Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1EMDEx1NM_000117.2:c.3G>Ap.Met1? | p.M1?NM_000117.2:c.3G>A, NM_001110556.1:c.-5090C>T, NM_001456.3:c.-5090C>T, XM_002343860.1:c.*4961G>APathogenic06/26/2015 
2EMDEx1NM_000117.2:c.-7A>CNM_000117.2:c.-7A>C, NM_001110556.1:c.-5081T>G, NM_001456.3:c.-5081T>G, XM_002343860.1:c.*4952A>CVOUS01/24/2017
3EMDEx1NM_000117.2:c.12C>Tp.Tyr4= | p.Y4=LRG_745t1:c.12C>T, NM_000117.2:c.12C>T, NM_001110556.1:c.-5099G>A, NM_001456.3:c.-5099G>A, XM_002343860.1:c.*4970C>TVOUS12/19/2016
4EMDEx1NM_000117.2:c.82+4C>ANM_000117.2:c.82+4C>A, NM_001110556.1:c.-5173G>T, NM_001456.3:c.-5173G>T, XM_002343860.1:c.*5044C>AVOUS09/10/2015
5EMDEx2NM_000117.2:c.115_117delTTCp.Phe39del | p.F39delLRG_745t1:c.115_117delTTC, NM_000117.2:c.115_117delTTCVOUS07/07/2017
6EMDEx2NM_000117.2:c.130C>Tp.Gln44* | p.Q44XNM_000117.2:c.130C>TPathogenic09/10/2013 
7EMDEx2NM_000117.2:c.144C>Tp.Leu48= | p.L48=NM_000117.2:c.144C>TBenign09/03/2014 
8EMDEx2NM_000117.2:c.144C>Gp.Leu48= | p.L48=LRG_745t1:c.144C>G, NM_000117.2:c.144C>GVOUS03/07/2017
9EMDEx2NM_000117.2:c.149C>Ap.Pro50His | p.P50HNM_000117.2:c.149C>AVOUS12/08/2015
10EMDEx2NM_000117.2:c.168C>Tp.Ala56= | p.A56=LRG_745t1:c.168C>T, NM_000117.2:c.168C>TVOUS03/23/2017
11EMDEx2NM_000117.2:c.171C>Tp.Ser57= | p.S57=LRG_745t1:c.171C>T, NM_000117.2:c.171C>TVOUS10/03/2016
12EMDEx3NM_000117.2:c.215A>Tp.Asp72Val | p.D72VLRG_745t1:c.215A>T, NM_000117.2:c.215A>TVOUS12/06/2016
13EMDEx3NM_000117.2:c.239_240insTNM_000117.2:c.239_240insTPathogenic09/11/2013 
14EMDEx3NM_000117.2:c.243C>Tp.Asp81= | p.D81=LRG_745t1:c.243C>T, NM_000117.2:c.243C>TVOUS02/28/2017
15EMDEx3NM_000117.2:c.251_255delTCTACLRG_745t1:c.251_255delTCTAC, NM_000117.2:c.251_255delTCTACPathogenic07/25/2016 
16EMDEx4NM_000117.2:c.266-2A>GLRG_745t1:c.266-2A>G, NM_000117.2:c.266-2A>GPathogenic05/07/2018 
17EMDEx4NM_000117.2:c.272A>Gp.Asn91Ser | p.N91SLRG_745t1:c.272A>G, NM_000117.2:c.272A>GLikely benign04/07/2017 
18EMDEx4NM_000117.2:c.284_298delATGAAGAGAGCTACTNM_000117.2:c.284_298delATGAAGAGAGCTACTLikely pathogenic05/27/2015 
19EMDEx4NM_000117.2:c.295T>Cp.Tyr99His | p.Y99HLRG_745t1:c.295T>C, NM_000117.2:c.295T>CVOUS08/29/2016
20EMDEx4NM_000117.2:c.355C>Tp.Gln119* | p.Q119XPathogenic01/17/2013 
21EMDEx4NM_000117.2:c.355C>Ap.Gln119Lys | p.Q119KLRG_745t1:c.355C>A, NM_000117.2:c.355C>AVOUS05/05/2017
22EMDEx4NM_000117.2:c.385G>Ap.Ala129Thr | p.A129TLRG_745t1:c.385G>A, NM_000117.2:c.385G>AVOUS09/03/2016
23EMDEx4NM_000117.2:c.396C>Tp.His132= | p.H132=LRG_745t1:c.396C>T, NM_000117.2:c.396C>TBenign10/05/2016 
24EMDEx5NM_000117.2:c.400-9C>TLRG_745t1:c.400-9C>T, NM_000117.2:c.400-9C>TVOUS01/03/2017
25EMDEx5NM_000117.2:c.408T>Cp.Asp136= | p.D136=LRG_745t1:c.408T>C, NM_000117.2:c.408T>CVOUS09/22/2017
26EMDEx5NM_000117.2:c.423T>Gp.Ser141= | p.S141=LRG_745t1:c.423T>G, NM_000117.2:c.423T>GVOUS10/11/2016
27EMDEx5NM_000117.2:c.428C>Tp.Ser143Phe | p.S143FLRG_745t1:c.428C>T, NM_000117.2:c.428C>TVOUS01/22/2016
28EMDEx5NM_000117.2:c.430G>Tp.Glu144* | p.E144XLRG_745t1:c.430G>T, NM_000117.2:c.430G>TPathogenic03/03/2017 
29EMDEx5NM_000117.2:c.445G>Cp.Asp149His | p.D149HLRG_745t1:c.445G>C, NM_000117.2:c.445G>CBenign05/05/2017 
30EMDEx5NM_000117.2:c.449+4C>TLRG_745t1:c.449+4C>T, NM_000117.2:c.449+4C>TVOUS09/21/2015
31EMDEx5NM_000117.2:c.449+4C>GLRG_745t1:c.449+4C>G, NM_000117.2:c.449+4C>GVOUS03/23/2017
32EMDEx5NM_000117.2:c.449+10G>CLRG_745t1:c.449+10G>C, NM_000117.2:c.449+10G>CVOUS07/14/2015
33EMDEx6NM_000117.2:c.450-2A>GLRG_745t1:c.450-2A>G, NM_000117.2:c.450-2A>GPathogenic11/12/2013 
34EMDEx6NM_000117.2:c.454C>Tp.Arg152Cys | p.R152CLRG_745t1:c.454C>T, NM_000117.2:c.454C>TVOUS10/10/2017
35EMDEx6NM_000117.2:c.460A>Gp.Met154Val | p.M154VLRG_745t1:c.460A>G, NM_000117.2:c.460A>GVOUS09/19/2016
36EMDEx6NM_000117.2:c.465C>Tp.Tyr155= | p.Y155=LRG_745t1:c.465C>T, NM_000117.2:c.465C>TBenign01/26/2016 
37EMDEx6NM_000117.2:c.466G>Ap.Gly156Ser | p.G156SNM_000117.2:c.466G>ALikely benign12/08/2015 
38EMDEx6NM_000117.2:c.466G>Cp.Gly156Arg | p.G156RLRG_745t1:c.466G>C, NM_000117.2:c.466G>CVOUS08/08/2016
39EMDEx6NM_000117.2:c.468_471delCCGGp.Arg157Thrfs*79 | p.R157TfsX79LRG_745t1:c.468_471delCCGG, NM_000117.2:c.468_471delCCGGPathogenic11/24/2017 
40EMDEx6NM_000117.2:c.484C>Tp.Gln162* | p.Q162XLRG_745t1:c.484C>T, NM_000117.2:c.484C>TPathogenic12/29/2016 
41EMDEx6NM_000117.2:c.495G>Tp.Thr165= | p.T165=LRG_745t1:c.495G>T, NM_000117.2:c.495G>TVOUS10/31/2016
42EMDEx6NM_000117.2:c.495G>Ap.Thr165= | p.T165=LRG_745t1:c.495G>A, NM_000117.2:c.495G>ALikely benign08/25/2017 
43EMDEx6NM_000117.2:c.502C>Tp.Arg168Cys | p.R168CNM_000117.2:c.502C>TVOUS12/04/2015
44EMDEx6NM_000117.2:c.512C>Ap.Ser171* | p.S171XLRG_745t1:c.512C>A, NM_000117.2:c.512C>APathogenic09/23/2016 
45EMDEx6NM_000117.2:c.525C>Tp.Ser175= | p.S175=LRG_745t1:c.525C>T, NM_000117.2:c.525C>TVOUS12/21/2015
46EMDEx6NM_000117.2:c.537G>Ap.Leu179= | p.L179=LRG_745t1:c.537G>A, NM_000117.2:c.537G>AVOUS01/03/2017
47EMDEx6NM_000117.2:c.548C>Tp.Pro183Leu | p.P183LNM_000117.2:c.548C>TVOUS02/02/2016
48EMDEx6NM_000117.2:c.549T>Cp.Pro183= | p.P183=NM_000117.2:c.549T>CVOUS02/09/2016
49EMDEx6NM_000117.2:c.562A>Cp.Thr188Pro | p.T188PLRG_745t1:c.562A>C, NM_000117.2:c.562A>CVOUS03/28/2017
50EMDEx6NM_000117.2:c.610C>Gp.Arg204Gly | p.R204GLRG_745t1:c.610C>G, NM_000117.2:c.610C>GVOUS03/03/2016
51EMDEx6NM_000117.2:c.618C>Tp.Ile206= | p.I206=LRG_745t1:c.618C>T, NM_000117.2:c.618C>TLikely benign11/01/2018 
52EMDEx6NM_000117.2:c.646G>Ap.Gly216Arg | p.G216RLRG_745t1:c.646G>A, NM_000117.2:c.646G>AVOUS04/16/2018
53EMDEx6NM_000117.2:c.662G>Tp.Arg221Leu | p.R221LNM_000117.2:c.662G>TVOUS07/28/2015
54EMDEx6NM_000117.2:c.704T>Cp.Phe235Ser | p.F235SLRG_745t1:c.704T>C, NM_000117.2:c.704T>CVOUS08/02/2018
55LEMD3Ex1NM_014319.4:c.13G>Ap.Ala5Thr | p.A5TNM_001167614.1:c.13G>A, NM_014319.3:c.13G>A, NM_014319.4:c.13G>AVOUS12/08/2015
56LEMD3Ex1NM_014319.4:c.240_263delACCAGCGGCGGCGGCGGCCGCGGGp.Pro81_Gly88del | p.P81_G88delNM_001167614.1:c.240_263delACCAGCGGCGGCGGCGGCCGCGGG, NM_014319.3:c.240_263delACCAGCGGCGGCGGCGGCCGCGGG, NM_014319.4:c.240_263delACCAGCGGCGGCGGCGGCCGCGGGLikely benign10/06/2017 
57LEMD3Ex1NM_014319.4:c.282C>Gp.Val94= | p.V94=NM_001167614.1:c.282C>G, NM_014319.3:c.282C>G, NM_014319.4:c.282C>GVOUS08/30/2016
58LEMD3Ex1NM_014319.4:c.292C>Tp.Leu98Phe | p.L98FNM_001167614.1:c.292C>T, NM_014319.3:c.292C>T, NM_014319.4:c.292C>TVOUS11/18/2015
59LEMD3Ex1NM_014319.4:c.336C>Tp.Ala112= | p.A112=NM_001167614.1:c.336C>T, NM_014319.3:c.336C>T, NM_014319.4:c.336C>TBenign10/06/2016 
60LEMD3Ex1NM_014319.4:c.636G>Ap.Gly212= | p.G212=NM_001167614.1:c.636G>A, NM_014319.3:c.636G>A, NM_014319.4:c.636G>AVOUS10/03/2016
61LEMD3Ex1NM_014319.4:c.862C>Gp.Arg288Gly | p.R288GNM_001167614.1:c.862C>G, NM_014319.3:c.862C>G, NM_014319.4:c.862C>GVOUS07/28/2015
62LEMD3Ex1NM_014319.4:c.887C>Gp.Pro296Arg | p.P296RNM_001167614.1:c.887C>G, NM_014319.3:c.887C>G, NM_014319.4:c.887C>GVOUS05/22/2018
63LEMD3Ex1NM_014319.4:c.907G>Tp.Gly303Cys | p.G303CNM_001167614.1:c.907G>T, NM_014319.3:c.907G>T, NM_014319.4:c.907G>TLikely benign09/08/2017 
64LEMD3Ex1NM_014319.4:c.1330C>Gp.Pro444Ala | p.P444ANM_001167614.1:c.1330C>G, NM_014319.3:c.1330C>G, NM_014319.4:c.1330C>GVOUS07/03/2018
65LEMD3Ex2NM_014319.4:c.1560+10C>TNM_001167614.1:c.1557+10C>T, NM_014319.3:c.1560+10C>T, NM_014319.4:c.1560+10C>TBenign10/30/2015 
66LEMD3Ex5NM_014319.4:c.1746C>Tp.Ile582= | p.I582=NM_001167614.1:c.1743C>T, NM_014319.3:c.1746C>T, NM_014319.4:c.1746C>TLikely benign04/06/2016 
67LEMD3Ex10NM_014319.4:c.2331A>Cp.Ser777= | p.S777=NM_001167614.1:c.2328A>C, NM_014319.3:c.2331A>C, NM_014319.4:c.2331A>CLikely benign06/23/2017 
68LEMD3Ex11NM_014319.4:c.2388-7C>TNM_001167614.1:c.2385-7C>T, NM_014319.3:c.2388-7C>T, NM_014319.4:c.2388-7C>TBenign07/28/2016 
69LEMD3Ex12NM_014319.4:c.2494-9A>GNM_001167614.1:c.2491-9A>G, NM_014319.3:c.2494-9A>G, NM_014319.4:c.2494-9A>GVOUS11/18/2015

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.