c.2338G>ABenign07/02/2019 
353GAAEx17NM_000152.3:c.2361A>Cp.Pro787= | p.P787=LRG_673t1:c.2361A>C, NM_000152.3:c.2361A>C, NM_001079803.1:c.2361A>C, NM_001079804.1:c.2361A>C, XM_005257193.1:c.2361A>C, XM_005257194.1:c.2361A>CVOUS10/18/2016
354GAAEx17NM_000152.3:c.2365C>Gp.Pro789Ala | p.P789ALRG_673t1:c.2365C>G, NM_000152.3:c.2365C>G, NM_001079803.1:c.2365C>G, NM_001079804.1:c.2365C>G, XM_005257193.1:c.2365C>G, XM_005257194.1:c.2365C>GVOUS09/26/2016
355GAAEx17NM_000152.3:c.2380C>Gp.Arg794Gly | p.R794GVOUS02/07/2014
356GAAEx17NM_000152.3:c.2383G>Ap.Glu795Lys | p.E795KLRG_673t1:c.2383G>A, NM_000152.3:c.2383G>A, NM_001079803.1:c.2383G>A, NM_001079804.1:c.2383G>A, XM_005257193.1:c.2383G>A, XM_005257194.1:c.2383G>AVOUS05/31/2016
357GAAEx17NM_000152.3:c.2391C>Tp.Ala797= | p.A797=NM_000152.3:c.2391C>T, NM_001079803.1:c.2391C>T, NM_001079804.1:c.2391C>T, XM_005257193.1:c.2391C>T, XM_005257194.1:c.2391C>TVOUS08/04/2015
358GAAEx17NM_000152.3:c.2395C>Tp.His799Tyr | p.H799YNM_000152.3:c.2395C>T, NM_001079803.1:c.2395C>T, NM_001079804.1:c.2395C>T, XM_005257193.1:c.2395C>T, XM_005257194.1:c.2395C>TVOUS12/31/2015
359GAAEx17NM_000152.3:c.2400C>Tp.Ser800= | p.S800=NM_000152.3:c.2400C>T, NM_001079803.1:c.2400C>T, NM_001079804.1:c.2400C>TBenign12/13/2013 
360GAAEx17NM_000152.3:c.2404G>Ap.Gly802Arg | p.G802RLRG_673t1:c.2404G>A, NM_000152.3:c.2404G>A, NM_001079803.1:c.2404G>A, NM_001079804.1:c.2404G>A, XM_005257193.1:c.2404G>A, XM_005257194.1:c.2404G>AVOUS01/25/2016
361GAAEx17NM_000152.3:c.2408A>Gp.Gln803Arg | p.Q803RLRG_673t1:c.2408A>G, NM_000152.3:c.2408A>G, NM_001079803.1:c.2408A>G, NM_001079804.1:c.2408A>G, XM_005257193.1:c.2408A>G, XM_005257194.1:c.2408A>GVOUS01/24/2017
362GAAEx17NM_000152.3:c.2415G>Ap.Val805= | p.V805=NM_000152.3:c.2415G>A, NM_001079803.1:c.2415G>A, NM_001079804.1:c.2415G>A, XM_005257193.1:c.2415G>A, XM_005257194.1:c.2415G>AVOUS04/13/2018
363GAAEx17NM_000152.3:c.2417C>Tp.Thr806Met | p.T806MNM_000152.3:c.2417C>T, NM_001079803.1:c.2417C>T, NM_001079804.1:c.2417C>T, XM_005257193.1:c.2417C>T, XM_005257194.1:c.2417C>TVOUS12/11/2018
364GAAEx17NM_000152.3:c.2418G>Ap.Thr806= | p.T806=NM_000152.3:c.2418G>A, NM_001079803.1:c.2418G>A, NM_001079804.1:c.2418G>A, XM_005257193.1:c.2418G>A, XM_005257194.1:c.2418G>AVOUS01/23/2016
365GAAEx17NM_000152.3:c.2423C>Tp.Pro808Leu | p.P808LNM_000152.3:c.2423C>T, NM_001079803.1:c.2423C>T, NM_001079804.1:c.2423C>T, XM_005257193.1:c.2423C>T, XM_005257194.1:c.2423C>TVOUS12/27/2016
366GAAEx17NM_000152.3:c.2427C>Gp.Ala809= | p.A809=NM_000152.3:c.2427C>G, NM_001079803.1:c.2427C>G, NM_001079804.1:c.2427C>G, XM_005257193.1:c.2427C>G, XM_005257194.1:c.2427C>GVOUS08/28/2015
367GAAEx17NM_000152.3:c.2431delCp.Leu811Trpfs*37 | p.L811WfsX37LRG_673t1:c.2431delC, NM_000152.3:c.2431delC, NM_001079803.1:c.2431delC, NM_001079804.1:c.2431delC, XM_005257193.1:c.2431delC, XM_005257194.1:c.2431delCPathogenic11/01/2019 
368GAAEx17NM_000152.3:c.2446G>Ap.Val816Ile | p.V816ILRG_673t1:c.2446G>A, NM_000152.3:c.2446G>A, NM_001079803.1:c.2446G>A, NM_001079804.1:c.2446G>A, XM_005257193.1:c.2446G>A, XM_005257194.1:c.2446G>ABenign09/27/2019 
369GAAEx17NM_000152.3:c.2459_2461delCTGp.Ala820del | p.A820delLRG_673t1:c.2459_2461delCTG, NM_000152.3:c.2459_2461delCTG, NM_001079803.1:c.2459_2461delCTG, NM_001079804.1:c.2459_2461delCTG, XM_005257193.1:c.2459_2461delCTG, XM_005257194.1:c.2459_2461delCTGVOUS09/13/2019
370GAAEx17NM_000152.3:c.2474C>Gp.Pro825Arg | p.P825RNM_000152.3:c.2474C>G, NM_001079803.1:c.2474C>G, NM_001079804.1:c.2474C>G, XM_005257193.1:c.2474C>G, XM_005257194.1:c.2474C>GVOUS08/20/2018
371GAAEx17NM_000152.3:c.2478G>Ap.Leu826= | p.L826=NM_000152.3:c.2478G>A, NM_001079803.1:c.2478G>A, NM_001079804.1:c.2478G>A, XM_005257193.1:c.2478G>A, XM_005257194.1:c.2478G>ALikely benign01/25/2016 
372GAAEx17NM_000152.3:c.2481+16G>ALRG_673t1:c.2481+16G>A, NM_000152.3:c.2481+16G>A, NM_001079803.1:c.2481+16G>A, NM_001079804.1:c.2481+16G>A, XM_005257194.1:c.2481+16G>AVOUS08/30/2016
373GAAEx18NM_000152.3:del 538bp Ex18 (NM_000152.3:c.2481+110_2646+39del)Pathogenic06/20/2019 
374GAAEx18NM_000152.3:c.2501_2502delCAp.Thr834Argfs*49 | p.T834RfsX49LRG_673t1:c.2501_2502delCA, NM_000152.3:c.2501_2502delCA, NM_001079803.1:c.2501_2502delCA, NM_001079804.1:c.2501_2502delCA, XM_005257193.1:c.2501_2502delCA, XM_005257194.1:c.2501_2502delCAPathogenic02/23/2016 
375GAAEx18NM_000152.3:c.2510G>Ap.Arg837His | p.R837HNM_000152.3:c.2510G>A, NM_001079803.1:c.2510G>A, NM_001079804.1:c.2510G>A, XM_005257193.1:c.2510G>A, XM_005257194.1:c.2510G>AVOUS11/22/2016
376GAAEx18NM_000152.3:c.2512C>Tp.Gln838* | p.Q838XLRG_673t1:c.2512C>T, NM_000152.3:c.2512C>T, NM_001079803.1:c.2512C>T, NM_001079804.1:c.2512C>T, XM_005257194.1:c.2512C>TPathogenic06/12/2018 
377GAAEx18NM_000152.3:c.2523G>Cp.Met841Ile | p.M841ILRG_673t1:c.2523G>C, NM_000152.3:c.2523G>C, NM_001079803.1:c.2523G>C, NM_001079804.1:c.2523G>C, XM_005257193.1:c.2523G>C, XM_005257194.1:c.2523G>CVOUS10/05/2016
378GAAEx18NM_000152.3:c.2528T>Cp.Leu843Pro | p.L843PVOUS**
379GAAEx18NM_000152.3:c.2540T>Gp.Leu847Arg | p.L847RLRG_673t1:c.2540T>G, NM_000152.3:c.2540T>G, NM_001079803.1:c.2540T>G, NM_001079804.1:c.2540T>G, XM_005257193.1:c.2540T>G, XM_005257194.1:c.2540T>GVOUS03/09/2017
380GAAEx18NM_000152.3:c.2544delCNM_000152.3:c.2544delC, NM_001079803.1:c.2544delC, NM_001079804.1:c.2544delC, XM_005257193.1:c.2544delC, XM_005257194.1:c.2544delCPathogenic12/14/2015 
381GAAEx18NM_000152.3:c.2553G>Ap.Gly851= | p.G851=LRG_673t1:c.2553G>A, NM_000152.3:c.2553G>A, NM_001079803.1:c.2553G>A, NM_001079804.1:c.2553G>A, XM_005257193.1:c.2553G>A, XM_005257194.1:c.2553G>ABenign07/02/2019 
382GAAEx18NM_000152.3:c.2560C>Tp.Arg854* | p.R854XLRG_673t1:c.2560C>T, NM_000152.3:c.2560C>T, NM_001079803.1:c.2560C>T, NM_001079804.1:c.2560C>T, XM_005257193.1:c.2560C>T, XM_005257194.1:c.2560C>TPathogenic10/04/2018 
383GAAEx18NM_000152.3:c.2561G>Ap.Arg854Gln | p.R854QNM_000152.3:c.2561G>A, NM_001079803.1:c.2561G>A, NM_001079804.1:c.2561G>A, XM_005257193.1:c.2561G>A, XM_005257194.1:c.2561G>ALikely benign03/23/2018 
384GAAEx18NM_000152.3:c.2574dupCNM_000152.3:c.2574_2575insC, NM_000152.3:c.2574dup, NM_001079803.1:c.2574_2575insC, NM_001079803.1:c.2574dup, NM_001079804.1:c.2574_2575insC, NM_001079804.1:c.2574dup, XM_005257193.1:c.2574_2575insC, XM_005257194.1:c.2574_2575insCPathogenic** 
385GAAEx18NM_000152.3:c.2580C>Tp.Asp860= | p.D860=NM_000152.3:c.2580C>T, NM_001079803.1:c.2580C>T, NM_001079804.1:c.2580C>T, XM_005257193.1:c.2580C>T, XM_005257194.1:c.2580C>TBenign07/30/2015 
386GAAEx18NM_000152.3:c.2597A>Tp.Glu866Val | p.E866VLRG_673t1:c.2597A>T, NM_000152.3:c.2597A>T, NM_001079803.1:c.2597A>T, NM_001079804.1:c.2597A>T, XM_005257193.1:c.2597A>T, XM_005257194.1:c.2597A>TVOUS01/10/2019
387GAAEx18NM_000152.3:c.2600_2604delTGCTGinsAp.Val867Glufs*19 | p.V867EfsX19LRG_673t1:c.2600_2604delinsA, NM_000152.3:c.2600_2604delinsA, NM_001079803.1:c.2600_2604delinsA, NM_001079804.1:c.2600_2604delinsA, XM_005257193.1:c.2600_2604delinsA, XM_005257194.1:c.2600_2604delinsAPathogenic05/06/2019 
388GAAEx18NM_000152.3:c.2608C>Tp.Arg870* | p.R870XLRG_673t1:c.2608C>T, NM_000152.3:c.2608C>T, NM_001079803.1:c.2608C>T, NM_001079804.1:c.2608C>T, XM_005257193.1:c.2608C>T, XM_005257194.1:c.2608C>TPathogenic12/03/2019 
389GAAEx18NM_000152.3:c.2646+2T>ALRG_673t1:c.2646+2T>A, NM_000152.3:c.2646+2T>A, NM_001079803.1:c.2646+2T>A, NM_001079804.1:c.2646+2T>A, XM_005257193.1:c.2646+2T>A, XM_005257194.1:c.2646+2T>APathogenic10/30/2018 
390GAAEx19NM_000152.3:c.2647-8C>TNM_000152.3:c.2647-8C>T, NM_001079803.1:c.2647-8C>T, NM_001079804.1:c.2647-8C>T, XM_005257193.1:c.2647-8C>T, XM_005257194.1:c.2647-8C>TLikely benign08/28/2015 
391GAAEx19NM_000152.3:c.2647-6G>ANM_000152.3:c.2647-6G>A, NM_001079803.1:c.2647-6G>A, NM_001079804.1:c.2647-6G>A, XM_005257193.1:c.2647-6G>A, XM_005257194.1:c.2647-6G>AVOUS10/30/2015
392GAAEx19NM_000152.3:c.2647-1_2648delGAAPathogenic11/23/2019 
393GAAEx19NM_000152.3:c.2652G>Ap.Thr884= | p.T884=LRG_673t1:c.2652G>A, NM_000152.3:c.2652G>A, NM_001079803.1:c.2652G>A, NM_001079804.1:c.2652G>A, XM_005257193.1:c.2652G>A, XM_005257194.1:c.2652G>AVOUS09/21/2021
394GAAEx19NM_000152.3:c.2655_2656delCGp.Val886Glufs*2 | p.V886EfsX2LRG_673t1:c.2655_2656delCG, NM_000152.3:c.2655_2656delCG, NM_001079803.1:c.2655_2656delCG, NM_001079804.1:c.2655_2656delCG, XM_005257193.1:c.2655_2656delCG, XM_005257194.1:c.2655_2656delCGPathogenic04/27/2018 
395GAAEx19NM_000152.3:c.2656G>Ap.Val886Met | p.V886MNM_000152.3:c.2656G>A, NM_001079803.1:c.2656G>A, NM_001079804.1:c.2656G>A, XM_005257193.1:c.2656G>A, XM_005257194.1:c.2656G>AVOUS12/09/2015
396GAAEx19NM_000152.3:c.2668G>Cp.Val890Leu | p.V890LNM_000152.3:c.2668G>C, NM_001079803.1:c.2668G>C, NM_001079804.1:c.2668G>C, XM_005257193.1:c.2668G>C, XM_005257194.1:c.2668G>CBenign09/18/2015 
397GAAEx19NM_000152.3:c.2672G>Ap.Arg891His | p.R891HLRG_673t1:c.2672G>A, NM_000152.3:c.2672G>A, NM_001079803.1:c.2672G>A, NM_001079804.1:c.2672G>A, XM_005257193.1:c.2672G>A, XM_005257194.1:c.2672G>AVOUS10/03/2018
398GAAEx19NM_000152.3:c.2706delGp.Lys903Argfs*2 | p.K903RfsX2LRG_673t1:c.2706delG, NM_000152.3:c.2706delG, NM_001079803.1:c.2706delG, NM_001079804.1:c.2706delG, XM_005257193.1:c.2706delG, XM_005257194.1:c.2706delGPathogenic09/17/2019 
399GAAEx19NM_000152.3:c.2712G>Ap.Val904= | p.V904=LRG_673t1:c.2712G>A, NM_000152.3:c.2712G>A, NM_001079803.1:c.2712G>A, NM_001079804.1:c.2712G>A, XM_005257193.1:c.2712G>A, XM_005257194.1:c.2712G>AVOUS06/07/2016
400GAAEx19NM_000152.3:c.2725G>Ap.Val909Met | p.V909MLRG_673t1:c.2725G>A, NM_000152.3:c.2725G>A, NM_001079803.1:c.2725G>A, NM_001079804.1:c.2725G>A, XM_005257193.1:c.2725G>A, XM_005257194.1:c.2725G>AVOUS02/06/2018
401GAAEx19NM_000152.3:c.2736G>Tp.Ala912= | p.A912=LRG_673t1:c.2736G>T, NM_000152.3:c.2736G>T, NM_001079803.1:c.2736G>T, NM_001079804.1:c.2736G>T, XM_005257193.1:c.2736G>T, XM_005257194.1:c.2736G>TVOUS10/19/2018
402GAAEx19NM_000152.3:c.2736G>Ap.Ala912= | p.A912=LRG_673t1:c.2736G>A, NM_000152.3:c.2736G>A, NM_001079803.1:c.2736G>A, NM_001079804.1:c.2736G>A, XM_005257193.1:c.2736G>A, XM_005257194.1:c.2736G>AVOUS10/31/2016
403GAAEx19NM_000152.3:c.2739C>Gp.Pro913= | p.P913=NM_000152.3:c.2739C>G, NM_001079803.1:c.2739C>G, NM_001079804.1:c.2739C>G, XM_005257193.1:c.2739C>G, XM_005257194.1:c.2739C>GVOUS06/03/2015
404GAAEx19NM_000152.3:c.2780C>Tp.Thr927Ile | p.T927ILRG_673t1:c.2780C>T, NM_000152.3:c.2780C>T, NM_001079803.1:c.2780C>T, NM_001079804.1:c.2780C>T, XM_005257194.1:c.2780C>TBenign08/13/2013 
405GAAEx19NM_000152.3:c.2799+4A>GNM_000152.3:c.2799+4A>G, NM_001079803.1:c.2799+4A>G, NM_001079804.1:c.2799+4A>G, XM_005257193.1:c.2799+4A>G, XM_005257194.1:c.2799+4A>GLikely pathogenic06/19/2019 
406GAAEx19NM_000152.3:c.2799+31C>GBenign** 
407GAAEx20NM_000152.3:c.*3G>ALRG_673t1:c.*3G>A, NM_000152.3:c.*3G>A, NM_001079803.1:c.*3G>A, NM_001079804.1:c.*3G>A, XM_005257194.1:c.*3G>ABenign10/23/2019 
408GAAEx20NM_000152.3:c.2800-9_2800-8delCTLRG_673t1:c.2800-9_2800-8delCT, NM_000152.3:c.2800-9_2800-8delCT, NM_001079803.1:c.2800-9_2800-8delCT, NM_001079804.1:c.2800-9_2800-8delCT, XM_005257193.1:c.2800-9_2800-8delCT, XM_005257194.1:c.2800-9_2800-8delCTVOUS03/01/2018
409GAAEx2NM_000152.4:c.-32-13T>GPathogenic06/14/2021 
410GAAEx2NM_000152.4:c.118C>Tp.Arg40* | p.R40XPathogenic11/04/2021 
411GAAEx2NM_000152.4:c.257C>Gp.Pro86Arg | p.P86RLRG_673t1:c.257C>G, NM_000152.3:c.257C>G, NM_001079803.1:c.257C>G, NM_001079804.1:c.257C>G, NM_017950.2:c.*5068C>G, NM_017950.3:c.*5068C>G, XM_005257193.1:c.257C>G, XM_005257194.1:c.257C>G, XM_005257491.1:c.*5068C>GVOUS06/14/2021
412GAAEx2NM_000152.4:c.266G>Ap.Arg89His | p.R89HLRG_673t1:c.266G>A, NM_000152.3:c.266G>A, NM_001079803.1:c.266G>A, NM_001079804.1:c.266G>A, NM_017950.2:c.*5077G>A, NM_017950.3:c.*5077G>A, XM_005257193.1:c.266G>A, XM_005257194.1:c.266G>A, XM_005257491.1:c.*5077G>AVOUS03/04/2020
413GAAEx2NM_000152.4:c.271G>Ap.Asp91Asn | p.D91NLRG_673t1:c.271G>A, NM_000152.3:c.271G>A, NM_001079803.1:c.271G>A, NM_001079804.1:c.271G>A, NM_017950.2:c.*5082G>A, NM_017950.3:c.*5082G>A, XM_005257193.1:c.271G>A, XM_005257194.1:c.271G>A, XM_005257491.1:c.*5082G>AOther Reportable04/29/2020 
414GAAEx2NM_000152.4:c.324T>Cp.Cys108= | p.C108=LRG_673t1:c.324T>C, NM_000152.3:c.324T>C, NM_001079803.1:c.324T>C, NM_001079804.1:c.324T>C, NM_017950.2:c.*5135T>C, NM_017950.3:c.*5135T>C, XM_005257193.1:c.324T>C, XM_005257194.1:c.324T>C, XM_005257491.1:c.*5135T>CBenign06/14/2021 
415GAAEx2NM_000152.4:c.447G>Ap.Thr149= | p.T149=Benign11/04/2021 
416GAAEx2NM_000152.4:c.525delTp.Glu176Argfs*45 | p.E176RfsX45LRG_673t1:c.525delT, NM_000152.3:c.525delT, NM_001079803.1:c.525delT, NM_001079804.1:c.525delT, NM_017950.2:c.*5336delT, NM_017950.3:c.*5336delT, XM_005257193.1:c.525delT, XM_005257194.1:c.525delT, XM_005257491.1:c.*5336delTPathogenic01/25/2021 
417GAAEx2NM_000152.4:c.546G>Cp.Thr182= | p.T182=LRG_673t1:c.546G>C, NM_000152.3:c.546G>C, NM_001079803.1:c.546G>C, NM_001079804.1:c.546G>C, NM_017950.2:c.*5357G>C, NM_017950.3:c.*5357G>C, XM_005257193.1:c.546G>C, XM_005257194.1:c.546G>C, XM_005257491.1:c.*5357G>CPathogenic09/13/2021 
418GAAEx2NM_000152.4:c.546G>Tp.Thr182= | p.T182=Pathogenic11/04/2021 
419GAAEx3NM_000152.4:c.547-4C>GBenign06/14/2021 
420GAAEx3NM_000152.4:c.596A>Gp.His199Arg | p.H199RLRG_673t1:c.596A>G, NM_000152.3:c.596A>G, NM_001079803.1:c.596A>G, NM_001079804.1:c.596A>G, XM_005257193.1:c.596A>G, XM_005257194.1:c.596A>GBenign10/29/2020 
421GAAEx3NM_000152.4:c.642C>Tp.Ser214= | p.S214=LRG_673t1:c.642C>T, NM_000152.3:c.642C>T, NM_001079803.1:c.642C>T, NM_001079804.1:c.642C>T, XM_005257193.1:c.642C>T, XM_005257194.1:c.642C>TBenign02/21/2020 
422GAAEx3NM_000152.4:c.668G>Ap.Arg223His | p.R223HLRG_673t1:c.668G>A, NM_000152.3:c.668G>A, NM_001079803.1:c.668G>A, NM_001079804.1:c.668G>A, XM_005257193.1:c.668G>A, XM_005257194.1:c.668G>ABenign10/29/2020 
423GAAEx4NM_000152.4:c.749C>Tp.Thr250Ile | p.T250ILRG_673t1:c.749C>T, NM_000152.3:c.749C>T, NM_001079803.1:c.749C>T, NM_001079804.1:c.749C>T, XM_005257193.1:c.749C>T, XM_005257194.1:c.749C>TVOUS07/07/2021
424GAAEx4NM_000152.4:c.853C>Tp.Pro285Ser | p.P285SLRG_673t1:c.853C>T, NM_000152.3:c.853C>T, NM_001079803.1:c.853C>T, NM_001079804.1:c.853C>T, XM_005257193.1:c.853C>T, XM_005257194.1:c.853C>TPathogenic06/04/2020 
425GAAEx4NM_000152.4:c.858+7_858+8insAGCGGGCBenign10/29/2020 
426GAAEx5NM_000152.4:c.921A>Tp.Ala307= | p.A307=LRG_673t1:c.921A>T, NM_000152.3:c.921A>T, NM_001079803.1:c.921A>T, NM_001079804.1:c.921A>T, XM_005257193.1:c.921A>T, XM_005257194.1:c.921A>TBenign06/04/2020 
427GAAEx5NM_000152.4:c.925G>Ap.Gly309Arg | p.G309RLRG_673t1:c.925G>A, NM_000152.3:c.925G>A, NM_001079803.1:c.925G>A, NM_001079804.1:c.925G>A, XM_005257193.1:c.925G>A, XM_005257194.1:c.925G>APathogenic11/16/2020 
428GAAEx5NM_000152.4:c.955+12G>ABenign10/29/2020 
429GAAEx7NM_000152.4:c.1082C>Tp.Pro361Leu | p.P361LLRG_673t1:c.1082C>T, NM_000152.3:c.1082C>T, NM_001079803.1:c.1082C>T, NM_001079804.1:c.1082C>T, XM_005257193.1:c.1082C>T, XM_005257194.1:c.1082C>TPathogenic07/16/2019 
430GAAEx8NM_000152.4:c.1203G>Ap.Gln401= | p.Q401=LRG_673t1:c.1203G>A, NM_000152.3:c.1203G>A, NM_001079803.1:c.1203G>A, NM_001079804.1:c.1203G>A, XM_005257193.1:c.1203G>A, XM_005257194.1:c.1203G>ABenign10/29/2020 
431GAAEx8NM_000152.4:c.1309C>Tp.Arg437Cys | p.R437CLRG_673t1:c.1309C>T, NM_000152.3:c.1309C>T, NM_001079803.1:c.1309C>T, NM_001079804.1:c.1309C>T, XM_005257193.1:c.1309C>T, XM_005257194.1:c.1309C>TPathogenic06/14/2021 
432GAAEx8NM_000152.4:c.1316T>Ap.Met439Lys | p.M439KLRG_673t1:c.1316T>A, NM_000152.3:c.1316T>A, NM_001079803.1:c.1316T>A, NM_001079804.1:c.1316T>A, XM_005257193.1:c.1316T>A, XM_005257194.1:c.1316T>APathogenic07/07/2021 
433GAAEx9NM_000152.4:c.1327-18A>GBenign10/29/2020 
434GAAEx9NM_000152.4:c.1374C>Tp.Tyr458= | p.Y458=LRG_673t1:c.1374C>T, NM_000152.3:c.1374C>T, NM_001079803.1:c.1374C>T, NM_001079804.1:c.1374C>T, XM_005257193.1:c.1374C>T, XM_005257194.1:c.1374C>TBenign06/04/2020 
435GAAEx10NM_000152.4:c.1438-19G>CBenign10/29/2020 
436GAAEx10NM_000152.4:c.1447G>Ap.Gly483Arg | p.G483RLRG_673t1:c.1447G>A, NM_000152.3:c.1447G>A, NM_001079803.1:c.1447G>A, NM_001079804.1:c.1447G>A, XM_005257193.1:c.1447G>A, XM_005257194.1:c.1447G>AVOUS11/03/2020
437GAAEx10NM_000152.4:c.1540G>Ap.Gly514Ser | p.G514SLRG_673t1:c.1540G>A, NM_000152.3:c.1540G>A, NM_001079803.1:c.1540G>A, NM_001079804.1:c.1540G>A, XM_005257193.1:c.1540G>A, XM_005257194.1:c.1540G>AVOUS03/31/2020
438GAAEx11NM_000152.4:c.1581G>Ap.Arg527= | p.R527=LRG_673t1:c.1581G>A, NM_000152.3:c.1581G>A, NM_001079803.1:c.1581G>A, NM_001079804.1:c.1581G>A, XM_005257193.1:c.1581G>A, XM_005257194.1:c.1581G>ABenign03/04/2020 
439GAAEx12NM_000152.4:c.1726G>Ap.Gly576Ser | p.G576SLRG_673t1:c.1726G>A, NM_000152.3:c.1726G>A, NM_001079803.1:c.1726G>A, NM_001079804.1:c.1726G>A, XM_005257193.1:c.1726G>A, XM_005257194.1:c.1726G>AOther Reportable07/07/2021 
440GAAEx13NM_000152.4:c.1841C>Ap.Thr614Lys | p.T614KPathogenic10/20/2021 
441GAAEx13NM_000152.4:c.1857C>Gp.Ser619Arg | p.S619RLRG_673t1:c.1857C>G, NM_000152.3:c.1857C>G, NM_001079803.1:c.1857C>G, NM_001079804.1:c.1857C>G, XM_005257193.1:c.1857C>G, XM_005257194.1:c.1857C>GPathogenic07/21/2021 
442GAAEx14NM_000152.4:c.1935C>Ap.Asp645Glu | p.D645ELRG_673t1:c.1935C>A, NM_000152.3:c.1935C>A, NM_001079803.1:c.1935C>A, NM_001079804.1:c.1935C>A, XM_005257193.1:c.1935C>A, XM_005257194.1:c.1935C>APathogenic03/10/2020 
443GAAEx14NM_000152.4:c.1979G>Ap.Arg660His | p.R660HPathogenic01/05/2022 
444GAAEx14NM_000152.4:c.2040+20A>GBenign12/26/2019 
445GAAEx15NM_000152.4:c.2065G>Ap.Glu689Lys | p.E689KLRG_673t1:c.2065G>A, NM_000152.3:c.2065G>A, NM_001079803.1:c.2065G>A, NM_001079804.1:c.2065G>A, XM_005257193.1:c.2065G>A, XM_005257194.1:c.2065G>AOther Reportable07/07/2021 
446GAAEx15NM_000152.4:c.2133A>Gp.Thr711= | p.T711=LRG_673t1:c.2133A>G, NM_000152.3:c.2133A>G, NM_001079803.1:c.2133A>G, NM_001079804.1:c.2133A>G, XM_005257193.1:c.2133A>G, XM_005257194.1:c.2133A>GBenign02/21/2020 
447GAAEx15NM_000152.4:c.2173C>Tp.Arg725Trp | p.R725WLRG_673t1:c.2173C>T, NM_000152.3:c.2173C>T, NM_001079803.1:c.2173C>T, NM_001079804.1:c.2173C>T, XM_005257193.1:c.2173C>T, XM_005257194.1:c.2173C>TPathogenic12/01/2020 
448GAAEx15NM_000152.4:c.2177C>Gp.Pro726Arg | p.P726RLRG_673t1:c.2177C>G, NM_000152.3:c.2177C>G, NM_001079803.1:c.2177C>G, NM_001079804.1:c.2177C>G, XM_005257193.1:c.2177C>G, XM_005257194.1:c.2177C>GVOUS06/14/2021
449GAAEx16NM_000152.4:c.2237G>Ap.Trp746* | p.W746XLRG_673t1:c.2237G>A, NM_000152.3:c.2237G>A, NM_001079803.1:c.2237G>A, NM_001079804.1:c.2237G>A, XM_005257193.1:c.2237G>A, XM_005257194.1:c.2237G>APathogenic06/04/2020 
450GAAEx16NM_000152.4:c.2238G>Cp.Trp746Cys | p.W746CLRG_673t1:c.2238G>C, NM_000152.3:c.2238G>C, NM_001079803.1:c.2238G>C, NM_001079804.1:c.2238G>C, XM_005257193.1:c.2238G>C, XM_005257194.1:c.2238G>CPathogenic03/10/2020 
451GAAEx16NM_000152.4:c.2238G>Ap.Trp746* | p.W746XLRG_673t1:c.2238G>A, NM_000152.3:c.2238G>A, NM_001079803.1:c.2238G>A, NM_001079804.1:c.2238G>A, XM_005257193.1:c.2238G>A, XM_005257194.1:c.2238G>APathogenic01/07/2020 
452GAAEx16NM_000152.4:c.2331+20G>ABenign12/26/2019 
453GAAEx17NM_000152.4:c.2338G>Ap.Val780Ile | p.V780ILRG_673t1:c.2338G>A, NM_000152.3:c.2338G>A, NM_001079803.1:c.2338G>A, NM_001079804.1:c.2338G>A, XM_005257193.1:c.2338G>A, XM_005257194.1:c.2338G>ABenign12/26/2019 
454GAAEx17NM_000152.4:c.2400C>Tp.Ser800= | p.S800=LRG_673t1:c.2400C>T, NM_000152.3:c.2400C>T, NM_001079803.1:c.2400C>T, NM_001079804.1:c.2400C>T, XM_005257193.1:c.2400C>T, XM_005257194.1:c.2400C>TBenign11/03/2020 
455GAAEx17NM_000152.4:c.2431delCp.Leu811Trpfs*37 | p.L811WfsX37LRG_673t1:c.2431delC, NM_000152.3:c.2431delC, NM_001079803.1:c.2431delC, NM_001079804.1:c.2431delC, XM_005257193.1:c.2431delC, XM_005257194.1:c.2431delCPathogenic02/02/2021 
456GAAEx17NM_000152.4:c.2446G>Ap.Val816Ile | p.V816ILRG_673t1:c.2446G>A, NM_000152.3:c.2446G>A, NM_001079803.1:c.2446G>A, NM_001079804.1:c.2446G>A, XM_005257193.1:c.2446G>A, XM_005257194.1:c.2446G>ABenign03/10/2020 
457GAAEx18NM_000152.4:c.2501_2502delCAPathogenic12/01/2021 
458GAAEx18NM_000152.4:c.2553G>Ap.Gly851= | p.G851=LRG_673t1:c.2553G>A, NM_000152.3:c.2553G>A, NM_001079803.1:c.2553G>A, NM_001079804.1:c.2553G>A, XM_005257193.1:c.2553G>A, XM_005257194.1:c.2553G>ABenign12/26/2019 
459GAAEx18NM_000152.4:c.2560C>Tp.Arg854* | p.R854XLRG_673t1:c.2560C>T, NM_000152.3:c.2560C>T, NM_001079803.1:c.2560C>T, NM_001079804.1:c.2560C>T, XM_005257193.1:c.2560C>T, XM_005257194.1:c.2560C>TPathogenic12/15/2020 
460GAAEx19NM_000152.4:c.2705A>Gp.Gln902Arg | p.Q902RLRG_673t1:c.2705A>G, NM_000152.3:c.2705A>G, NM_001079803.1:c.2705A>G, NM_001079804.1:c.2705A>G, XM_005257193.1:c.2705A>G, XM_005257194.1:c.2705A>GVOUS06/04/2020

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.