Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1DMDEx1NM_004006.2:c.-5T>CLRG_199t1:c.-5T>C, NM_000109.2:c.7+127942T>C, NM_000109.3:c.7+127942T>C, NM_004006.1:c.-5T>C, NM_004006.2:c.-5T>CVOUS05/05/2015
2DMDEx1NM_004006.2:c.-8T>ALRG_199t1:c.-8T>A, NM_000109.2:c.7+127939T>A, NM_000109.3:c.7+127939T>A, NM_004006.1:c.-8T>A, NM_004006.2:c.-8T>ABenign01/25/2016 
3DMDEx1NM_004006.2:c.9G>Ap.Trp3* | p.W3XLRG_199t1:c.9G>A, NM_000109.2:c.7+127955G>A, NM_000109.3:c.7+127955G>A, NM_004006.1:c.9G>A, NM_004006.2:c.9G>APathogenic04/25/2017 
4DMDEx1NM_004006.2:c.14_15delAAinsTp.Glu5Valfs*3 | p.E5VfsX3LRG_199t1:c.14_15delinsT, NM_000109.2:c.7+127960_7+127961delinsT, NM_000109.3:c.7+127960_7+127961delinsT, NM_004006.1:c.14_15delinsT, NM_004006.2:c.14_15delinsTPathogenic04/06/2015 
5DMDEx1NM_004006.2:c.28delTp.Cys10Valfs*16 | p.C10VfsX16LRG_199t1:c.28delT, NM_000109.2:c.7+127974delT, NM_000109.3:c.7+127974delT, NM_004006.1:c.28delT, NM_004006.2:c.28delTPathogenic08/28/2012 
6DMDEx1NM_004006.2:c.-29dupTLRG_199t1:c.-29dupT, NM_000109.2:c.7+127917_7+127918insT, NM_000109.2:c.7+127918_7+127919insT, NM_000109.2:c.7+127918dupT, NM_000109.3:c.7+127917_7+127918insT, NM_000109.3:c.7+127918_7+127919insT, NM_000109.3:c.7+127918dupT, NM_004006.1:c.-29_-28insT, NM_004006.1:c.-29dupT, NM_004006.1:c.-30_-29insT, NM_004006.2:c.-29_-28insT, NM_004006.2:c.-29dupT, NM_004006.2:c.-30_-29insTVOUS10/23/2018
7DMDEx1NM_004006.2:c.29G>Cp.Cys10Ser | p.C10SLRG_199t1:c.29G>C, NM_000109.2:c.7+127975G>C, NM_000109.3:c.7+127975G>C, NM_004006.1:c.29G>C, NM_004006.2:c.29G>CVOUS05/05/2015
8DMDEx1NM_004006.2:c.31+1G>TLRG_199t1:c.31+1G>T, NM_000109.2:c.7+127978G>T, NM_000109.3:c.7+127978G>T, NM_004006.1:c.31+1G>T, NM_004006.2:c.31+1G>TPathogenic03/01/2018 
9DMDEx1NM_004006.2:c.31+10A>GLRG_199t1:c.31+10A>G, NM_000109.2:c.7+127987A>G, NM_000109.3:c.7+127987A>G, NM_004006.1:c.31+10A>G, NM_004006.2:c.31+10A>GVOUS10/17/2016
10DMDEx1NM_004006.2:c.31+23T>CLRG_199t1:c.31+23T>C, NM_000109.2:c.7+128000T>C, NM_000109.3:c.7+128000T>C, NM_004006.1:c.31+23T>C, NM_004006.2:c.31+23T>CVOUS02/01/2018
11DMDEx1NM_004006.2:c.31+34G>TLRG_199t1:c.31+34G>T, NM_000109.2:c.7+128011G>T, NM_000109.3:c.7+128011G>T, NM_004006.1:c.31+34G>T, NM_004006.2:c.31+34G>TVOUS04/21/2016
12DMDEx1NM_004006.2:c.31+37G>TLRG_199t1:c.31+37G>T, NM_000109.2:c.7+128014G>T, NM_000109.3:c.7+128014G>T, NM_004006.1:c.31+37G>T, NM_004006.2:c.31+37G>TVOUS05/09/2017
13DMDEx1NM_004006.2:c.31+61C>GLRG_199t1:c.31+61C>G, NM_000109.2:c.7+128038C>G, NM_000109.3:c.7+128038C>G, NM_004006.1:c.31+61C>G, NM_004006.2:c.31+61C>GVOUS03/13/2018
14DMDEx1NM_004006.2:c.31+68A>GIVS1+68A>G, LRG_199t1:c.31+68A>G, NM_000109.2:c.7+128045A>G, NM_000109.3:c.7+128045A>G, NM_004006.1:c.31+68A>G, NM_004006.2:c.31+68A>GVOUS05/16/2018
15DMDEx1NM_004006.2:c.31+98T>CLRG_199t1:c.31+98T>C, NM_000109.2:c.7+128075T>C, NM_000109.3:c.7+128075T>C, NM_004006.1:c.31+98T>C, NM_004006.2:c.31+98T>CVOUS01/04/2017
16DMDEx1NM_004006.2:c.31+114A>TNM_000109.2:c.7+128091A>T, NM_000109.3:c.7+128091A>T, NM_004006.1:c.31+114A>T, NM_004006.2:c.31+114A>TVOUS01/22/2016
17DMDEx1NM_004006.2:c.31+142_31+143dupATLRG_199t1:c.31+143_31+144insAT, NM_000109.2:c.7+128120_7+128121insAT, NM_000109.3:c.7+128120_7+128121insAT, NM_004006.1:c.31+143_31+144insAT, NM_004006.2:c.31+143_31+144insATVOUS06/03/2016
18DMDEx1NM_004006.2:c.31+194delALRG_199t1:c.31+194delA, NM_000109.2:c.7+128171delA, NM_000109.3:c.7+128171delA, NM_004006.1:c.31+194delA, NM_004006.2:c.31+194delAVOUS11/01/2016
19DMDEx1NM_004006.2:c.31+201G>TLRG_199t1:c.31+201G>T, NM_000109.2:c.7+128178G>T, NM_000109.3:c.7+128178G>T, NM_004006.1:c.31+201G>T, NM_004006.2:c.31+201G>TVOUS01/24/2018
20DMDEx1NM_004006.2:c.31+218C>TLRG_199t1:c.31+218C>T, NM_000109.2:c.7+128195C>T, NM_000109.3:c.7+128195C>T, NM_004006.1:c.31+218C>T, NM_004006.2:c.31+218C>TVOUS06/14/2016
21DMDEx1NM_004006.2:c.31+229A>CLRG_199t1:c.31+229A>C, NM_000109.2:c.7+128206A>C, NM_000109.3:c.7+128206A>C, NM_004006.1:c.31+229A>C, NM_004006.2:c.31+229A>CVOUS06/09/2016
22DMDEx1NM_004006.2:c.31+233C>TLRG_199t1:c.31+233C>T, NM_000109.2:c.7+128210C>T, NM_000109.3:c.7+128210C>T, NM_004006.1:c.31+233C>T, NM_004006.2:c.31+233C>TVOUS06/09/2016
23DMDEx1NM_004006.2:c.31+256A>GLRG_199t1:c.31+256A>G, NM_000109.2:c.7+128233A>G, NM_000109.3:c.7+128233A>G, NM_004006.1:c.31+256A>G, NM_004006.2:c.31+256A>GVOUS06/27/2018
24DMDEx1NM_004006.2:c.31+265A>TLRG_199t1:c.31+265A>T, NM_000109.2:c.7+128242A>T, NM_000109.3:c.7+128242A>T, NM_004006.1:c.31+265A>T, NM_004006.2:c.31+265A>TVOUS06/14/2016
25DMDEx1NM_004006.2:c.31+292A>Cc.31+292A>C (IVS1+292A>C), LRG_199t1:c.31+292A>C, NM_000109.2:c.7+128269A>C, NM_000109.3:c.7+128269A>C, NM_004006.1:c.31+292A>C, NM_004006.2:c.31+292A>CBenign02/17/2016 
26DMDEx1NM_004006.2:c.31+319G>CLRG_199t1:c.31+319G>C, NM_000109.2:c.7+128296G>C, NM_000109.3:c.7+128296G>C, NM_004006.1:c.31+319G>C, NM_004006.2:c.31+319G>CVOUS02/01/2018
27DMDEx1NM_004006.2:c.31+36946C>TNM_000109.2:c.8-154136C>T, NM_000109.3:c.8-154136C>T, NM_004006.1:c.31+36946C>T, NM_004006.2:c.31+36946C>TBenign09/25/2013 
28DMDEx1NM_004006.2:c.31+36947G>ALRG_199t1:c.31+36947G>A, NM_000109.2:c.8-154135G>A, NM_000109.3:c.8-154135G>A, NM_004006.1:c.31+36947G>A, NM_004006.2:c.31+36947G>APathogenic03/22/2018 
29DMDEx1NM_004006.2:c.31+36949C>TLRG_199t1:c.31+36949C>T, NM_000109.2:c.8-154133C>T, NM_000109.3:c.8-154133C>T, NM_004006.1:c.31+36949C>T, NM_004006.2:c.31+36949C>TVOUS07/01/2014
30DMDEx1NM_004006.2:c.31+37111T>GVOUS**
31DMDEx1NM_004006.2:c.31+37120T>AVOUS**
32DMDEx1NM_004006.2:c.31+82537C>TVOUS**
33DMDEx1NM_004006.2:c.31+82538G>TBenign** 
34DMDEx1NM_004006.2:c.31+82538G>ABenign** 
35DMDEx1NM_004006.2:c.31+82639G>AVOUS**
36DMDEx1NM_004006.2:c.31+82690G>TLRG_199t1:c.31+82690G>T, NM_000109.2:c.8-108392G>T, NM_000109.3:c.8-108392G>T, NM_004006.1:c.31+82690G>T, NM_004006.2:c.31+82690G>T, NM_004009.2:c.-427G>T, NM_004009.3:c.-427G>T, NM_004010.2:c.-868G>T, NM_004010.3:c.-868G>TVOUS**
37DMDEx1NM_004006.2:c.31+82743G>ABenign** 
38DMDEx1NM_004006.2:c.31+82758A>GVOUS**
39DMDEx1NM_004006.2:c.31+82898C>TBenign** 
40DMDEx1NM_004006.2:c.31+82921G>AVOUS**
41DMDEx1NM_004006.2:c.31+82961G>AVOUS**
42DMDEx1NM_004006.2:c.31+83052C>TLRG_199t1:c.31+83052C>T, NM_000109.2:c.8-108030C>T, NM_000109.3:c.8-108030C>T, NM_004006.1:c.31+83052C>T, NM_004006.2:c.31+83052C>T, NM_004009.2:c.-65C>T, NM_004009.3:c.-65C>T, NM_004010.2:c.-506C>T, NM_004010.3:c.-506C>TVOUS**
43DMDEx1NM_004006.2:c.31+83180G>TLRG_199t1:c.31+83180G>T, NM_000109.2:c.8-107902G>T, NM_000109.3:c.8-107902G>T, NM_004006.1:c.31+83180G>T, NM_004006.2:c.31+83180G>T, NM_004009.2:c.19+45G>T, NM_004009.3:c.19+45G>T, NM_004010.2:c.-378G>T, NM_004010.3:c.-378G>TBenign** 
44DMDEx1NM_004006.2:c.31+83313T>CBenign** 
45DMDEx1NM_004006.2:c.31+83690G>TNM_000109.2:c.8-107392G>T, NM_000109.3:c.8-107392G>T, NM_004006.1:c.31+83690G>T, NM_004006.2:c.31+83690G>T, NM_004009.2:c.19+555G>T, NM_004009.3:c.19+555G>T, NM_004010.2:c.-339+471G>T, NM_004010.3:c.-339+471G>TVOUS**
46DMDEx1NM_004006.2:c.31+173056G>ANM_000109.2:c.8-18026G>A, NM_000109.3:c.8-18026G>A, NM_004006.1:c.32-18026G>A, NM_004006.2:c.32-18026G>A, NM_004009.2:c.20-18026G>A, NM_004009.3:c.20-18026G>A, NM_004010.2:c.-338-18026G>A, NM_004010.3:c.-338-18026G>AVOUS**
47DMDEx1NM_004006.2:c.31+173219A>GVOUS**
48DMDEx1NM_004006.2:c.-75G>ANM_000109.2:c.7+127872G>A, NM_000109.3:c.7+127872G>A, NM_004006.1:c.-75G>A, NM_004006.2:c.-75G>AVOUS08/28/2015
49DMDEx1NM_004006.2:c.-114dupTNM_000109.2:c.7+127832_7+127833insT, NM_000109.2:c.7+127833_7+127834insT, NM_000109.2:c.7+127833dup, NM_000109.3:c.7+127832_7+127833insT, NM_000109.3:c.7+127833_7+127834insT, NM_000109.3:c.7+127833dup, NM_004006.1:c.-114_-113insT, NM_004006.1:c.-114dup, NM_004006.1:c.-115_-114insT, NM_004006.2:c.-114_-113insT, NM_004006.2:c.-114dup, NM_004006.2:c.-115_-114insTBenign12/16/2015 
50DMDEx1NM_004006.2:c.-181A>TLRG_199t1:c.-181A>T, NM_000109.2:c.7+127766A>T, NM_000109.3:c.7+127766A>T, NM_004006.1:c.-181A>T, NM_004006.2:c.-181A>TVOUS07/06/2012
51DMDEx1NM_004006.2:c.-188delCNM_000109.2:c.7+127759delC, NM_000109.3:c.7+127759delC, NM_004006.1:c.-188delC, NM_004006.2:c.-188delCLikely benign12/23/2015 
52DMDEx1NM_004006.2:c.-188C>TLRG_199t1:c.-188C>T, NM_000109.2:c.7+127759C>T, NM_000109.3:c.7+127759C>T, NM_004006.1:c.-188C>T, NM_004006.2:c.-188C>TVOUS03/02/2016
53DMDEx1NM_004006.2:c.-302G>ALRG_199t1:c.-302G>A, NM_000109.2:c.7+127645G>A, NM_000109.3:c.7+127645G>A, NM_004006.1:c.-302G>A, NM_004006.2:c.-302G>AVOUS03/03/2016
54DMDEx1NM_004006.2:c.-342G>ALRG_199t1:c.-342G>A, NM_000109.2:c.7+127605G>A, NM_000109.3:c.7+127605G>A, NM_004006.1:c.-342G>A, NM_004006.2:c.-342G>AVOUS09/03/2015
55DMDEx1NM_004006.2:c.-357A>GNM_000109.2:c.7+127590A>G, NM_000109.3:c.7+127590A>G, NM_004006.1:c.-357A>G, NM_004006.2:c.-357A>GVOUS12/17/2015
56DMDEx1NM_004006.2:c.-419A>GLRG_199t1:c.-419A>G, NM_000109.2:c.7+127528A>G, NM_000109.3:c.7+127528A>G, NM_004006.1:c.-419A>G, NM_004006.2:c.-419A>GBenign06/30/2014 
57DMDEx1NM_004006.2:c.-451A>GLRG_199t1:c.-451A>G, NM_000109.2:c.7+127496A>G, NM_000109.3:c.7+127496A>G, NM_004006.1:c.-451A>G, NM_004006.2:c.-451A>GVOUS03/24/2014
58DMDEx1NM_004006.2:c.-583dupAVOUS**
59DMDEx1NM_004006.2:c.-681_-680delTTLRG_199t1:c.-681_-680delTT, NM_000109.2:c.7+127266_7+127267delTT, NM_000109.3:c.7+127266_7+127267delTT, NM_004006.1:c.-681_-680delTT, NM_004006.2:c.-681_-680delTTVOUS11/13/2015
60DMDEx1NM_004006.2:c.-807A>TNM_000109.2:c.7+127140A>T, NM_000109.3:c.7+127140A>T, NM_004006.1:c.-807A>T, NM_004006.2:c.-807A>TBenign01/24/2014 
61DMDEx1NM_004006.2:c.-955A>TVOUS**
62DMDEx1NM_004006.2:c.-1081T>CNM_000109.2:c.7+126866T>C, NM_000109.3:c.7+126866T>C, NM_004006.1:c.-1081T>C, NM_004006.2:c.-1081T>CVOUS**
63DMDEx1NM_004006.2:c.-1105G>ANM_000109.2:c.7+126842G>A, NM_000109.3:c.7+126842G>A, NM_004006.1:c.-1105G>A, NM_004006.2:c.-1105G>AVOUS10/06/2014
64DMDEx1NM_004006.2:c.-1128G>ALRG_199t1:c.-1128G>A, NM_000109.2:c.7+126819G>A, NM_000109.3:c.7+126819G>A, NM_004006.1:c.-1128G>A, NM_004006.2:c.-1128G>ABenign10/28/2015 
65DMDEx1NM_004006.2:c.-126450A>CBenign** 
66DMDEx1NM_004006.2:c.-126811C>TNM_000109.2:c.7+1136C>T, NM_000109.3:c.7+1136C>TVOUS**
67DMDEx1NM_004006.2:c.-127348A>TBenign** 
68DMDEx1NM_004006.2:c.-127369G>ANM_000109.2:c.7+578G>A, NM_000109.3:c.7+578G>ABenign** 
69DMDEx1NM_004006.2:c.-127596delANM_000109.2:c.7+351delA, NM_000109.3:c.7+351delABenign** 
70DMDEx1NM_004006.2:c.-127599delANM_000109.2:c.7+348delA, NM_000109.3:c.7+348delABenign** 
71DMDEx1NM_004006.2:c.-128163A>GBenign** 
72DMDEx1NM_004006.2:c.-128410A>CNM_000109.2:c.-457A>C, NM_000109.3:c.-457A>CBenign** 
73DMDEx1NM_004006.2:c.-128490C>ANM_000109.2:c.-537C>A, NM_000109.3:c.-537C>AVOUS**
74DMDEx1NM_004006.2:c.-128726A>GNM_000109.2:c.-773A>G, NM_000109.3:c.-773A>GVOUS**
75DMDEx1NM_004006.2:c.-128771C>TNM_000109.2:c.-818C>T, NM_000109.3:c.-818C>TBenign01/22/2016 
76DMDEx1NM_004006.2:c.-128857G>AVOUS**
77DMDEx1NM_004006.2:c.-129064A>GVOUS**
78DMDEx1NM_004006.2:c.-129210_-129201dupACACACACACNM_000109.2:c.-1248_-1247insACACACACAC, NM_000109.2:c.-1258_-1257insACACACACAC, NM_000109.3:c.-1248_-1247insACACACACAC, NM_000109.3:c.-1258_-1257insACACACACACVOUS**
79DMDEx1NM_004006.2:c.-129226A>GNM_000109.2:c.-1273A>G, NM_000109.3:c.-1273A>GVOUS**
80DMDEx1NM_004006.2:c.-129266G>TNM_000109.2:c.-1313G>T, NM_000109.3:c.-1313G>TVOUS**
81DMDEx1NM_004006.2:c.-129310A>GNM_000109.2:c.-1357A>G, NM_000109.3:c.-1357A>GVOUS01/30/2013
82DMDEx1NM_004006.2:c.-129329G>ANM_000109.2:c.-1376G>A, NM_000109.3:c.-1376G>ABenign** 
83DMDEx1NM_004006.2:c.-129380T>ANM_000109.2:c.-1427T>A, NM_000109.3:c.-1427T>AVOUS**
84DMDEx1NM_004006.2:c.-129556delANM_000109.2:c.-1603delA, NM_000109.3:c.-1603delABenign** 
85DMDEx2NM_004006.2:c.32-2A>TNM_000109.2:c.8-2A>T, NM_000109.3:c.8-2A>T, NM_004006.1:c.32-2A>T, NM_004006.2:c.32-2A>T, NM_004007.1:c.-340A>T, NM_004007.2:c.-340A>T, NM_004009.2:c.20-2A>T, NM_004009.3:c.20-2A>T, NM_004010.2:c.-338-2A>T, NM_004010.3:c.-338-2A>TPathogenic** 
86DMDEx2NM_004006.2:c.62T>Cp.Phe21Ser | p.F21SVOUS**
87DMDEx2NM_004006.2:c.74T>Cp.Val25Ala | p.V25ALRG_199t1:c.74T>C, NM_000109.2:c.50T>C, NM_000109.3:c.50T>C, NM_004006.1:c.74T>C, NM_004006.2:c.74T>C, NM_004007.1:c.-296T>C, NM_004007.2:c.-296T>C, NM_004009.2:c.62T>C, NM_004009.3:c.62T>C, NM_004010.2:c.-296T>C, NM_004010.3:c.-296T>CVOUS09/25/2016
88DMDEx2NM_004006.2:c.78T>Gp.Asn26Lys | p.N26KNM_000109.2:c.54T>G, NM_000109.3:c.54T>G, NM_004006.1:c.78T>G, NM_004006.2:c.78T>G, NM_004007.1:c.-292T>G, NM_004007.2:c.-292T>G, NM_004009.2:c.66T>G, NM_004009.3:c.66T>G, NM_004010.2:c.-292T>G, NM_004010.3:c.-292T>GVOUS11/26/2014
89DMDEx2NM_004006.2:c.79G>Cp.Ala27Pro | p.A27PLRG_199t1:c.79G>C, NM_000109.2:c.55G>C, NM_000109.3:c.55G>C, NM_004006.1:c.79G>C, NM_004006.2:c.79G>C, NM_004007.1:c.-291G>C, NM_004007.2:c.-291G>C, NM_004009.2:c.67G>C, NM_004009.3:c.67G>C, NM_004010.2:c.-291G>C, NM_004010.3:c.-291G>CVOUS01/21/2016
90DMDEx2NM_004006.2:c.91A>Gp.Lys31Glu | p.K31ELRG_199t1:c.91A>G, NM_000109.2:c.67A>G, NM_000109.3:c.67A>G, NM_004006.1:c.91A>G, NM_004006.2:c.91A>G, NM_004007.1:c.-279A>G, NM_004007.2:c.-279A>G, NM_004009.2:c.79A>G, NM_004009.3:c.79A>G, NM_004010.2:c.-279A>G, NM_004010.3:c.-279A>GVOUS08/27/2016
91DMDEx2NM_004006.2:c.93+1_93+5delGTAAGLRG_199t1:c.93+1_93+5delGTAAG, NM_000109.2:c.69+1_69+5delGTAAG, NM_000109.3:c.69+1_69+5delGTAAG, NM_004006.1:c.93+1_93+5delGTAAG, NM_004006.2:c.93+1_93+5delGTAAG, NM_004007.1:c.-277+1_-277+5delGTAAG, NM_004007.2:c.-277+1_-277+5delGTAAG, NM_004009.2:c.81+1_81+5delGTAAG, NM_004009.3:c.81+1_81+5delGTAAG, NM_004010.2:c.-277+1_-277+5delGTAAG, NM_004010.3:c.-277+1_-277+5delGTAAGPathogenic09/07/2016 
92DMDEx2NM_004006.2:c.93+1G>ANM_000109.2:c.69+1G>A, NM_000109.3:c.69+1G>A, NM_004006.1:c.93+1G>A, NM_004006.2:c.93+1G>A, NM_004007.1:c.-277+1G>A, NM_004007.2:c.-277+1G>A, NM_004009.2:c.81+1G>A, NM_004009.3:c.81+1G>A, NM_004010.2:c.-277+1G>A, NM_004010.3:c.-277+1G>APathogenic09/10/2015 
93DMDEx2NM_004006.2:c.93+5590T>ANM_000109.2:c.69+5590T>A, NM_000109.3:c.69+5590T>A, NM_004006.1:c.93+5590T>A, NM_004006.2:c.93+5590T>A, NM_004007.1:c.-277+5590T>A, NM_004007.2:c.-277+5590T>A, NM_004009.2:c.81+5590T>A, NM_004009.3:c.81+5590T>A, NM_004010.2:c.-277+5590T>A, NM_004010.3:c.-277+5590T>AVOUS06/19/2017
94DMDEx3NM_004006.2:c.94-43G>ANM_000109.2:c.70-43G>A, NM_000109.3:c.70-43G>A, NM_004006.1:c.94-43G>A, NM_004006.2:c.94-43G>A, NM_004007.1:c.-276-43G>A, NM_004007.2:c.-276-43G>A, NM_004009.2:c.82-43G>A, NM_004009.3:c.82-43G>A, NM_004010.2:c.-276-43G>A, NM_004010.3:c.-276-43G>AVOUS**
95DMDEx3NM_004006.2:c.94-9dupTNM_000109.2:c.70-10_70-9insT, NM_000109.2:c.70-9_70-8insT, NM_000109.2:c.70-9dup, NM_000109.3:c.70-10_70-9insT, NM_000109.3:c.70-9_70-8insT, NM_000109.3:c.70-9dup, NM_004006.1:c.94-10_94-9insT, NM_004006.1:c.94-9_94-8insT, NM_004006.1:c.94-9dup, NM_004006.2:c.94-10_94-9insT, NM_004006.2:c.94-9_94-8insT, NM_004006.2:c.94-9dup, NM_004007.1:c.-276-10_-276-9insT, NM_004007.1:c.-276-9_-276-8insT, NM_004007.1:c.-276-9dup, NM_004007.2:c.-276-10_-276-9insT, NM_004007.2:c.-276-9_-276-8insT, NM_004007.2:c.-276-9dup, NM_004009.2:c.82-10_82-9insT, NM_004009.2:c.82-9_82-8insT, NM_004009.2:c.82-9dup, NM_004009.3:c.82-10_82-9insT, NM_004009.3:c.82-9_82-8insT, NM_004009.3:c.82-9dup, NM_004010.2:c.-276-10_-276-9insT, NM_004010.2:c.-276-9_-276-8insT, NM_004010.2:c.-276-9dup, NM_004010.3:c.-276-10_-276-9insT, NM_004010.3:c.-276-9_-276-8insT, NM_004010.3:c.-276-9dupBenign04/04/2016 
96DMDEx3NM_004006.2:c.94-9T>ALRG_199t1:c.94-9T>A, NM_000109.2:c.70-9T>A, NM_000109.3:c.70-9T>A, NM_004006.1:c.94-9T>A, NM_004006.2:c.94-9T>A, NM_004007.1:c.-276-9T>A, NM_004007.2:c.-276-9T>A, NM_004009.2:c.82-9T>A, NM_004009.3:c.82-9T>A, NM_004010.2:c.-276-9T>A, NM_004010.3:c.-276-9T>ALikely benign06/01/2018 
97DMDEx3NM_004006.2:c.94-3C>TNM_000109.2:c.70-3C>T, NM_000109.3:c.70-3C>T, NM_004006.1:c.94-3C>T, NM_004006.2:c.94-3C>T, NM_004007.1:c.-276-3C>T, NM_004007.2:c.-276-3C>T, NM_004009.2:c.82-3C>T, NM_004009.3:c.82-3C>T, NM_004010.2:c.-276-3C>T, NM_004010.3:c.-276-3C>TVOUS02/23/2015
98DMDEx3NM_004006.2:c.100A>Gp.Lys34Glu | p.K34ELRG_199t1:c.100A>G, NM_000109.2:c.76A>G, NM_000109.3:c.76A>G, NM_004006.1:c.100A>G, NM_004006.2:c.100A>G, NM_004007.1:c.-270A>G, NM_004007.2:c.-270A>G, NM_004009.2:c.88A>G, NM_004009.3:c.88A>G, NM_004010.2:c.-270A>G, NM_004010.3:c.-270A>GVOUS12/02/2016
99DMDEx3NM_004006.2:c.104A>Cp.Gln35Pro | p.Q35PLRG_199t1:c.104A>C, NM_000109.2:c.80A>C, NM_000109.3:c.80A>C, NM_004006.1:c.104A>C, NM_004006.2:c.104A>C, NM_004007.1:c.-266A>C, NM_004007.2:c.-266A>C, NM_004009.2:c.92A>C, NM_004009.3:c.92A>C, NM_004010.2:c.-266A>C, NM_004010.3:c.-266A>CVOUS01/26/2018
100DMDEx3NM_004006.2:c.133C>Tp.Gln45* | p.Q45XNM_000109.2:c.109C>T, NM_000109.3:c.109C>T, NM_004006.1:c.133C>T, NM_004006.2:c.133C>T, NM_004007.1:c.-237C>T, NM_004007.2:c.-237C>T, NM_004009.2:c.121C>T, NM_004009.3:c.121C>T, NM_004010.2:c.-237C>T, NM_004010.3:c.-237C>TPathogenic07/30/2014 
101DMDEx3NM_004006.2:c.137_138dupATp.Gly47Metfs*6 | p.G47MfsX6LRG_199t1:c.137_138dupAT, NM_000109.2:c.112_113insAT, NM_000109.2:c.113_114dup, NM_000109.2:c.113_114dupAT, NM_000109.2:c.114_115insAT, NM_000109.3:c.112_113insAT, NM_000109.3:c.113_114dup, NM_000109.3:c.113_114dupAT, NM_000109.3:c.114_115insAT, NM_004006.1:c.136_137insAT, NM_004006.1:c.137_138dup, NM_004006.1:c.137_138dupAT, NM_004006.1:c.138_139insAT, NM_004006.2:c.136_137insAT, NM_004006.2:c.137_138dup, NM_004006.2:c.137_138dupAT, NM_004006.2:c.138_139insAT, NM_004007.1:c.-232_-231insAT, NM_004007.1:c.-233_-232dup, NM_004007.1:c.-233_-232dupAT, NM_004007.1:c.-234_-233insAT, NM_004007.2:c.-232_-231insAT, NM_004007.2:c.-233_-232dup, NM_004007.2:c.-233_-232dupAT, NM_004007.2:c.-234_-233insAT, NM_004009.2:c.124_125insAT, NM_004009.2:c.125_126dup, NM_004009.2:c.125_126dupAT, NM_004009.2:c.126_127insAT, NM_004009.3:c.124_125insAT, NM_004009.3:c.125_126dup, NM_004009.3:c.125_126dupAT, NM_004009.3:c.126_127insAT, NM_004010.2:c.-232_-231insAT, NM_004010.2:c.-233_-232dup, NM_004010.2:c.-233Pathogenic03/03/2016 
102DMDEx3NM_004006.2:c.137A>Tp.Asp46Val | p.D46VNM_000109.2:c.113A>T, NM_000109.3:c.113A>T, NM_004006.1:c.137A>T, NM_004006.2:c.137A>T, NM_004007.1:c.-233A>T, NM_004007.2:c.-233A>T, NM_004009.2:c.125A>T, NM_004009.3:c.125A>T, NM_004010.2:c.-233A>T, NM_004010.3:c.-233A>TPathogenic** 
103DMDEx3NM_004006.2:c.140G>Ap.Gly47Glu | p.G47ELRG_199t1:c.140G>A, NM_000109.2:c.116G>A, NM_000109.3:c.116G>A, NM_004006.1:c.140G>A, NM_004006.2:c.140G>A, NM_004007.1:c.-230G>A, NM_004007.2:c.-230G>A, NM_004009.2:c.128G>A, NM_004009.3:c.128G>A, NM_004010.2:c.-230G>A, NM_004010.3:c.-230G>AVOUS**
104DMDEx3NM_004006.2:c.140G>Cp.Gly47Ala | p.G47ALRG_199t1:c.140G>C, NM_000109.2:c.116G>C, NM_000109.3:c.116G>C, NM_004006.1:c.140G>C, NM_004006.2:c.140G>C, NM_004007.1:c.-230G>C, NM_004007.2:c.-230G>C, NM_004009.2:c.128G>C, NM_004009.3:c.128G>C, NM_004010.2:c.-230G>C, NM_004010.3:c.-230G>CVOUS08/25/2016
105DMDEx3NM_004006.2:c.145C>Tp.Arg49Cys | p.R49CLRG_199t1:c.145C>T, NM_000109.2:c.121C>T, NM_000109.3:c.121C>T, NM_004006.1:c.145C>T, NM_004006.2:c.145C>T, NM_004007.1:c.-225C>T, NM_004007.2:c.-225C>T, NM_004009.2:c.133C>T, NM_004009.3:c.133C>T, NM_004010.2:c.-225C>T, NM_004010.3:c.-225C>TVOUS08/23/2018
106DMDEx3NM_004006.2:c.146G>Ap.Arg49His | p.R49HNM_000109.2:c.122G>A, NM_000109.3:c.122G>A, NM_004006.1:c.146G>A, NM_004006.2:c.146G>A, NM_004007.1:c.-224G>A, NM_004007.2:c.-224G>A, NM_004009.2:c.134G>A, NM_004009.3:c.134G>A, NM_004010.2:c.-224G>A, NM_004010.3:c.-224G>AVOUS08/11/2015
107DMDEx3NM_004006.2:c.149T>Ap.Leu50His | p.L50HLRG_199t1:c.149T>A, NM_000109.2:c.125T>A, NM_000109.3:c.125T>A, NM_004006.1:c.149T>A, NM_004006.2:c.149T>A, NM_004007.1:c.-221T>A, NM_004007.2:c.-221T>A, NM_004009.2:c.137T>A, NM_004009.3:c.137T>A, NM_004010.2:c.-221T>A, NM_004010.3:c.-221T>AVOUS10/26/2021
108DMDEx3NM_004006.2:c.152T>Cp.Leu51Pro | p.L51PLRG_199t1:c.152T>C, NM_000109.2:c.128T>C, NM_000109.3:c.128T>C, NM_004006.1:c.152T>C, NM_004006.2:c.152T>C, NM_004007.1:c.-218T>C, NM_004007.2:c.-218T>C, NM_004009.2:c.140T>C, NM_004009.3:c.140T>C, NM_004010.2:c.-218T>C, NM_004010.3:c.-218T>CVOUS07/26/2016
109DMDEx3NM_004006.2:c.159C>Ap.Leu53= | p.L53=LRG_199t1:c.159C>A, NM_000109.2:c.135C>A, NM_000109.3:c.135C>A, NM_004006.1:c.159C>A, NM_004006.2:c.159C>A, NM_004007.1:c.-211C>A, NM_004007.2:c.-211C>A, NM_004009.2:c.147C>A, NM_004009.3:c.147C>A, NM_004010.2:c.-211C>A, NM_004010.3:c.-211C>AVOUS01/04/2017
110DMDEx3NM_004006.2:c.160_162delCTCNM_000109.2:c.136_138delCTC, NM_000109.3:c.136_138delCTC, NM_004006.1:c.160_162delCTC, NM_004006.2:c.160_162delCTC, NM_004007.1:c.-210_-208delCTC, NM_004007.2:c.-210_-208delCTC, NM_004009.2:c.148_150delCTC, NM_004009.3:c.148_150delCTC, NM_004010.2:c.-210_-208delCTC, NM_004010.3:c.-210_-208delCTCPathogenic** 
111DMDEx3NM_004006.2:c.170T>Cp.Leu57Pro | p.L57PLRG_199t1:c.170T>C, NM_000109.2:c.146T>C, NM_000109.3:c.146T>C, NM_004006.1:c.170T>C, NM_004006.2:c.170T>C, NM_004007.1:c.-200T>C, NM_004007.2:c.-200T>C, NM_004009.2:c.158T>C, NM_004009.3:c.158T>C, NM_004010.2:c.-200T>C, NM_004010.3:c.-200T>CVOUS08/22/2016
112DMDEx3NM_004006.2:c.175_179dupGGGCAp.Lys61Glyfs*16 | p.K61GfsX16LRG_199t1:c.175_179dupGGGCA, NM_000109.2:c.151_155dupGGGCA, NM_000109.2:c.155_156insGGGCA, NM_000109.3:c.151_155dupGGGCA, NM_000109.3:c.155_156insGGGCA, NM_004006.1:c.175_179dupGGGCA, NM_004006.1:c.179_180insGGGCA, NM_004006.2:c.175_179dupGGGCA, NM_004006.2:c.179_180insGGGCA, NM_004007.1:c.-191_-190insGGGCA, NM_004007.1:c.-195_-191dupGGGCA, NM_004007.2:c.-191_-190insGGGCA, NM_004007.2:c.-195_-191dupGGGCA, NM_004009.2:c.163_167dupGGGCA, NM_004009.2:c.167_168insGGGCA, NM_004009.3:c.163_167dupGGGCA, NM_004009.3:c.167_168insGGGCA, NM_004010.2:c.-191_-190insGGGCA, NM_004010.2:c.-195_-191dupGGGCA, NM_004010.3:c.-191_-190insGGGCA, NM_004010.3:c.-195_-191dupGGGCAPathogenic02/03/2016 
113DMDEx3NM_004006.2:c.186+2T>ALRG_199t1:c.186+2T>A, NM_000109.2:c.162+2T>A, NM_000109.3:c.162+2T>A, NM_004006.1:c.186+2T>A, NM_004006.2:c.186+2T>A, NM_004007.1:c.-184+2T>A, NM_004007.2:c.-184+2T>A, NM_004009.2:c.174+2T>A, NM_004009.3:c.174+2T>A, NM_004010.2:c.-184+2T>A, NM_004010.3:c.-184+2T>APathogenic06/14/2016 
114DMDEx4NM_004006.2:c.199G>Tp.Gly67* | p.G67XLRG_199t1:c.199G>T, NM_000109.2:c.175G>T, NM_000109.3:c.175G>T, NM_004006.1:c.199G>T, NM_004006.2:c.199G>T, NM_004007.1:c.-171G>T, NM_004007.2:c.-171G>T, NM_004009.2:c.187G>T, NM_004009.3:c.187G>T, NM_004010.2:c.-171G>T, NM_004010.3:c.-171G>TPathogenic** 
115DMDEx4NM_004006.2:c.204dupCNM_000109.2:c.180_181insC, NM_000109.3:c.180_181insC, NM_004006.1:c.204_205insC, NM_004006.2:c.204_205insC, NM_004007.1:c.-166_-165insC, NM_004007.2:c.-166_-165insC, NM_004009.2:c.192_193insC, NM_004009.3:c.192_193insC, NM_004010.2:c.-166_-165insC, NM_004010.3:c.-166_-165insCPathogenic** 
116DMDEx4NM_004006.2:c.220delCPathogenic** 
117DMDEx4NM_004006.2:c.230T>Ap.Val77Asp | p.V77DNM_000109.2:c.206T>A, NM_000109.3:c.206T>A, NM_004006.1:c.230T>A, NM_004006.2:c.230T>A, NM_004007.1:c.-140T>A, NM_004007.2:c.-140T>A, NM_004009.2:c.218T>A, NM_004009.3:c.218T>A, NM_004010.2:c.-140T>A, NM_004010.3:c.-140T>AVOUS01/03/2016
118DMDEx4NM_004006.2:c.243G>Ap.Leu81= | p.L81=NM_000109.2:c.219G>A, NM_000109.3:c.219G>A, NM_004006.1:c.243G>A, NM_004006.2:c.243G>A, NM_004007.1:c.-127G>A, NM_004007.2:c.-127G>A, NM_004009.2:c.231G>A, NM_004009.3:c.231G>A, NM_004010.2:c.-127G>A, NM_004010.3:c.-127G>AVOUS12/04/2015
119DMDEx4NM_004006.2:c.245G>Cp.Arg82Pro | p.R82PLRG_199t1:c.245G>C, NM_000109.2:c.221G>C, NM_000109.3:c.221G>C, NM_004006.1:c.245G>C, NM_004006.2:c.245G>C, NM_004007.1:c.-125G>C, NM_004007.2:c.-125G>C, NM_004009.2:c.233G>C, NM_004009.3:c.233G>C, NM_004010.2:c.-125G>C, NM_004010.3:c.-125G>CVOUS09/19/2017
120DMDEx4NM_004006.2:c.251delTPathogenic** 
121DMDEx4NM_004006.2:c.264+1G>ALRG_199t1:c.264+1G>A, NM_000109.2:c.240+1G>A, NM_000109.3:c.240+1G>A, NM_004006.1:c.264+1G>A, NM_004006.2:c.264+1G>A, NM_004007.1:c.-106+1G>A, NM_004007.2:c.-106+1G>A, NM_004009.2:c.252+1G>A, NM_004009.3:c.252+1G>A, NM_004010.2:c.-106+1G>A, NM_004010.3:c.-106+1G>APathogenic09/06/2017 
122DMDEx4NM_004006.2:c.264+5G>CLRG_199t1:c.264+5G>C, NM_000109.2:c.240+5G>C, NM_000109.3:c.240+5G>C, NM_004006.1:c.264+5G>C, NM_004006.2:c.264+5G>C, NM_004007.1:c.-106+5G>C, NM_004007.2:c.-106+5G>C, NM_004009.2:c.252+5G>C, NM_004009.3:c.252+5G>C, NM_004010.2:c.-106+5G>C, NM_004010.3:c.-106+5G>CVOUS**
123DMDEx5NM_004006.2:c.265-9_265-6delCTTTNM_000109.2:c.241-9_241-6delCTTT, NM_000109.3:c.241-9_241-6delCTTT, NM_004006.1:c.265-9_265-6delCTTT, NM_004006.2:c.265-9_265-6delCTTT, NM_004007.1:c.-105-9_-105-6delCTTT, NM_004007.2:c.-105-9_-105-6delCTTT, NM_004009.2:c.253-9_253-6delCTTT, NM_004009.3:c.253-9_253-6delCTTT, NM_004010.2:c.-105-9_-105-6delCTTT, NM_004010.3:c.-105-9_-105-6delCTTTVOUS12/08/2015
124DMDEx5NM_004006.2:c.266T>Ap.Val89Asp | p.V89DLRG_199t1:c.266T>A, NM_000109.2:c.242T>A, NM_000109.3:c.242T>A, NM_004006.1:c.266T>A, NM_004006.2:c.266T>A, NM_004007.1:c.-104T>A, NM_004007.2:c.-104T>A, NM_004009.2:c.254T>A, NM_004009.3:c.254T>A, NM_004010.2:c.-104T>A, NM_004010.3:c.-104T>AVOUS09/25/2018
125DMDEx5NM_004006.2:c.276G>Ap.Val92= | p.V92=NM_000109.2:c.252G>A, NM_000109.3:c.252G>A, NM_004006.1:c.276G>A, NM_004006.2:c.276G>A, NM_004007.1:c.-94G>A, NM_004007.2:c.-94G>A, NM_004009.2:c.264G>A, NM_004009.3:c.264G>A, NM_004010.2:c.-94G>A, NM_004010.3:c.-94G>AVOUS11/26/2013
126DMDEx5NM_004006.2:c.277A>Gp.Asn93Asp | p.N93DNM_000109.2:c.253A>G, NM_000109.3:c.253A>G, NM_004006.1:c.277A>G, NM_004006.2:c.277A>G, NM_004007.1:c.-93A>G, NM_004007.2:c.-93A>G, NM_004009.2:c.265A>G, NM_004009.3:c.265A>G, NM_004010.2:c.-93A>G, NM_004010.3:c.-93A>GVOUS11/26/2013
127DMDEx5NM_004006.2:c.283G>Tp.Gly95* | p.G95XLRG_199t1:c.283G>T, NM_000109.2:c.259G>T, NM_000109.3:c.259G>T, NM_004006.1:c.283G>T, NM_004006.2:c.283G>T, NM_004007.1:c.-87G>T, NM_004007.2:c.-87G>T, NM_004009.2:c.271G>T, NM_004009.3:c.271G>T, NM_004010.2:c.-87G>T, NM_004010.3:c.-87G>TPathogenic05/01/2017 
128DMDEx5NM_004006.2:c.287G>Ap.Ser96Asn | p.S96NLRG_199t1:c.287G>A, NM_000109.2:c.263G>A, NM_000109.3:c.263G>A, NM_004006.1:c.287G>A, NM_004006.2:c.287G>A, NM_004007.1:c.-83G>A, NM_004007.2:c.-83G>A, NM_004009.2:c.275G>A, NM_004009.3:c.275G>A, NM_004010.2:c.-83G>A, NM_004010.3:c.-83G>AVOUS05/14/2018
129DMDEx5NM_004006.2:c.291dupTNM_000109.2:c.266_267insT, NM_000109.2:c.267_268insT, NM_000109.3:c.266_267insT, NM_000109.3:c.267_268insT, NM_004006.1:c.290_291insT, NM_004006.1:c.291_292insT, NM_004006.2:c.290_291insT, NM_004006.2:c.291_292insT, NM_004007.1:c.-79_-78insT, NM_004007.1:c.-80_-79insT, NM_004007.2:c.-79_-78insT, NM_004007.2:c.-80_-79insT, NM_004009.2:c.278_279insT, NM_004009.2:c.279_280insT, NM_004009.3:c.278_279insT, NM_004009.3:c.279_280insT, NM_004010.2:c.-79_-78insT, NM_004010.2:c.-80_-79insT, NM_004010.3:c.-79_-78insT, NM_004010.3:c.-80_-79insTPathogenic12/01/2014 
130DMDEx5NM_004006.2:c.295A>Gp.Ile99Val | p.I99VNM_000109.2:c.271A>G, NM_000109.3:c.271A>G, NM_004006.1:c.295A>G, NM_004006.2:c.295A>G, NM_004007.1:c.-75A>G, NM_004007.2:c.-75A>G, NM_004009.2:c.283A>G, NM_004009.3:c.283A>G, NM_004010.2:c.-75A>G, NM_004010.3:c.-75A>GVOUS09/06/2017
131DMDEx5NM_004006.2:c.314A>Tp.Lys105Ile | p.K105ILRG_199t1:c.314A>T, NM_000109.2:c.290A>T, NM_000109.3:c.290A>T, NM_004006.1:c.314A>T, NM_004006.2:c.314A>T, NM_004007.1:c.-56A>T, NM_004007.2:c.-56A>T, NM_004009.2:c.302A>T, NM_004009.3:c.302A>T, NM_004010.2:c.-56A>T, NM_004010.3:c.-56A>TVOUS**
132DMDEx5NM_004006.2:c.319dupANM_000109.2:c.295_296insA, NM_000109.3:c.295_296insA, NM_004006.1:c.319_320insA, NM_004006.2:c.319_320insA, NM_004007.1:c.-51_-50insA, NM_004007.2:c.-51_-50insA, NM_004009.2:c.307_308insA, NM_004009.3:c.307_308insA, NM_004010.2:c.-51_-50insA, NM_004010.3:c.-51_-50insAPathogenic01/13/2016 
133DMDEx5NM_004006.2:c.336G>Ap.Trp112* | p.W112XLRG_199t1:c.336G>A, NM_000109.2:c.312G>A, NM_000109.3:c.312G>A, NM_004006.1:c.336G>A, NM_004006.2:c.336G>A, NM_004007.1:c.-34G>A, NM_004007.2:c.-34G>A, NM_004009.2:c.324G>A, NM_004009.3:c.324G>A, NM_004010.2:c.-34G>A, NM_004010.3:c.-34G>APathogenic11/22/2013 
134DMDEx5NM_004006.2:c.352T>Cp.Trp118Arg | p.W118RLRG_199t1:c.352T>C, NM_000109.2:c.328T>C, NM_000109.3:c.328T>C, NM_004006.1:c.352T>C, NM_004006.2:c.352T>C, NM_004007.1:c.-18T>C, NM_004007.2:c.-18T>C, NM_004009.2:c.340T>C, NM_004009.3:c.340T>C, NM_004010.2:c.-18T>C, NM_004010.3:c.-18T>CVOUS08/24/2016
135DMDEx5NM_004006.2:c.355C>Tp.Gln119* | p.Q119XLRG_199t1:c.355C>T, NM_000109.2:c.331C>T, NM_000109.3:c.331C>T, NM_004006.1:c.355C>T, NM_004006.2:c.355C>T, NM_004007.1:c.-15C>T, NM_004007.2:c.-15C>T, NM_004009.2:c.343C>T, NM_004009.3:c.343C>T, NM_004010.2:c.-15C>T, NM_004010.3:c.-15C>TPathogenic03/14/2018 
136DMDEx5NM_004006.2:c.357+5G>ALRG_199t1:c.357+5G>A, NM_000109.2:c.333+5G>A, NM_000109.3:c.333+5G>A, NM_004006.1:c.357+5G>A, NM_004006.2:c.357+5G>A, NM_004007.1:c.-13+5G>A, NM_004007.2:c.-13+5G>A, NM_004009.2:c.345+5G>A, NM_004009.3:c.345+5G>A, NM_004010.2:c.-13+5G>A, NM_004010.3:c.-13+5G>AVOUS04/24/2018
137DMDEx5NM_004006.2:c.357+7A>GLRG_199t1:c.357+7A>G, NM_000109.2:c.333+7A>G, NM_000109.3:c.333+7A>G, NM_004006.1:c.357+7A>G, NM_004006.2:c.357+7A>G, NM_004007.1:c.-13+7A>G, NM_004007.2:c.-13+7A>G, NM_004009.2:c.345+7A>G, NM_004009.3:c.345+7A>G, NM_004010.2:c.-13+7A>G, NM_004010.3:c.-13+7A>GVOUS03/07/2016
138DMDEx5NM_004006.2:c.357+42T>CBenign** 
139DMDEx6NM_004006.2:c.358-1G>ALRG_199t1:c.358-1G>A, NM_000109.2:c.334-1G>A, NM_000109.3:c.334-1G>A, NM_004006.1:c.358-1G>A, NM_004006.2:c.358-1G>A, NM_004007.1:c.-12-1G>A, NM_004007.2:c.-12-1G>A, NM_004009.2:c.346-1G>A, NM_004009.3:c.346-1G>A, NM_004010.2:c.-12-1G>A, NM_004010.3:c.-12-1G>APathogenic09/19/2016 
140DMDEx6NM_004006.2:c.365delAp.Asn122Metfs*2 | p.N122MfsX2LRG_199t1:c.365delA, NM_000109.2:c.341delA, NM_000109.3:c.341delA, NM_004006.1:c.365delA, NM_004006.2:c.365delA, NM_004007.1:c.-5delA, NM_004007.2:c.-5delA, NM_004009.2:c.353delA, NM_004009.3:c.353delA, NM_004010.2:c.-5delA, NM_004010.3:c.-5delAPathogenic10/17/2016 
141DMDEx6NM_004006.2:c.412_413delAAPathogenic03/28/2013 
142DMDEx6NM_004006.2:c.415_428delATTCTCCTGAGCTGNM_000109.2:c.391_404delATTCTCCTGAGCTG, NM_000109.3:c.391_404delATTCTCCTGAGCTG, NM_004006.1:c.415_428delATTCTCCTGAGCTG, NM_004006.2:c.415_428delATTCTCCTGAGCTG, NM_004007.1:c.46_59delATTCTCCTGAGCTG, NM_004007.2:c.46_59delATTCTCCTGAGCTG, NM_004009.2:c.403_416delATTCTCCTGAGCTG, NM_004009.3:c.403_416delATTCTCCTGAGCTG, NM_004010.2:c.46_59delATTCTCCTGAGCTG, NM_004010.3:c.46_59delATTCTCCTGAGCTGPathogenic11/21/2014 
143DMDEx6NM_004006.2:c.431T>Ap.Val144Asp | p.V144DLRG_199t1:c.431T>A, NM_000109.2:c.407T>A, NM_000109.3:c.407T>A, NM_004006.1:c.431T>A, NM_004006.2:c.431T>A, NM_004007.1:c.62T>A, NM_004007.2:c.62T>A, NM_004009.2:c.419T>A, NM_004009.3:c.419T>A, NM_004010.2:c.62T>A, NM_004010.3:c.62T>AVOUS10/25/2018
144DMDEx6NM_004006.2:c.433C>Tp.Arg145* | p.R145XLRG_199t1:c.433C>T, NM_000109.2:c.409C>T, NM_000109.3:c.409C>T, NM_004006.1:c.433C>T, NM_004006.2:c.433C>T, NM_004007.1:c.64C>T, NM_004007.2:c.64C>T, NM_004009.2:c.421C>T, NM_004009.3:c.421C>T, NM_004010.2:c.64C>T, NM_004010.3:c.64C>TPathogenic05/19/2016 
145DMDEx6NM_004006.2:c.434G>Cp.Arg145Pro | p.R145PNM_000109.2:c.410G>C, NM_000109.3:c.410G>C, NM_004006.1:c.434G>C, NM_004006.2:c.434G>C, NM_004007.1:c.65G>C, NM_004007.2:c.65G>C, NM_004009.2:c.422G>C, NM_004009.3:c.422G>C, NM_004010.2:c.65G>C, NM_004010.3:c.65G>CPathogenic09/28/2015 
146DMDEx6NM_004006.2:c.434G>Ap.Arg145Gln | p.R145QNM_000109.2:c.410G>A, NM_000109.3:c.410G>A, NM_004006.1:c.434G>A, NM_004006.2:c.434G>A, NM_004007.1:c.65G>A, NM_004007.2:c.65G>A, NM_004009.2:c.422G>A, NM_004009.3:c.422G>A, NM_004010.2:c.65G>A, NM_004010.3:c.65G>AVOUS12/17/2015
147DMDEx6NM_004006.2:c.445C>Ap.Arg149Ser | p.R149SLRG_199t1:c.445C>A, NM_000109.2:c.421C>A, NM_000109.3:c.421C>A, NM_004006.1:c.445C>A, NM_004006.2:c.445C>A, NM_004007.1:c.76C>A, NM_004007.2:c.76C>A, NM_004009.2:c.433C>A, NM_004009.3:c.433C>A, NM_004010.2:c.76C>A, NM_004010.3:c.76C>AVOUS11/11/2016
148DMDEx6NM_004006.2:c.446G>Ap.Arg149His | p.R149HLRG_199t1:c.446G>A, NM_000109.2:c.422G>A, NM_000109.3:c.422G>A, NM_004006.1:c.446G>A, NM_004006.2:c.446G>A, NM_004007.1:c.77G>A, NM_004007.2:c.77G>A, NM_004009.2:c.434G>A, NM_004009.3:c.434G>A, NM_004010.2:c.77G>A, NM_004010.3:c.77G>AVOUS12/16/2016
149DMDEx6NM_004006.2:c.457C>Tp.Gln153* | p.Q153XNM_000109.2:c.433C>T, NM_000109.3:c.433C>T, NM_004006.1:c.457C>T, NM_004006.2:c.457C>T, NM_004007.1:c.88C>T, NM_004007.2:c.88C>T, NM_004009.2:c.445C>T, NM_004009.3:c.445C>T, NM_004010.2:c.88C>T, NM_004010.3:c.88C>TPathogenic12/14/2015 
150DMDEx6NM_004006.2:c.468A>Cp.Val156= | p.V156=LRG_199t1:c.468A>C, NM_000109.2:c.444A>C, NM_000109.3:c.444A>C, NM_004006.1:c.468A>C, NM_004006.2:c.468A>C, NM_004007.1:c.99A>C, NM_004007.2:c.99A>C, NM_004009.2:c.456A>C, NM_004009.3:c.456A>C, NM_004010.2:c.99A>C, NM_004010.3:c.99A>CVOUS06/19/2016
151DMDEx6NM_004006.2:c.478_479dupACLRG_199t1:c.479_480insAC, NM_000109.2:c.455_456insAC, NM_000109.3:c.455_456insAC, NM_004006.1:c.479_480insAC, NM_004006.2:c.479_480insAC, NM_004007.1:c.110_111insAC, NM_004007.2:c.110_111insAC, NM_004009.2:c.467_468insAC, NM_004009.3:c.467_468insAC, NM_004010.2:c.110_111insAC, NM_004010.3:c.110_111insACPathogenic11/07/2016 
152DMDEx6NM_004006.2:c.478A>Cp.Thr160Pro | p.T160PNM_000109.2:c.454A>C, NM_000109.3:c.454A>C, NM_004006.1:c.478A>C, NM_004006.2:c.478A>C, NM_004007.1:c.109A>C, NM_004007.2:c.109A>C, NM_004009.2:c.466A>C, NM_004009.3:c.466A>C, NM_004010.2:c.109A>C, NM_004010.3:c.109A>CVOUS07/23/2013
153DMDEx6NM_004006.2:c.489G>Ap.Trp163* | p.W163XPathogenic** 
154DMDEx6NM_004006.2:c.493G>Tp.Asp165Tyr | p.D165YLRG_199t1:c.493G>T, NM_000109.2:c.469G>T, NM_000109.3:c.469G>T, NM_004006.1:c.493G>T, NM_004006.2:c.493G>T, NM_004007.1:c.124G>T, NM_004007.2:c.124G>T, NM_004009.2:c.481G>T, NM_004009.3:c.481G>T, NM_004010.2:c.124G>T, NM_004010.3:c.124G>TVOUS03/13/2018
155DMDEx6NM_004006.2:c.501G>Tp.Leu167= | p.L167=LRG_199t1:c.501G>T, NM_000109.2:c.477G>T, NM_000109.3:c.477G>T, NM_004006.1:c.501G>T, NM_004006.2:c.501G>T, NM_004007.1:c.132G>T, NM_004007.2:c.132G>T, NM_004009.2:c.489G>T, NM_004009.3:c.489G>T, NM_004010.2:c.132G>T, NM_004010.3:c.132G>TVOUS07/29/2016
156DMDEx6NM_004006.2:c.514C>Gp.Leu172Val | p.L172VLRG_199t1:c.514C>G, NM_000109.2:c.490C>G, NM_000109.3:c.490C>G, NM_004006.1:c.514C>G, NM_004006.2:c.514C>G, NM_004007.1:c.145C>G, NM_004007.2:c.145C>G, NM_004009.2:c.502C>G, NM_004009.3:c.502C>G, NM_004010.2:c.145C>G, NM_004010.3:c.145C>GVOUS08/26/2016
157DMDEx6NM_004006.2:c.522_523delTAp.His174Glnfs*3 | p.H174QfsX3LRG_199t1:c.522_523delTA, NM_000109.2:c.498_499delTA, NM_000109.3:c.498_499delTA, NM_004006.1:c.522_523delTA, NM_004006.2:c.522_523delTA, NM_004007.1:c.153_154delTA, NM_004007.2:c.153_154delTA, NM_004009.2:c.510_511delTA, NM_004009.3:c.510_511delTA, NM_004010.2:c.153_154delTA, NM_004010.3:c.153_154delTAPathogenic09/05/2017 
158DMDEx6NM_004006.2:c.530+1delGPathogenic** 
159DMDEx6NM_004006.2:c.530+7A>TLRG_199t1:c.530+7A>T, NM_000109.2:c.506+7A>T, NM_000109.3:c.506+7A>T, NM_004006.1:c.530+7A>T, NM_004006.2:c.530+7A>T, NM_004007.1:c.161+7A>T, NM_004007.2:c.161+7A>T, NM_004009.2:c.518+7A>T, NM_004009.3:c.518+7A>T, NM_004010.2:c.161+7A>T, NM_004010.3:c.161+7A>TVOUS01/05/2017
160DMDEx7NM_004006.2:c.531-34T>AVOUS**
161DMDEx7NM_004006.2:c.531-17A>GVOUS**
162DMDEx7NM_004006.2:c.531-11_531-6delATGTGTLRG_199t1:c.531-11_531-6delATGTGT, NM_000109.2:c.507-11_507-6delATGTGT, NM_000109.3:c.507-11_507-6delATGTGT, NM_004006.1:c.531-11_531-6delATGTGT, NM_004006.2:c.531-11_531-6delATGTGT, NM_004007.1:c.162-11_162-6delATGTGT, NM_004007.2:c.162-11_162-6delATGTGT, NM_004009.2:c.519-11_519-6delATGTGT, NM_004009.3:c.519-11_519-6delATGTGT, NM_004010.2:c.162-11_162-6delATGTGT, NM_004010.3:c.162-11_162-6delATGTGTVOUS09/17/2016
163DMDEx7NM_004006.2:c.531-10T>ALRG_199t1:c.531-10T>A, NM_000109.2:c.507-10T>A, NM_000109.3:c.507-10T>A, NM_004006.1:c.531-10T>A, NM_004006.2:c.531-10T>A, NM_004007.1:c.162-10T>A, NM_004007.2:c.162-10T>A, NM_004009.2:c.519-10T>A, NM_004009.3:c.519-10T>A, NM_004010.2:c.162-10T>A, NM_004010.3:c.162-10T>AVOUS05/09/2018
164DMDEx7NM_004006.2:c.531-2A>CPathogenic** 
165DMDEx7NM_004006.2:c.532C>Tp.Pro178Ser | p.P178SNM_000109.2:c.508C>T, NM_000109.3:c.508C>T, NM_004006.1:c.532C>T, NM_004006.2:c.532C>T, NM_004007.1:c.163C>T, NM_004007.2:c.163C>T, NM_004009.2:c.520C>T, NM_004009.3:c.520C>T, NM_004010.2:c.163C>T, NM_004010.3:c.163C>TVOUS01/10/2014
166DMDEx7NM_004006.2:c.547dupTNM_000109.2:c.523_524insT, NM_000109.3:c.523_524insT, NM_004006.1:c.547_548insT, NM_004006.2:c.547_548insT, NM_004007.1:c.178_179insT, NM_004007.2:c.178_179insT, NM_004009.2:c.535_536insT, NM_004009.3:c.535_536insT, NM_004010.2:c.178_179insT, NM_004010.3:c.178_179insTPathogenic03/31/2015 
167DMDEx7NM_004006.2:c.565C>Tp.Gln189* | p.Q189XNM_000109.2:c.541C>T, NM_000109.3:c.541C>T, NM_004006.1:c.565C>T, NM_004006.2:c.565C>T, NM_004007.1:c.196C>T, NM_004007.2:c.196C>T, NM_004009.2:c.553C>T, NM_004009.3:c.553C>T, NM_004010.2:c.196C>T, NM_004010.3:c.196C>TPathogenic04/27/2018 
168DMDEx7NM_004006.2:c.572C>Gp.Ser191* | p.S191XNM_000109.2:c.548C>G, NM_000109.3:c.548C>G, NM_004006.1:c.572C>G, NM_004006.2:c.572C>G, NM_004007.1:c.203C>G, NM_004007.2:c.203C>G, NM_004009.2:c.560C>G, NM_004009.3:c.560C>G, NM_004010.2:c.203C>G, NM_004010.3:c.203C>GPathogenic06/02/2015 
169DMDEx7NM_004006.2:c.579A>Tp.Thr193= | p.T193=LRG_199t1:c.579A>T, NM_000109.2:c.555A>T, NM_000109.3:c.555A>T, NM_004006.1:c.579A>T, NM_004006.2:c.579A>T, NM_004007.1:c.210A>T, NM_004007.2:c.210A>T, NM_004009.2:c.567A>T, NM_004009.3:c.567A>T, NM_004010.2:c.210A>T, NM_004010.3:c.210A>TVOUS07/05/2017
170DMDEx7NM_004006.2:c.583C>Tp.Arg195* | p.R195XNM_000109.2:c.559C>T, NM_000109.3:c.559C>T, NM_004006.1:c.583C>T, NM_004006.2:c.583C>T, NM_004007.1:c.214C>T, NM_004007.2:c.214C>T, NM_004009.2:c.571C>T, NM_004009.3:c.571C>T, NM_004010.2:c.214C>T, NM_004010.3:c.214C>TPathogenic05/06/2013 
171DMDEx7NM_004006.2:c.595_598dupGCATp.Phe200Cysfs*18 | p.F200CfsX18LRG_199t1:c.595_598dupGCAT, NM_000109.2:c.571_574dupGCAT, NM_000109.3:c.571_574dupGCAT, NM_004006.1:c.595_598dupGCAT, NM_004006.2:c.595_598dupGCAT, NM_004007.1:c.226_229dupGCAT, NM_004007.2:c.226_229dupGCAT, NM_004009.2:c.583_586dupGCAT, NM_004009.3:c.583_586dupGCAT, NM_004010.2:c.226_229dupGCAT, NM_004010.3:c.226_229dupGCATPathogenic06/14/2017 
172DMDEx7NM_004006.2:c.606C>Tp.Ile202= | p.I202=NM_000109.2:c.582C>T, NM_000109.3:c.582C>T, NM_004006.1:c.606C>T, NM_004006.2:c.606C>T, NM_004007.1:c.237C>T, NM_004007.2:c.237C>T, NM_004009.2:c.594C>T, NM_004009.3:c.594C>T, NM_004010.2:c.237C>T, NM_004010.3:c.237C>TVOUS11/27/2017
173DMDEx7NM_004006.2:c.614A>Gp.Tyr205Cys | p.Y205CLRG_199t1:c.614A>G, NM_000109.2:c.590A>G, NM_000109.3:c.590A>G, NM_004006.1:c.614A>G, NM_004006.2:c.614A>G, NM_004007.1:c.245A>G, NM_004007.2:c.245A>G, NM_004009.2:c.602A>G, NM_004009.3:c.602A>G, NM_004010.2:c.245A>G, NM_004010.3:c.245A>GVOUS09/28/2018
174DMDEx7NM_004006.2:c.615T>Ap.Tyr205* | p.Y205XNM_000109.2:c.591T>A, NM_000109.3:c.591T>A, NM_004006.1:c.615T>A, NM_004006.2:c.615T>A, NM_004007.1:c.246T>A, NM_004007.2:c.246T>A, NM_004009.2:c.603T>A, NM_004009.3:c.603T>A, NM_004010.2:c.246T>A, NM_004010.3:c.246T>APathogenic07/25/2013 
175DMDEx7NM_004006.2:c.618A>Gp.Gln206= | p.Q206=NM_000109.2:c.594A>G, NM_000109.3:c.594A>G, NM_004006.1:c.618A>G, NM_004006.2:c.618A>G, NM_004007.1:c.249A>G, NM_004007.2:c.249A>G, NM_004009.2:c.606A>G, NM_004009.3:c.606A>G, NM_004010.2:c.249A>G, NM_004010.3:c.249A>GVOUS10/10/2017
176DMDEx7NM_004006.2:c.626T>Cp.Ile209Thr | p.I209TLRG_199t1:c.626T>C, NM_000109.2:c.602T>C, NM_000109.3:c.602T>C, NM_004006.1:c.626T>C, NM_004006.2:c.626T>C, NM_004007.1:c.257T>C, NM_004007.2:c.257T>C, NM_004009.2:c.614T>C, NM_004009.3:c.614T>C, NM_004010.2:c.257T>C, NM_004010.3:c.257T>CVOUS07/18/2016
177DMDEx7NM_004006.2:c.627delAPathogenic01/21/2016 
178DMDEx7NM_004006.2:c.649+1G>APathogenic04/22/2013 
179DMDEx7NM_004006.2:c.649+1G>TNM_000109.2:c.625+1G>T, NM_000109.3:c.625+1G>T, NM_004006.1:c.649+1G>T, NM_004006.2:c.649+1G>T, NM_004007.1:c.280+1G>T, NM_004007.2:c.280+1G>T, NM_004009.2:c.637+1G>T, NM_004009.3:c.637+1G>T, NM_004010.2:c.280+1G>T, NM_004010.3:c.280+1G>TPathogenic12/02/2015 
180DMDEx7NM_004006.2:c.649+5G>TLRG_199t1:c.649+5G>T, NM_000109.2:c.625+5G>T, NM_000109.3:c.625+5G>T, NM_004006.1:c.649+5G>T, NM_004006.2:c.649+5G>T, NM_004007.1:c.280+5G>T, NM_004007.2:c.280+5G>T, NM_004009.2:c.637+5G>T, NM_004009.3:c.637+5G>T, NM_004010.2:c.280+5G>T, NM_004010.3:c.280+5G>TPathogenic05/03/2017 
181DMDEx7NM_004006.2:c.649+48A>TVOUS**
182DMDEx8NM_004006.2:c.650-7C>TNM_000109.2:c.626-7C>T, NM_000109.3:c.626-7C>T, NM_004006.1:c.650-7C>T, NM_004006.2:c.650-7C>T, NM_004007.1:c.281-7C>T, NM_004007.2:c.281-7C>T, NM_004009.2:c.638-7C>T, NM_004009.3:c.638-7C>T, NM_004010.2:c.281-7C>T, NM_004010.3:c.281-7C>TVOUS08/18/2015
183DMDEx8NM_004006.2:c.676_678delAAGNM_000109.2:c.652_654delAAG, NM_000109.3:c.652_654delAAG, NM_004006.1:c.676_678delAAG, NM_004006.2:c.676_678delAAG, NM_004007.1:c.307_309delAAG, NM_004007.2:c.307_309delAAG, NM_004009.2:c.664_666delAAG, NM_004009.3:c.664_666delAAG, NM_004010.2:c.307_309delAAG, NM_004010.3:c.307_309delAAGPathogenic01/21/2016 
184DMDEx8NM_004006.2:c.678G>Ap.Lys226= | p.K226=LRG_199t1:c.678G>A, NM_000109.2:c.654G>A, NM_000109.3:c.654G>A, NM_004006.1:c.678G>A, NM_004006.2:c.678G>A, NM_004007.1:c.309G>A, NM_004007.2:c.309G>A, NM_004009.2:c.666G>A, NM_004009.3:c.666G>A, NM_004010.2:c.309G>A, NM_004010.3:c.309G>AVOUS11/27/2018
185DMDEx8NM_004006.2:c.683T>Ap.Ile228Asn | p.I228NLRG_199t1:c.683T>A, NM_000109.2:c.659T>A, NM_000109.3:c.659T>A, NM_004006.1:c.683T>A, NM_004006.2:c.683T>A, NM_004007.1:c.314T>A, NM_004007.2:c.314T>A, NM_004009.2:c.671T>A, NM_004009.3:c.671T>A, NM_004010.2:c.314T>A, NM_004010.3:c.314T>AVOUS03/10/2016
186DMDEx8NM_004006.2:c.693C>Tp.Tyr231= | p.Y231=LRG_199t1:c.693C>T, NM_000109.2:c.669C>T, NM_000109.3:c.669C>T, NM_004006.1:c.693C>T, NM_004006.2:c.693C>T, NM_004007.1:c.324C>T, NM_004007.2:c.324C>T, NM_004009.2:c.681C>T, NM_004009.3:c.681C>T, NM_004010.2:c.324C>T, NM_004010.3:c.324C>TVOUS05/12/2017
187DMDEx8NM_004006.2:c.696C>Gp.Ile232Met | p.I232MNM_000109.2:c.672C>G, NM_000109.3:c.672C>G, NM_004006.1:c.696C>G, NM_004006.2:c.696C>G, NM_004007.1:c.327C>G, NM_004007.2:c.327C>G, NM_004009.2:c.684C>G, NM_004009.3:c.684C>G, NM_004010.2:c.327C>G, NM_004010.3:c.327C>GLikely benign08/03/2016 
188DMDEx8NM_004006.2:c.711A>Gp.Gln237= | p.Q237=NM_000109.2:c.687A>G, NM_000109.3:c.687A>G, NM_004006.1:c.711A>G, NM_004006.2:c.711A>G, NM_004007.1:c.342A>G, NM_004007.2:c.342A>G, NM_004009.2:c.699A>G, NM_004009.3:c.699A>G, NM_004010.2:c.342A>G, NM_004010.3:c.342A>GVOUS07/17/2015
189DMDEx8NM_004006.2:c.731G>Cp.Ser244Thr | p.S244TLRG_199t1:c.731G>C, NM_000109.2:c.707G>C, NM_000109.3:c.707G>C, NM_004006.1:c.731G>C, NM_004006.2:c.731G>C, NM_004007.1:c.362G>C, NM_004007.2:c.362G>C, NM_004009.2:c.719G>C, NM_004009.3:c.719G>C, NM_004010.2:c.362G>C, NM_004010.3:c.362G>CVOUS11/09/2018
190DMDEx8NM_004006.2:c.733A>Gp.Ile245Val | p.I245VNM_000109.2:c.709A>G, NM_000109.3:c.709A>G, NM_004006.1:c.733A>G, NM_004006.2:c.733A>G, NM_004007.1:c.364A>G, NM_004007.2:c.364A>G, NM_004009.2:c.721A>G, NM_004009.3:c.721A>G, NM_004010.2:c.364A>G, NM_004010.3:c.364A>GVOUS10/01/2018
191DMDEx8NM_004006.2:c.767_768dupAGPathogenic** 
192DMDEx8NM_004006.2:c.772C>Ap.Pro258Thr | p.P258TLRG_199t1:c.772C>A, NM_000109.2:c.748C>A, NM_000109.3:c.748C>A, NM_004006.1:c.772C>A, NM_004006.2:c.772C>A, NM_004007.1:c.403C>A, NM_004007.2:c.403C>A, NM_004009.2:c.760C>A, NM_004009.3:c.760C>A, NM_004010.2:c.403C>A, NM_004010.3:c.403C>AVOUS03/21/2018
193DMDEx8NM_004006.2:c.776_777delAAp.Lys259Serfs*3 | p.K259SfsX3LRG_199t1:c.776_777delAA, NM_000109.2:c.752_753delAA, NM_000109.3:c.752_753delAA, NM_004006.1:c.776_777delAA, NM_004006.2:c.776_777delAA, NM_004007.1:c.407_408delAA, NM_004007.2:c.407_408delAA, NM_004009.2:c.764_765delAA, NM_004009.3:c.764_765delAA, NM_004010.2:c.407_408delAA, NM_004010.3:c.407_408delAAPathogenic06/22/2018 
194DMDEx8NM_004006.2:c.802T>Cp.Leu268= | p.L268=NM_000109.2:c.778T>C, NM_000109.3:c.778T>C, NM_004006.1:c.802T>C, NM_004006.2:c.802T>C, NM_004007.1:c.433T>C, NM_004007.2:c.433T>C, NM_004009.2:c.790T>C, NM_004009.3:c.790T>C, NM_004010.2:c.433T>C, NM_004010.3:c.433T>CBenign11/11/2015 
195DMDEx8NM_004006.2:c.807_808delTCinsATp.His269_His270delinsGlnTyr | p.H269_H270delinsQYLRG_199t1:c.807_808delinsAT, NM_000109.2:c.783_784delinsAT, NM_000109.3:c.783_784delinsAT, NM_004006.1:c.807_808delinsAT, NM_004006.2:c.807_808delinsAT, NM_004007.1:c.438_439delinsAT, NM_004007.2:c.438_439delinsAT, NM_004009.2:c.795_796delinsAT, NM_004009.3:c.795_796delinsAT, NM_004010.2:c.438_439delinsAT, NM_004010.3:c.438_439delinsATVOUS08/27/2019
196DMDEx8NM_004006.2:c.821A>Gp.Tyr274Cys | p.Y274CLRG_199t1:c.821A>G, NM_000109.2:c.797A>G, NM_000109.3:c.797A>G, NM_004006.1:c.821A>G, NM_004006.2:c.821A>G, NM_004007.1:c.452A>G, NM_004007.2:c.452A>G, NM_004009.2:c.809A>G, NM_004009.3:c.809A>G, NM_004010.2:c.452A>G, NM_004010.3:c.452A>GVOUS11/30/2016
197DMDEx8NM_004006.2:c.831G>Ap.Gln277= | p.Q277=LRG_199t1:c.831G>A, NM_000109.2:c.807G>A, NM_000109.3:c.807G>A, NM_004006.1:c.831G>A, NM_004006.2:c.831G>A, NM_004007.1:c.462G>A, NM_004007.2:c.462G>A, NM_004009.2:c.819G>A, NM_004009.3:c.819G>A, NM_004010.2:c.462G>A, NM_004010.3:c.462G>AVOUS08/23/2016
198DMDEx8NM_004006.2:c.831G>Tp.Gln277His | p.Q277HVOUS**
199DMDEx8NM_004006.2:c.831+1G>TLRG_199t1:c.831+1G>T, NM_000109.2:c.807+1G>T, NM_000109.3:c.807+1G>T, NM_004006.1:c.831+1G>T, NM_004006.2:c.831+1G>T, NM_004007.1:c.462+1G>T, NM_004007.2:c.462+1G>T, NM_004009.2:c.819+1G>T, NM_004009.3:c.819+1G>T, NM_004010.2:c.462+1G>T, NM_004010.3:c.462+1G>TPathogenic12/01/2017 
200DMDEx9NM_004006.2:c.832-44T>ABenign** 
201DMDEx9NM_004006.2:c.832-18C>GNM_000109.2:c.808-18C>G, NM_000109.3:c.808-18C>G, NM_004006.1:c.832-18C>G, NM_004006.2:c.832-18C>G, NM_004007.1:c.463-18C>G, NM_004007.2:c.463-18C>G, NM_004009.2:c.820-18C>G, NM_004009.3:c.820-18C>G, NM_004010.2:c.463-18C>G, NM_004010.3:c.463-18C>GBenign05/09/2014 
202DMDEx9NM_004006.2:c.832-17C>ANM_000109.2:c.808-17C>A, NM_000109.3:c.808-17C>A, NM_004006.1:c.832-17C>A, NM_004006.2:c.832-17C>A, NM_004007.1:c.463-17C>A, NM_004007.2:c.463-17C>A, NM_004009.2:c.820-17C>A, NM_004009.3:c.820-17C>A, NM_004010.2:c.463-17C>A, NM_004010.3:c.463-17C>ABenign05/09/2014 
203DMDEx9NM_004006.2:c.837G>Ap.Thr279= | p.T279=NM_000109.2:c.813G>A, NM_000109.3:c.813G>A, NM_004006.1:c.837G>A, NM_004006.2:c.837G>A, NM_004007.1:c.468G>A, NM_004007.2:c.468G>A, NM_004009.2:c.825G>A, NM_004009.3:c.825G>A, NM_004010.2:c.468G>A, NM_004010.3:c.468G>ABenign11/11/2015 
204DMDEx9NM_004006.2:c.863G>Cp.Arg288Thr | p.R288TLRG_199t1:c.863G>C, NM_000109.2:c.839G>C, NM_000109.3:c.839G>C, NM_004006.1:c.863G>C, NM_004006.2:c.863G>C, NM_004007.1:c.494G>C, NM_004007.2:c.494G>C, NM_004009.2:c.851G>C, NM_004009.3:c.851G>C, NM_004010.2:c.494G>C, NM_004010.3:c.494G>CVOUS01/13/2017
205DMDEx9NM_004006.2:c.883C>Tp.Arg295* | p.R295XNM_000109.2:c.859C>T, NM_000109.3:c.859C>T, NM_004006.1:c.883C>T, NM_004006.2:c.883C>T, NM_004007.1:c.514C>T, NM_004007.2:c.514C>T, NM_004009.2:c.871C>T, NM_004009.3:c.871C>T, NM_004010.2:c.514C>T, NM_004010.3:c.514C>TPathogenic01/17/2014 
206DMDEx9NM_004006.2:c.884G>Ap.Arg295Gln | p.R295QLRG_199t1:c.884G>A, NM_000109.2:c.860G>A, NM_000109.3:c.860G>A, NM_004006.1:c.884G>A, NM_004006.2:c.884G>A, NM_004007.1:c.515G>A, NM_004007.2:c.515G>A, NM_004009.2:c.872G>A, NM_004009.3:c.872G>A, NM_004010.2:c.515G>A, NM_004010.3:c.515G>AVOUS04/04/2018
207DMDEx9NM_004006.2:c.914C>Tp.Ala305Val | p.A305VLRG_199t1:c.914C>T, NM_000109.2:c.890C>T, NM_000109.3:c.890C>T, NM_004006.1:c.914C>T, NM_004006.2:c.914C>T, NM_004007.1:c.545C>T, NM_004007.2:c.545C>T, NM_004009.2:c.902C>T, NM_004009.3:c.902C>T, NM_004010.2:c.545C>T, NM_004010.3:c.545C>TVOUS07/25/2016
208DMDEx9NM_004006.2:c.923C>Tp.Thr308Ile | p.T308ILRG_199t1:c.923C>T, NM_000109.2:c.899C>T, NM_000109.3:c.899C>T, NM_004006.1:c.923C>T, NM_004006.2:c.923C>T, NM_004007.1:c.554C>T, NM_004007.2:c.554C>T, NM_004009.2:c.911C>T, NM_004009.3:c.911C>T, NM_004010.2:c.554C>T, NM_004010.3:c.554C>TBenign09/06/2016 
209DMDEx9NM_004006.2:c.923C>Ap.Thr308Asn | p.T308NLRG_199t1:c.923C>A, NM_000109.2:c.899C>A, NM_000109.3:c.899C>A, NM_004006.1:c.923C>A, NM_004006.2:c.923C>A, NM_004007.1:c.554C>A, NM_004007.2:c.554C>A, NM_004009.2:c.911C>A, NM_004009.3:c.911C>A, NM_004010.2:c.554C>A, NM_004010.3:c.554C>AVOUS10/04/2016
210DMDEx9NM_004006.2:c.940C>Tp.Arg314Trp | p.R314WLRG_199t1:c.940C>T, NM_000109.2:c.916C>T, NM_000109.3:c.916C>T, NM_004006.1:c.940C>T, NM_004006.2:c.940C>T, NM_004007.1:c.571C>T, NM_004007.2:c.571C>T, NM_004009.2:c.928C>T, NM_004009.3:c.928C>T, NM_004010.2:c.571C>T, NM_004010.3:c.571C>TVOUS04/04/2017
211DMDEx9NM_004006.2:c.960+7C>GNM_000109.2:c.936+7C>G, NM_000109.3:c.936+7C>G, NM_004006.1:c.960+7C>G, NM_004006.2:c.960+7C>G, NM_004007.1:c.591+7C>G, NM_004007.2:c.591+7C>G, NM_004009.2:c.948+7C>G, NM_004009.3:c.948+7C>G, NM_004010.2:c.591+7C>G, NM_004010.3:c.591+7C>GVOUS08/17/2015
212DMDEx9NM_004006.2:c.960+9A>GNM_000109.2:c.936+9A>G, NM_000109.3:c.936+9A>G, NM_004006.1:c.960+9A>G, NM_004006.2:c.960+9A>G, NM_004007.1:c.591+9A>G, NM_004007.2:c.591+9A>G, NM_004009.2:c.948+9A>G, NM_004009.3:c.948+9A>G, NM_004010.2:c.591+9A>G, NM_004010.3:c.591+9A>GVOUS07/22/2015
213DMDEx9NM_004006.2:c.960+50delGLRG_199t1:c.960+50delG, NM_000109.2:c.936+50delG, NM_000109.3:c.936+50delG, NM_004006.1:c.960+50delG, NM_004006.2:c.960+50delG, NM_004007.1:c.591+50delG, NM_004007.2:c.591+50delG, NM_004009.2:c.948+50delG, NM_004009.3:c.948+50delG, NM_004010.2:c.591+50delG, NM_004010.3:c.591+50delGBenign02/10/2014 
214DMDEx10NM_004006.2:c.961-5981A>TBenign** 
215DMDEx10NM_004006.2:c.961-5978_961-5977insGGANM_000109.2:c.937-5978_937-5977insGGA, NM_000109.3:c.937-5978_937-5977insGGA, NM_004006.1:c.961-5978_961-5977insGGA, NM_004006.2:c.961-5978_961-5977insGGA, NM_004007.1:c.592-5978_592-5977insGGA, NM_004007.2:c.592-5978_592-5977insGGA, NM_004009.2:c.949-5978_949-5977insGGA, NM_004009.3:c.949-5978_949-5977insGGA, NM_004010.2:c.592-5978_592-5977insGGA, NM_004010.3:c.592-5978_592-5977insGGAVOUS**
216DMDEx10NM_004006.2:c.961-5978_961-5974delTTATAVOUS**
217DMDEx10NM_004006.2:c.961-5853C>TNM_000109.2:c.937-5853C>T, NM_000109.3:c.937-5853C>T, NM_004006.1:c.961-5853C>T, NM_004006.2:c.961-5853C>T, NM_004007.1:c.592-5853C>T, NM_004007.2:c.592-5853C>T, NM_004009.2:c.949-5853C>T, NM_004009.3:c.949-5853C>T, NM_004010.2:c.592-5853C>T, NM_004010.3:c.592-5853C>TVOUS**
218DMDEx10NM_004006.2:c.961-5831C>TNM_000109.2:c.937-5831C>T, NM_000109.3:c.937-5831C>T, NM_004006.1:c.961-5831C>T, NM_004006.2:c.961-5831C>T, NM_004007.1:c.592-5831C>T, NM_004007.2:c.592-5831C>T, NM_004009.2:c.949-5831C>T, NM_004009.3:c.949-5831C>T, NM_004010.2:c.592-5831C>T, NM_004010.3:c.592-5831C>TPathogenic11/15/2016 
219DMDEx10NM_004006.2:c.961-6G>ANM_000109.2:c.937-6G>A, NM_000109.3:c.937-6G>A, NM_004006.1:c.961-6G>A, NM_004006.2:c.961-6G>A, NM_004007.1:c.592-6G>A, NM_004007.2:c.592-6G>A, NM_004009.2:c.949-6G>A, NM_004009.3:c.949-6G>A, NM_004010.2:c.592-6G>A, NM_004010.3:c.592-6G>A, NR_031646.1:n.-3599G>AVOUS09/03/2015
220DMDEx10NM_004006.2:c.981C>Gp.Asp327Glu | p.D327ELRG_199t1:c.981C>G, NM_000109.2:c.957C>G, NM_000109.3:c.957C>G, NM_004006.1:c.981C>G, NM_004006.2:c.981C>G, NM_004007.1:c.612C>G, NM_004007.2:c.612C>G, NM_004009.2:c.969C>G, NM_004009.3:c.969C>G, NM_004010.2:c.612C>G, NM_004010.3:c.612C>G, NR_031646.1:n.-3573C>GVOUS10/25/2017
221DMDEx10NM_004006.2:c.984G>Tp.Lys328Asn | p.K328NLRG_199t1:c.984G>T, NM_000109.2:c.960G>T, NM_000109.3:c.960G>T, NM_004006.1:c.984G>T, NM_004006.2:c.984G>T, NM_004007.1:c.615G>T, NM_004007.2:c.615G>T, NM_004009.2:c.972G>T, NM_004009.3:c.972G>T, NM_004010.2:c.615G>T, NM_004010.3:c.615G>T, NR_031646.1:n.-3570G>TVOUS12/06/2016
222DMDEx10NM_004006.2:c.1011T>Gp.Ser337Arg | p.S337RVOUS12/14/2012
223DMDEx10NM_004006.2:c.1012G>Tp.Glu338* | p.E338XLRG_199t1:c.1012G>T, NM_000109.2:c.988G>T, NM_000109.3:c.988G>T, NM_004006.1:c.1012G>T, NM_004006.2:c.1012G>T, NM_004007.1:c.643G>T, NM_004007.2:c.643G>T, NM_004009.2:c.1000G>T, NM_004009.3:c.1000G>T, NM_004010.2:c.643G>T, NM_004010.3:c.643G>T, NR_031646.1:n.-3542G>TPathogenic12/14/2012 
224DMDEx10NM_004006.2:c.1014A>Gp.Glu338= | p.E338=LRG_199t1:c.1014A>G, NM_000109.2:c.990A>G, NM_000109.3:c.990A>G, NM_004006.1:c.1014A>G, NM_004006.2:c.1014A>G, NM_004007.1:c.645A>G, NM_004007.2:c.645A>G, NM_004009.2:c.1002A>G, NM_004009.3:c.1002A>G, NM_004010.2:c.645A>G, NM_004010.3:c.645A>G, NR_031646.1:n.-3540A>GVOUS06/01/2016
225DMDEx10NM_004006.2:c.1015G>Ap.Val339Ile | p.V339ILRG_199t1:c.1015G>A, NM_000109.2:c.991G>A, NM_000109.3:c.991G>A, NM_004006.1:c.1015G>A, NM_004006.2:c.1015G>A, NM_004007.1:c.646G>A, NM_004007.2:c.646G>A, NM_004009.2:c.1003G>A, NM_004009.3:c.1003G>A, NM_004010.2:c.646G>A, NM_004010.3:c.646G>A, NR_031646.1:n.-3539G>AVOUS06/30/2016
226DMDEx10NM_004006.2:c.1028G>Ap.Arg343His | p.R343HNM_000109.2:c.1004G>A, NM_000109.3:c.1004G>A, NM_004006.1:c.1028G>A, NM_004006.2:c.1028G>A, NM_004007.1:c.659G>A, NM_004007.2:c.659G>A, NM_004009.2:c.1016G>A, NM_004009.3:c.1016G>A, NM_004010.2:c.659G>A, NM_004010.3:c.659G>A, NR_031646.1:n.-3526G>ALikely benign05/04/2017 
227DMDEx10NM_004006.2:c.1047dupANM_000109.2:c.1023_1024insA, NM_000109.3:c.1023_1024insA, NM_004006.1:c.1047_1048insA, NM_004006.2:c.1047_1048insA, NM_004007.1:c.678_679insA, NM_004007.2:c.678_679insA, NM_004009.2:c.1035_1036insA, NM_004009.3:c.1035_1036insA, NM_004010.2:c.678_679insA, NM_004010.3:c.678_679insA, NR_031646.1:n.-3507_-3506insAPathogenic11/09/2015 
228DMDEx10NM_004006.2:c.1048G>Tp.Glu350* | p.E350XLRG_199t1:c.1048G>T, NM_000109.2:c.1024G>T, NM_000109.3:c.1024G>T, NM_004006.1:c.1048G>T, NM_004006.2:c.1048G>T, NM_004007.1:c.679G>T, NM_004007.2:c.679G>T, NM_004009.2:c.1036G>T, NM_004009.3:c.1036G>T, NM_004010.2:c.679G>T, NM_004010.3:c.679G>T, NR_031646.1:n.-3506G>TPathogenic07/05/2012 
229DMDEx10NM_004006.2:c.1057T>Cp.Ser353Pro | p.S353PLRG_199t1:c.1057T>C, NM_000109.2:c.1033T>C, NM_000109.3:c.1033T>C, NM_004006.1:c.1057T>C, NM_004006.2:c.1057T>C, NM_004007.1:c.688T>C, NM_004007.2:c.688T>C, NM_004009.2:c.1045T>C, NM_004009.3:c.1045T>C, NM_004010.2:c.688T>C, NM_004010.3:c.688T>C, NR_031646.1:n.-3497T>CVOUS01/04/2017
230DMDEx10NM_004006.2:c.1058C>Tp.Ser353Leu | p.S353LLRG_199t1:c.1058C>T, NM_000109.2:c.1034C>T, NM_000109.3:c.1034C>T, NM_004006.1:c.1058C>T, NM_004006.2:c.1058C>T, NM_004007.1:c.689C>T, NM_004007.2:c.689C>T, NM_004009.2:c.1046C>T, NM_004009.3:c.1046C>T, NM_004010.2:c.689C>T, NM_004010.3:c.689C>T, NR_031646.1:n.-3496C>TVOUS11/23/2016
231DMDEx10NM_004006.2:c.1059G>Ap.Ser353= | p.S353=NM_000109.2:c.1035G>A, NM_000109.3:c.1035G>A, NM_004006.1:c.1059G>A, NM_004006.2:c.1059G>A, NM_004007.1:c.690G>A, NM_004007.2:c.690G>A, NM_004009.2:c.1047G>A, NM_004009.3:c.1047G>A, NM_004010.2:c.690G>A, NM_004010.3:c.690G>A, NR_031646.1:n.-3495G>ALikely benign08/04/2016 
232DMDEx10NM_004006.2:c.1062G>Ap.Trp354* | p.W354XLRG_199t1:c.1062G>A, NM_000109.2:c.1038G>A, NM_000109.3:c.1038G>A, NM_004006.1:c.1062G>A, NM_004006.2:c.1062G>A, NM_004007.1:c.693G>A, NM_004007.2:c.693G>A, NM_004009.2:c.1050G>A, NM_004009.3:c.1050G>A, NM_004010.2:c.693G>A, NM_004010.3:c.693G>A, NR_031646.1:n.-3492G>APathogenic01/25/2018 
233DMDEx10NM_004006.2:c.1070delCp.Ser357Leufs*19 | p.S357LfsX19LRG_199t1:c.1070delC, NM_000109.2:c.1046delC, NM_000109.3:c.1046delC, NM_004006.1:c.1070delC, NM_004006.2:c.1070delC, NM_004007.1:c.701delC, NM_004007.2:c.701delC, NM_004009.2:c.1058delC, NM_004009.3:c.1058delC, NM_004010.2:c.701delC, NM_004010.3:c.701delC, NR_031646.1:n.-3484delCPathogenic05/20/2014 
234DMDEx10NM_004006.2:c.1079A>Tp.Asp360Val | p.D360VLRG_199t1:c.1079A>T, NM_000109.2:c.1055A>T, NM_000109.3:c.1055A>T, NM_004006.1:c.1079A>T, NM_004006.2:c.1079A>T, NM_004007.1:c.710A>T, NM_004007.2:c.710A>T, NM_004009.2:c.1067A>T, NM_004009.3:c.1067A>T, NM_004010.2:c.710A>T, NM_004010.3:c.710A>T, NR_031646.1:n.-3475A>TVOUS10/06/2016
235DMDEx10NM_004006.2:c.1093C>Tp.Gln365* | p.Q365XLRG_199t1:c.1093C>T, NM_000109.2:c.1069C>T, NM_000109.3:c.1069C>T, NM_004006.1:c.1093C>T, NM_004006.2:c.1093C>T, NM_004007.1:c.724C>T, NM_004007.2:c.724C>T, NM_004009.2:c.1081C>T, NM_004009.3:c.1081C>T, NM_004010.2:c.724C>T, NM_004010.3:c.724C>T, NR_031646.1:n.-3461C>TPathogenic02/13/2020 
236DMDEx10NM_004006.2:c.1095A>Cp.Gln365His | p.Q365HNM_000109.2:c.1071A>C, NM_000109.3:c.1071A>C, NM_004006.1:c.1095A>C, NM_004006.2:c.1095A>C, NM_004007.1:c.726A>C, NM_004007.2:c.726A>C, NM_004009.2:c.1083A>C, NM_004009.3:c.1083A>C, NM_004010.2:c.726A>C, NM_004010.3:c.726A>C, NR_031646.1:n.-3459A>CBenign09/07/2015 
237DMDEx10NM_004006.2:c.1097G>Ap.Gly366Glu | p.G366ELRG_199t1:c.1097G>A, NM_000109.2:c.1073G>A, NM_000109.3:c.1073G>A, NM_004006.1:c.1097G>A, NM_004006.2:c.1097G>A, NM_004007.1:c.728G>A, NM_004007.2:c.728G>A, NM_004009.2:c.1085G>A, NM_004009.3:c.1085G>A, NM_004010.2:c.728G>A, NM_004010.3:c.728G>A, NR_031646.1:n.-3457G>AVOUS01/19/2017
238DMDEx10NM_004006.2:c.1098A>Tp.Gly366= | p.G366=LRG_199t1:c.1098A>T, NM_000109.2:c.1074A>T, NM_000109.3:c.1074A>T, NM_004006.1:c.1098A>T, NM_004006.2:c.1098A>T, NM_004007.1:c.729A>T, NM_004007.2:c.729A>T, NM_004009.2:c.1086A>T, NM_004009.3:c.1086A>T, NM_004010.2:c.729A>T, NM_004010.3:c.729A>T, NR_031646.1:n.-3456A>TVOUS05/10/2017
239DMDEx10NM_004006.2:c.1128dupALRG_199t1:c.1128_1129insA, NM_000109.2:c.1104_1105insA, NM_000109.3:c.1104_1105insA, NM_004006.1:c.1128_1129insA, NM_004006.2:c.1128_1129insA, NM_004007.1:c.759_760insA, NM_004007.2:c.759_760insA, NM_004009.2:c.1116_1117insA, NM_004009.3:c.1116_1117insA, NM_004010.2:c.759_760insA, NM_004010.3:c.759_760insA, NR_031646.1:n.-3426_-3425insAPathogenic09/15/2016 
240DMDEx11NM_004006.2:c.1150-4T>ANM_000109.2:c.1126-4T>A, NM_000109.3:c.1126-4T>A, NM_004006.1:c.1150-4T>A, NM_004006.2:c.1150-4T>A, NM_004007.1:c.781-4T>A, NM_004007.2:c.781-4T>A, NM_004009.2:c.1138-4T>A, NM_004009.3:c.1138-4T>A, NM_004010.2:c.781-4T>A, NM_004010.3:c.781-4T>A, NR_031646.1:n.-2758T>AVOUS07/21/2014
241DMDEx11NM_004006.2:c.1150-2A>GNM_000109.2:c.1126-2A>G, NM_000109.3:c.1126-2A>G, NM_004006.1:c.1150-2A>G, NM_004006.2:c.1150-2A>G, NM_004007.1:c.781-2A>G, NM_004007.2:c.781-2A>G, NM_004009.2:c.1138-2A>G, NM_004009.3:c.1138-2A>G, NM_004010.2:c.781-2A>G, NM_004010.3:c.781-2A>G, NR_031646.1:n.-2756A>GPathogenic12/05/2014 
242DMDEx11NM_004006.2:c.1150-1G>ANM_000109.2:c.1126-1G>A, NM_000109.3:c.1126-1G>A, NM_004006.1:c.1150-1G>A, NM_004006.2:c.1150-1G>A, NM_004007.1:c.781-1G>A, NM_004007.2:c.781-1G>A, NM_004009.2:c.1138-1G>A, NM_004009.3:c.1138-1G>A, NM_004010.2:c.781-1G>A, NM_004010.3:c.781-1G>A, NR_031646.1:n.-2755G>APathogenic02/01/2016 
243DMDEx11NM_004006.2:c.1159A>Gp.Met387Val | p.M387VNM_000109.2:c.1135A>G, NM_000109.3:c.1135A>G, NM_004006.1:c.1159A>G, NM_004006.2:c.1159A>G, NM_004007.1:c.790A>G, NM_004007.2:c.790A>G, NM_004009.2:c.1147A>G, NM_004009.3:c.1147A>G, NM_004010.2:c.790A>G, NM_004010.3:c.790A>G, NR_031646.1:n.-2745A>GVOUS01/14/2016
244DMDEx11NM_004006.2:c.1183C>Tp.Arg395Trp | p.R395WLRG_199t1:c.1183C>T, NM_000109.2:c.1159C>T, NM_000109.3:c.1159C>T, NM_004006.1:c.1183C>T, NM_004006.2:c.1183C>T, NM_004007.1:c.814C>T, NM_004007.2:c.814C>T, NM_004009.2:c.1171C>T, NM_004009.3:c.1171C>T, NM_004010.2:c.814C>T, NM_004010.3:c.814C>T, NR_031646.1:n.-2721C>TVOUS08/09/2016
245DMDEx11NM_004006.2:c.1184G>Ap.Arg395Gln | p.R395QNM_000109.2:c.1160G>A, NM_000109.3:c.1160G>A, NM_004006.1:c.1184G>A, NM_004006.2:c.1184G>A, NM_004007.1:c.815G>A, NM_004007.2:c.815G>A, NM_004009.2:c.1172G>A, NM_004009.3:c.1172G>A, NM_004010.2:c.815G>A, NM_004010.3:c.815G>A, NR_031646.1:n.-2720G>ALikely benign08/04/2015 
246DMDEx11NM_004006.2:c.1211G>Tp.Ser404Ile | p.S404IVOUS**
247DMDEx11NM_004006.2:c.1225A>Tp.Thr409Ser | p.T409SNM_000109.2:c.1201A>T, NM_000109.3:c.1201A>T, NM_004006.1:c.1225A>T, NM_004006.2:c.1225A>T, NM_004007.1:c.856A>T, NM_004007.2:c.856A>T, NM_004009.2:c.1213A>T, NM_004009.3:c.1213A>T, NM_004010.2:c.856A>T, NM_004010.3:c.856A>T, NR_031646.1:n.-2679A>TBenign12/16/2015 
248DMDEx11NM_004006.2:c.1252A>Tp.Thr418Ser | p.T418SNM_000109.2:c.1228A>T, NM_000109.3:c.1228A>T, NM_004006.1:c.1252A>T, NM_004006.2:c.1252A>T, NM_004007.1:c.883A>T, NM_004007.2:c.883A>T, NM_004009.2:c.1240A>T, NM_004009.3:c.1240A>T, NM_004010.2:c.883A>T, NM_004010.3:c.883A>T, NR_031646.1:n.-2652A>TLikely benign03/06/2017 
249DMDEx11NM_004006.2:c.1255G>Tp.Glu419* | p.E419XLRG_199t1:c.1255G>T, NM_000109.2:c.1231G>T, NM_000109.3:c.1231G>T, NM_004006.1:c.1255G>T, NM_004006.2:c.1255G>T, NM_004007.1:c.886G>T, NM_004007.2:c.886G>T, NM_004009.2:c.1243G>T, NM_004009.3:c.1243G>T, NM_004010.2:c.886G>T, NM_004010.3:c.886G>T, NR_031646.1:n.-2649G>TPathogenic04/25/2017 
250DMDEx11NM_004006.2:c.1261C>Tp.Gln421* | p.Q421XNM_000109.2:c.1237C>T, NM_000109.3:c.1237C>T, NM_004006.1:c.1261C>T, NM_004006.2:c.1261C>T, NM_004007.1:c.892C>T, NM_004007.2:c.892C>T, NM_004009.2:c.1249C>T, NM_004009.3:c.1249C>T, NM_004010.2:c.892C>T, NM_004010.3:c.892C>T, NR_031646.1:n.-2643C>TPathogenic09/12/2013 
251DMDEx11NM_004006.2:c.1280T>Cp.Leu427Pro | p.L427PLRG_199t1:c.1280T>C, NM_000109.2:c.1256T>C, NM_000109.3:c.1256T>C, NM_004006.1:c.1280T>C, NM_004006.2:c.1280T>C, NM_004007.1:c.911T>C, NM_004007.2:c.911T>C, NM_004009.2:c.1268T>C, NM_004009.3:c.1268T>C, NM_004010.2:c.911T>C, NM_004010.3:c.911T>C, NR_031646.1:n.-2624T>CVOUS01/10/2017
252DMDEx11NM_004006.2:c.1286C>Gp.Ser429* | p.S429XLRG_199t1:c.1286C>G, NM_000109.2:c.1262C>G, NM_000109.3:c.1262C>G, NM_004006.1:c.1286C>G, NM_004006.2:c.1286C>G, NM_004007.1:c.917C>G, NM_004007.2:c.917C>G, NM_004009.2:c.1274C>G, NM_004009.3:c.1274C>G, NM_004010.2:c.917C>G, NM_004010.3:c.917C>G, NR_031646.1:n.-2618C>GPathogenic11/27/2018 
253DMDEx11NM_004006.2:c.1286C>Ap.Ser429* | p.S429XLRG_199t1:c.1286C>A, NM_000109.2:c.1262C>A, NM_000109.3:c.1262C>A, NM_004006.1:c.1286C>A, NM_004006.2:c.1286C>A, NM_004007.1:c.917C>A, NM_004007.2:c.917C>A, NM_004009.2:c.1274C>A, NM_004009.3:c.1274C>A, NM_004010.2:c.917C>A, NM_004010.3:c.917C>A, NR_031646.1:n.-2618C>APathogenic03/27/2017 
254DMDEx11NM_004006.2:c.1306dupGp.Val436Glyfs*3 | p.V436GfsX3LRG_199t1:c.1306dupG, NM_000109.2:c.1282dupG, NM_000109.3:c.1282dupG, NM_004006.1:c.1306dupG, NM_004006.2:c.1306dupG, NM_004007.1:c.937dupG, NM_004007.2:c.937dupG, NM_004009.2:c.1294dupG, NM_004009.3:c.1294dupG, NM_004010.2:c.937dupG, NM_004010.3:c.937dupG, NR_031646.1:n.-2598dupGPathogenic09/14/2012 
255DMDEx11NM_004006.2:c.1311T>Gp.Ala437= | p.A437=NM_000109.2:c.1287T>G, NM_000109.3:c.1287T>G, NM_004006.1:c.1311T>G, NM_004006.2:c.1311T>G, NM_004007.1:c.942T>G, NM_004007.2:c.942T>G, NM_004009.2:c.1299T>G, NM_004009.3:c.1299T>G, NM_004010.2:c.942T>G, NM_004010.3:c.942T>G, NR_031646.1:n.-2593T>GVOUS07/29/2013
256DMDEx11NM_004006.2:c.1318G>Ap.Glu440Lys | p.E440KLRG_199t1:c.1318G>A, NM_000109.2:c.1294G>A, NM_000109.3:c.1294G>A, NM_004006.1:c.1318G>A, NM_004006.2:c.1318G>A, NM_004007.1:c.949G>A, NM_004007.2:c.949G>A, NM_004009.2:c.1306G>A, NM_004009.3:c.1306G>A, NM_004010.2:c.949G>A, NM_004010.3:c.949G>A, NR_031646.1:n.-2586G>ABenign11/21/2016 
257DMDEx11NM_004006.2:c.1331+26A>GBenign** 
258DMDEx12NM_004006.2:c.1332-11909C>TLRG_199t1:c.1332-11909C>T, NM_000109.2:c.1308-11909C>T, NM_000109.3:c.1308-11909C>T, NM_004006.1:c.1332-11909C>T, NM_004006.2:c.1332-11909C>T, NM_004007.1:c.963-11909C>T, NM_004007.2:c.963-11909C>T, NM_004009.2:c.1320-11909C>T, NM_004009.3:c.1320-11909C>T, NM_004010.2:c.963-11909C>T, NM_004010.3:c.963-11909C>TVOUS06/06/2017
259DMDEx12NM_004006.2:c.1332-11909C>GLRG_199t1:c.1332-11909C>G, NM_000109.2:c.1308-11909C>G, NM_000109.3:c.1308-11909C>G, NM_004006.1:c.1332-11909C>G, NM_004006.2:c.1332-11909C>G, NM_004007.1:c.963-11909C>G, NM_004007.2:c.963-11909C>G, NM_004009.2:c.1320-11909C>G, NM_004009.3:c.1320-11909C>G, NM_004010.2:c.963-11909C>G, NM_004010.3:c.963-11909C>GVOUS04/12/2019
260DMDEx12NM_004006.2:c.1332-18C>TBenign10/08/2012 
261DMDEx12NM_004006.2:c.1332-9A>GNM_000109.2:c.1308-9A>G, NM_000109.3:c.1308-9A>G, NM_004006.1:c.1332-9A>G, NM_004006.2:c.1332-9A>G, NM_004007.1:c.963-9A>G, NM_004007.2:c.963-9A>G, NM_004009.2:c.1320-9A>G, NM_004009.3:c.1320-9A>G, NM_004010.2:c.963-9A>G, NM_004010.3:c.963-9A>GPathogenic04/20/2016 
262DMDEx12NM_004006.2:c.1337A>Gp.His446Arg | p.H446RLRG_199t1:c.1337A>G, NM_000109.2:c.1313A>G, NM_000109.3:c.1313A>G, NM_004006.1:c.1337A>G, NM_004006.2:c.1337A>G, NM_004007.1:c.968A>G, NM_004007.2:c.968A>G, NM_004009.2:c.1325A>G, NM_004009.3:c.1325A>G, NM_004010.2:c.968A>G, NM_004010.3:c.968A>GLikely benign02/15/2018 
263DMDEx12NM_004006.2:c.1341_1342dupAGNM_000109.2:c.1318_1319insAG, NM_000109.3:c.1318_1319insAG, NM_004006.1:c.1342_1343insAG, NM_004006.2:c.1342_1343insAG, NM_004007.1:c.973_974insAG, NM_004007.2:c.973_974insAG, NM_004009.2:c.1330_1331insAG, NM_004009.3:c.1330_1331insAG, NM_004010.2:c.973_974insAG, NM_004010.3:c.973_974insAGPathogenic12/10/2012 
264DMDEx12NM_004006.2:c.1371delGPathogenic08/01/2012 
265DMDEx12NM_004006.2:c.1387_1408delTGGCTAACAAAAACAGAAGAAAp.Trp463Glufs*17 | p.W463EfsX17LRG_199t1:c.1387_1408delTGGCTAACAAAAACAGAAGAAA, NM_000109.2:c.1363_1384delTGGCTAACAAAAACAGAAGAAA, NM_000109.3:c.1363_1384delTGGCTAACAAAAACAGAAGAAA, NM_004006.1:c.1387_1408delTGGCTAACAAAAACAGAAGAAA, NM_004006.2:c.1387_1408delTGGCTAACAAAAACAGAAGAAA, NM_004007.1:c.1018_1039delTGGCTAACAAAAACAGAAGAAA, NM_004007.2:c.1018_1039delTGGCTAACAAAAACAGAAGAAA, NM_004009.2:c.1375_1396delTGGCTAACAAAAACAGAAGAAA, NM_004009.3:c.1375_1396delTGGCTAACAAAAACAGAAGAAA, NM_004010.2:c.1018_1039delTGGCTAACAAAAACAGAAGAAA, NM_004010.3:c.1018_1039delTGGCTAACAAAAACAGAAGAAAPathogenic10/13/2015 
266DMDEx12NM_004006.2:c.1417A>Tp.Lys473* | p.K473XNM_000109.2:c.1393A>T, NM_000109.3:c.1393A>T, NM_004006.1:c.1417A>T, NM_004006.2:c.1417A>T, NM_004007.1:c.1048A>T, NM_004007.2:c.1048A>T, NM_004009.2:c.1405A>T, NM_004009.3:c.1405A>T, NM_004010.2:c.1048A>T, NM_004010.3:c.1048A>TPathogenic09/14/2017 
267DMDEx12NM_004006.2:c.1432C>Tp.Pro478Ser | p.P478SNM_000109.2:c.1408C>T, NM_000109.3:c.1408C>T, NM_004006.1:c.1432C>T, NM_004006.2:c.1432C>T, NM_004007.1:c.1063C>T, NM_004007.2:c.1063C>T, NM_004009.2:c.1420C>T, NM_004009.3:c.1420C>T, NM_004010.2:c.1063C>T, NM_004010.3:c.1063C>TVOUS01/15/2014
268DMDEx12NM_004006.2:c.1433C>Tp.Pro478Leu | p.P478LNM_000109.2:c.1409C>T, NM_000109.3:c.1409C>T, NM_004006.1:c.1433C>T, NM_004006.2:c.1433C>T, NM_004007.1:c.1064C>T, NM_004007.2:c.1064C>T, NM_004009.2:c.1421C>T, NM_004009.3:c.1421C>T, NM_004010.2:c.1064C>T, NM_004010.3:c.1064C>TVOUS09/25/2015
269DMDEx12NM_004006.2:c.1463G>Tp.Arg488Leu | p.R488LNM_000109.2:c.1439G>T, NM_000109.3:c.1439G>T, NM_004006.1:c.1463G>T, NM_004006.2:c.1463G>T, NM_004007.1:c.1094G>T, NM_004007.2:c.1094G>T, NM_004009.2:c.1451G>T, NM_004009.3:c.1451G>T, NM_004010.2:c.1094G>T, NM_004010.3:c.1094G>TVOUS03/31/2015
270DMDEx12NM_004006.2:c.1465C>Tp.Gln489* | p.Q489XNM_000109.2:c.1441C>T, NM_000109.3:c.1441C>T, NM_004006.1:c.1465C>T, NM_004006.2:c.1465C>T, NM_004007.1:c.1096C>T, NM_004007.2:c.1096C>T, NM_004009.2:c.1453C>T, NM_004009.3:c.1453C>T, NM_004010.2:c.1096C>T, NM_004010.3:c.1096C>TPathogenic08/09/2013 
271DMDEx12NM_004006.2:c.1482+1G>TPathogenic12/12/2012 
272DMDEx12NM_004006.2:c.1482+1G>CNM_000109.2:c.1458+1G>C, NM_000109.3:c.1458+1G>C, NM_004006.1:c.1482+1G>C, NM_004006.2:c.1482+1G>C, NM_004007.1:c.1113+1G>C, NM_004007.2:c.1113+1G>C, NM_004009.2:c.1470+1G>C, NM_004009.3:c.1470+1G>C, NM_004010.2:c.1113+1G>C, NM_004010.3:c.1113+1G>CPathogenic02/11/2016 
273DMDEx12NM_004006.2:c.1482+3A>GLRG_199t1:c.1482+3A>G, NM_000109.2:c.1458+3A>G, NM_000109.3:c.1458+3A>G, NM_004006.1:c.1482+3A>G, NM_004006.2:c.1482+3A>G, NM_004007.1:c.1113+3A>G, NM_004007.2:c.1113+3A>G, NM_004009.2:c.1470+3A>G, NM_004009.3:c.1470+3A>G, NM_004010.2:c.1113+3A>G, NM_004010.3:c.1113+3A>GVOUS09/02/2016
274DMDEx12NM_004006.2:c.1482+7G>TLRG_199t1:c.1482+7G>T, NM_000109.2:c.1458+7G>T, NM_000109.3:c.1458+7G>T, NM_004006.1:c.1482+7G>T, NM_004006.2:c.1482+7G>T, NM_004007.1:c.1113+7G>T, NM_004007.2:c.1113+7G>T, NM_004009.2:c.1470+7G>T, NM_004009.3:c.1470+7G>T, NM_004010.2:c.1113+7G>T, NM_004010.3:c.1113+7G>TVOUS06/23/2016
275DMDEx13NM_004006.2:Ex13:Non-amplificationOther Reportable12/07/2018 
276DMDEx13NM_004006.2:c.1483-7C>GBenign12/20/2012 
277DMDEx13NM_004006.2:c.1483-7C>ANM_000109.2:c.1459-7C>A, NM_000109.3:c.1459-7C>A, NM_004006.1:c.1483-7C>A, NM_004006.2:c.1483-7C>A, NM_004007.1:c.1114-7C>A, NM_004007.2:c.1114-7C>A, NM_004009.2:c.1471-7C>A, NM_004009.3:c.1471-7C>A, NM_004010.2:c.1114-7C>A, NM_004010.3:c.1114-7C>AVOUS12/16/2015
278DMDEx13NM_004006.2:c.1483G>Tp.Val495Leu | p.V495LLRG_199t1:c.1483G>T, NM_000109.2:c.1459G>T, NM_000109.3:c.1459G>T, NM_004006.1:c.1483G>T, NM_004006.2:c.1483G>T, NM_004007.1:c.1114G>T, NM_004007.2:c.1114G>T, NM_004009.2:c.1471G>T, NM_004009.3:c.1471G>T, NM_004010.2:c.1114G>T, NM_004010.3:c.1114G>TVOUS07/25/2016
279DMDEx13NM_004006.2:c.1489C>Tp.Gln497* | p.Q497XPathogenic** 
280DMDEx13NM_004006.2:c.1513G>Cp.Val505Leu | p.V505LNM_000109.2:c.1489G>C, NM_000109.3:c.1489G>C, NM_004006.1:c.1513G>C, NM_004006.2:c.1513G>C, NM_004007.1:c.1144G>C, NM_004007.2:c.1144G>C, NM_004009.2:c.1501G>C, NM_004009.3:c.1501G>C, NM_004010.2:c.1144G>C, NM_004010.3:c.1144G>CBenign05/31/2013 
281DMDEx13NM_004006.2:c.1518G>Tp.Arg506Ser | p.R506SLRG_199t1:c.1518G>T, NM_000109.2:c.1494G>T, NM_000109.3:c.1494G>T, NM_004006.1:c.1518G>T, NM_004006.2:c.1518G>T, NM_004007.1:c.1149G>T, NM_004007.2:c.1149G>T, NM_004009.2:c.1506G>T, NM_004009.3:c.1506G>T, NM_004010.2:c.1149G>T, NM_004010.3:c.1149G>TVOUS03/23/2017
282DMDEx13NM_004006.2:c.1523A>Gp.Asn508Ser | p.N508SLRG_199t1:c.1523A>G, NM_000109.2:c.1499A>G, NM_000109.3:c.1499A>G, NM_004006.1:c.1523A>G, NM_004006.2:c.1523A>G, NM_004007.1:c.1154A>G, NM_004007.2:c.1154A>G, NM_004009.2:c.1511A>G, NM_004009.3:c.1511A>G, NM_004010.2:c.1154A>G, NM_004010.3:c.1154A>GVOUS09/02/2016
283DMDEx13NM_004006.2:c.1529_1530delTCp.Leu510Hisfs*8 | p.L510HfsX8NM_000109.2:c.1505_1506delTC, NM_000109.3:c.1505_1506delTC, NM_004006.1:c.1529_1530delTC, NM_004006.2:c.1529_1530delTC, NM_004007.1:c.1160_1161delTC, NM_004007.2:c.1160_1161delTC, NM_004009.2:c.1517_1518delTC, NM_004009.3:c.1517_1518delTC, NM_004010.2:c.1160_1161delTC, NM_004010.3:c.1160_1161delTCPathogenic10/09/2013 
284DMDEx13NM_004006.2:c.1530dupCp.Thr511Hisfs*8 | p.T511HfsX8LRG_199t1:c.1530dupC, NM_000109.2:c.1506_1507insC, NM_000109.2:c.1506dupC, NM_000109.3:c.1506_1507insC, NM_000109.3:c.1506dupC, NM_004006.1:c.1530_1531insC, NM_004006.1:c.1530dupC, NM_004006.2:c.1530_1531insC, NM_004006.2:c.1530dupC, NM_004007.1:c.1161_1162insC, NM_004007.1:c.1161dupC, NM_004007.2:c.1161_1162insC, NM_004007.2:c.1161dupC, NM_004009.2:c.1518_1519insC, NM_004009.2:c.1518dupC, NM_004009.3:c.1518_1519insC, NM_004009.3:c.1518dupC, NM_004010.2:c.1161_1162insC, NM_004010.2:c.1161dupC, NM_004010.3:c.1161_1162insC, NM_004010.3:c.1161dupCPathogenic07/06/2018 
285DMDEx13NM_004006.2:c.1533_1534dupTCLRG_199t1:c.1534_1535insTC, NM_000109.2:c.1510_1511insTC, NM_000109.3:c.1510_1511insTC, NM_004006.1:c.1534_1535insTC, NM_004006.2:c.1534_1535insTC, NM_004007.1:c.1165_1166insTC, NM_004007.2:c.1165_1166insTC, NM_004009.2:c.1522_1523insTC, NM_004009.3:c.1522_1523insTC, NM_004010.2:c.1165_1166insTC, NM_004010.3:c.1165_1166insTCPathogenic08/22/2016 
286DMDEx13NM_004006.2:c.1533_1536delTCACp.His512Trpfs*4 | p.H512WfsX4LRG_199t1:c.1533_1536delTCAC, NM_000109.2:c.1509_1512delTCAC, NM_000109.3:c.1509_1512delTCAC, NM_004006.1:c.1533_1536delTCAC, NM_004006.2:c.1533_1536delTCAC, NM_004007.1:c.1164_1167delTCAC, NM_004007.2:c.1164_1167delTCAC, NM_004009.2:c.1521_1524delTCAC, NM_004009.3:c.1521_1524delTCAC, NM_004010.2:c.1164_1167delTCAC, NM_004010.3:c.1164_1167delTCACPathogenic12/16/2014 
287DMDEx13NM_004006.2:c.1536C>Ap.His512Gln | p.H512QLRG_199t1:c.1536C>A, NM_000109.2:c.1512C>A, NM_000109.3:c.1512C>A, NM_004006.1:c.1536C>A, NM_004006.2:c.1536C>A, NM_004007.1:c.1167C>A, NM_004007.2:c.1167C>A, NM_004009.2:c.1524C>A, NM_004009.3:c.1524C>A, NM_004010.2:c.1167C>A, NM_004010.3:c.1167C>AVOUS02/03/2017
288DMDEx13NM_004006.2:c.1554T>Ap.Asp518Glu | p.D518ENM_000109.2:c.1530T>A, NM_000109.3:c.1530T>A, NM_004006.1:c.1554T>A, NM_004006.2:c.1554T>A, NM_004007.1:c.1185T>A, NM_004007.2:c.1185T>A, NM_004009.2:c.1542T>A, NM_004009.3:c.1542T>A, NM_004010.2:c.1185T>A, NM_004010.3:c.1185T>ABenign10/04/2013 
289DMDEx13NM_004006.2:c.1573G>Ap.Ala525Thr | p.A525TLRG_199t1:c.1573G>A, NM_000109.2:c.1549G>A, NM_000109.3:c.1549G>A, NM_004006.1:c.1573G>A, NM_004006.2:c.1573G>A, NM_004007.1:c.1204G>A, NM_004007.2:c.1204G>A, NM_004009.2:c.1561G>A, NM_004009.3:c.1561G>A, NM_004010.2:c.1204G>A, NM_004010.3:c.1204G>AVOUS09/29/2016
290DMDEx13NM_004006.2:c.1582G>Ap.Ala528Thr | p.A528TLRG_199t1:c.1582G>A, NM_000109.2:c.1558G>A, NM_000109.3:c.1558G>A, NM_004006.1:c.1582G>A, NM_004006.2:c.1582G>A, NM_004007.1:c.1213G>A, NM_004007.2:c.1213G>A, NM_004009.2:c.1570G>A, NM_004009.3:c.1570G>A, NM_004010.2:c.1213G>A, NM_004010.3:c.1213G>AVOUS10/04/2016
291DMDEx13NM_004006.2:c.1594C>Tp.Gln532* | p.Q532XNM_000109.2:c.1570C>T, NM_000109.3:c.1570C>T, NM_004006.1:c.1594C>T, NM_004006.2:c.1594C>T, NM_004007.1:c.1225C>T, NM_004007.2:c.1225C>T, NM_004009.2:c.1582C>T, NM_004009.3:c.1582C>T, NM_004010.2:c.1225C>T, NM_004010.3:c.1225C>TPathogenic08/30/2017 
292DMDEx13NM_004006.2:c.1602+1G>TLRG_199t1:c.1602+1G>T, NM_000109.2:c.1578+1G>T, NM_000109.3:c.1578+1G>T, NM_004006.1:c.1602+1G>T, NM_004006.2:c.1602+1G>T, NM_004007.1:c.1233+1G>T, NM_004007.2:c.1233+1G>T, NM_004009.2:c.1590+1G>T, NM_004009.3:c.1590+1G>T, NM_004010.2:c.1233+1G>T, NM_004010.3:c.1233+1G>TPathogenic08/21/2018 
293DMDEx14NM_004006.2:Ex14:Non-amplificationOther Reportable10/31/2014 
294DMDEx14NM_004006.2:c.1603-6C>TLRG_199t1:c.1603-6C>T, NM_000109.2:c.1579-6C>T, NM_000109.3:c.1579-6C>T, NM_004006.1:c.1603-6C>T, NM_004006.2:c.1603-6C>T, NM_004007.1:c.1234-6C>T, NM_004007.2:c.1234-6C>T, NM_004009.2:c.1591-6C>T, NM_004009.3:c.1591-6C>T, NM_004010.2:c.1234-6C>T, NM_004010.3:c.1234-6C>TVOUS01/09/2017
295DMDEx14NM_004006.2:c.1603-4C>ALRG_199t1:c.1603-4C>A, NM_000109.2:c.1579-4C>A, NM_000109.3:c.1579-4C>A, NM_004006.1:c.1603-4C>A, NM_004006.2:c.1603-4C>A, NM_004007.1:c.1234-4C>A, NM_004007.2:c.1234-4C>A, NM_004009.2:c.1591-4C>A, NM_004009.3:c.1591-4C>A, NM_004010.2:c.1234-4C>A, NM_004010.3:c.1234-4C>AVOUS11/20/2018
296DMDEx14NM_004006.2:c.1603-2A>CLRG_199t1:c.1603-2A>C, NM_000109.2:c.1579-2A>C, NM_000109.3:c.1579-2A>C, NM_004006.1:c.1603-2A>C, NM_004006.2:c.1603-2A>C, NM_004007.1:c.1234-2A>C, NM_004007.2:c.1234-2A>C, NM_004009.2:c.1591-2A>C, NM_004009.3:c.1591-2A>C, NM_004010.2:c.1234-2A>C, NM_004010.3:c.1234-2A>CPathogenic01/26/2018 
297DMDEx14NM_004006.2:c.1615C>Tp.Arg539* | p.R539XPathogenic12/05/2012 
298DMDEx14NM_004006.2:c.1620G>Ap.Trp540* | p.W540XLRG_199t1:c.1620G>A, NM_000109.2:c.1596G>A, NM_000109.3:c.1596G>A, NM_004006.1:c.1620G>A, NM_004006.2:c.1620G>A, NM_004007.1:c.1251G>A, NM_004007.2:c.1251G>A, NM_004009.2:c.1608G>A, NM_004009.3:c.1608G>A, NM_004010.2:c.1251G>A, NM_004010.3:c.1251G>APathogenic05/21/2018 
299DMDEx14NM_004006.2:c.1635A>Gp.Arg545= | p.R545=NM_000109.2:c.1611A>G, NM_000109.3:c.1611A>G, NM_004006.1:c.1635A>G, NM_004006.2:c.1635A>G, NM_004007.1:c.1266A>G, NM_004007.2:c.1266A>G, NM_004009.2:c.1623A>G, NM_004009.3:c.1623A>G, NM_004010.2:c.1266A>G, NM_004010.3:c.1266A>GBenign04/17/2015 
300DMDEx14NM_004006.2:c.1649G>Cp.Arg550Pro | p.R550PLRG_199t1:c.1649G>C, NM_000109.2:c.1625G>C, NM_000109.3:c.1625G>C, NM_004006.1:c.1649G>C, NM_004006.2:c.1649G>C, NM_004007.1:c.1280G>C, NM_004007.2:c.1280G>C, NM_004009.2:c.1637G>C, NM_004009.3:c.1637G>C, NM_004010.2:c.1280G>C, NM_004010.3:c.1280G>CVOUS07/03/2019
301DMDEx14NM_004006.2:c.1652G>Ap.Trp551* | p.W551XLRG_199t1:c.1652G>A, NM_000109.2:c.1628G>A, NM_000109.3:c.1628G>A, NM_004006.1:c.1652G>A, NM_004006.2:c.1652G>A, NM_004007.1:c.1283G>A, NM_004007.2:c.1283G>A, NM_004009.2:c.1640G>A, NM_004009.3:c.1640G>A, NM_004010.2:c.1283G>A, NM_004010.3:c.1283G>APathogenic07/07/2017 
302DMDEx14NM_004006.2:c.1659_1660insGTAAp.Leu554Valfs*14 | p.L554VfsX14LRG_199t1:c.1659_1660insGTAA, NM_000109.2:c.1635_1636insGTAA, NM_000109.3:c.1635_1636insGTAA, NM_004006.1:c.1659_1660insGTAA, NM_004006.2:c.1659_1660insGTAA, NM_004007.1:c.1290_1291insGTAA, NM_004007.2:c.1290_1291insGTAA, NM_004009.2:c.1647_1648insGTAA, NM_004009.3:c.1647_1648insGTAA, NM_004010.2:c.1290_1291insGTAA, NM_004010.3:c.1290_1291insGTAAPathogenic11/21/2016 
303DMDEx14NM_004006.2:c.1663C>Tp.Gln555* | p.Q555XLRG_199t1:c.1663C>T, NM_000109.2:c.1639C>T, NM_000109.3:c.1639C>T, NM_004006.1:c.1663C>T, NM_004006.2:c.1663C>T, NM_004007.1:c.1294C>T, NM_004007.2:c.1294C>T, NM_004009.2:c.1651C>T, NM_004009.3:c.1651C>T, NM_004010.2:c.1294C>T, NM_004010.3:c.1294C>TPathogenic10/10/2017 
304DMDEx14NM_004006.2:c.1666G>Ap.Asp556Asn | p.D556NNM_000109.2:c.1642G>A, NM_000109.3:c.1642G>A, NM_004006.1:c.1666G>A, NM_004006.2:c.1666G>A, NM_004007.1:c.1297G>A, NM_004007.2:c.1297G>A, NM_004009.2:c.1654G>A, NM_004009.3:c.1654G>A, NM_004010.2:c.1297G>A, NM_004010.3:c.1297G>ABenign01/12/2016 
305DMDEx14NM_004006.2:c.1683G>Ap.Trp561* | p.W561XLRG_199t1:c.1683G>A, NM_000109.2:c.1659G>A, NM_000109.3:c.1659G>A, NM_004006.1:c.1683G>A, NM_004006.2:c.1683G>A, NM_004007.1:c.1314G>A, NM_004007.2:c.1314G>A, NM_004009.2:c.1671G>A, NM_004009.3:c.1671G>A, NM_004010.2:c.1314G>A, NM_004010.3:c.1314G>APathogenic03/15/2019 
306DMDEx14NM_004006.2:c.1687C>Ap.Arg563Ser | p.R563SLRG_199t1:c.1687C>A, NM_000109.2:c.1663C>A, NM_000109.3:c.1663C>A, NM_004006.1:c.1687C>A, NM_004006.2:c.1687C>A, NM_004007.1:c.1318C>A, NM_004007.2:c.1318C>A, NM_004009.2:c.1675C>A, NM_004009.3:c.1675C>A, NM_004010.2:c.1318C>A, NM_004010.3:c.1318C>AVOUS12/22/2016
307DMDEx14NM_004006.2:c.1687C>Tp.Arg563Cys | p.R563CLRG_199t1:c.1687C>T, NM_000109.2:c.1663C>T, NM_000109.3:c.1663C>T, NM_004006.1:c.1687C>T, NM_004006.2:c.1687C>T, NM_004007.1:c.1318C>T, NM_004007.2:c.1318C>T, NM_004009.2:c.1675C>T, NM_004009.3:c.1675C>T, NM_004010.2:c.1318C>T, NM_004010.3:c.1318C>TVOUS07/29/2016
308DMDEx14NM_004006.2:c.1704+1G>ANM_000109.2:c.1680+1G>A, NM_000109.3:c.1680+1G>A, NM_004006.1:c.1704+1G>A, NM_004006.2:c.1704+1G>A, NM_004007.1:c.1335+1G>A, NM_004007.2:c.1335+1G>A, NM_004009.2:c.1692+1G>A, NM_004009.3:c.1692+1G>A, NM_004010.2:c.1335+1G>A, NM_004010.3:c.1335+1G>APathogenic04/20/2015 
309DMDEx14NM_004006.2:c.1704+3G>ALRG_199t1:c.1704+3G>A, NM_000109.2:c.1680+3G>A, NM_000109.3:c.1680+3G>A, NM_004006.1:c.1704+3G>A, NM_004006.2:c.1704+3G>A, NM_004007.1:c.1335+3G>A, NM_004007.2:c.1335+3G>A, NM_004009.2:c.1692+3G>A, NM_004009.3:c.1692+3G>A, NM_004010.2:c.1335+3G>A, NM_004010.3:c.1335+3G>AVOUS08/07/2017
310DMDEx14NM_004006.2:c.1704+51T>CBenign** 
311DMDEx15NM_004006.2:Ex15:Non-amplificationOther Reportable10/31/2014 
312DMDEx15NM_004006.2:c.1724T>Cp.Leu575Pro | p.L575PLRG_199t1:c.1724T>C, NM_000109.2:c.1700T>C, NM_000109.3:c.1700T>C, NM_004006.1:c.1724T>C, NM_004006.2:c.1724T>C, NM_004007.1:c.1355T>C, NM_004007.2:c.1355T>C, NM_004009.2:c.1712T>C, NM_004009.3:c.1712T>C, NM_004010.2:c.1355T>C, NM_004010.3:c.1355T>CVOUS12/26/2017
313DMDEx15NM_004006.2:c.1731A>Tp.Glu577Asp | p.E577DLRG_199t1:c.1731A>T, NM_000109.2:c.1707A>T, NM_000109.3:c.1707A>T, NM_004006.1:c.1731A>T, NM_004006.2:c.1731A>T, NM_004007.1:c.1362A>T, NM_004007.2:c.1362A>T, NM_004009.2:c.1719A>T, NM_004009.3:c.1719A>T, NM_004010.2:c.1362A>T, NM_004010.3:c.1362A>TLikely benign08/02/2019 
314DMDEx15NM_004006.2:c.1734delAPathogenic** 
315DMDEx15NM_004006.2:c.1762A>Gp.Thr588Ala | p.T588ALRG_199t1:c.1762A>G, NM_000109.2:c.1738A>G, NM_000109.3:c.1738A>G, NM_004006.1:c.1762A>G, NM_004006.2:c.1762A>G, NM_004007.1:c.1393A>G, NM_004007.2:c.1393A>G, NM_004009.2:c.1750A>G, NM_004009.3:c.1750A>G, NM_004010.2:c.1393A>G, NM_004010.3:c.1393A>GVOUS09/12/2018
316DMDEx15NM_004006.2:c.1769_1772dupTTAAp.Lys591Asnfs*2 | p.K591NfsX2LRG_199t1:c.1769_1772dupTTAA, NM_000109.2:c.1745_1748dupTTAA, NM_000109.3:c.1745_1748dupTTAA, NM_004006.1:c.1769_1772dupTTAA, NM_004006.2:c.1769_1772dupTTAA, NM_004007.1:c.1400_1403dupTTAA, NM_004007.2:c.1400_1403dupTTAA, NM_004009.2:c.1757_1760dupTTAA, NM_004009.3:c.1757_1760dupTTAA, NM_004010.2:c.1400_1403dupTTAA, NM_004010.3:c.1400_1403dupTTAAPathogenic04/24/2018 
317DMDEx15NM_004006.2:c.1809G>Ap.Leu603= | p.L603=NM_000109.2:c.1785G>A, NM_000109.3:c.1785G>A, NM_004006.1:c.1809G>A, NM_004006.2:c.1809G>A, NM_004007.1:c.1440G>A, NM_004007.2:c.1440G>A, NM_004009.2:c.1797G>A, NM_004009.3:c.1797G>A, NM_004010.2:c.1440G>A, NM_004010.3:c.1440G>ABenign01/12/2016 
318DMDEx15NM_004006.2:c.1812C>Tp.Ala604= | p.A604=NM_000109.2:c.1788C>T, NM_000109.3:c.1788C>T, NM_004006.1:c.1812C>T, NM_004006.2:c.1812C>T, NM_004007.1:c.1443C>T, NM_004007.2:c.1443C>T, NM_004009.2:c.1800C>T, NM_004009.3:c.1800C>T, NM_004010.2:c.1443C>T, NM_004010.3:c.1443C>TBenign05/21/2018 
319DMDEx15NM_004006.2:c.1812+2T>ALRG_199t1:c.1812+2T>A, NM_000109.2:c.1788+2T>A, NM_000109.3:c.1788+2T>A, NM_004006.1:c.1812+2T>A, NM_004006.2:c.1812+2T>A, NM_004007.1:c.1443+2T>A, NM_004007.2:c.1443+2T>A, NM_004009.2:c.1800+2T>A, NM_004009.3:c.1800+2T>A, NM_004010.2:c.1443+2T>A, NM_004010.3:c.1443+2T>APathogenic05/10/2017 
320DMDEx16NM_004006.2:Ex16:Non-amplificationOther Reportable10/31/2014 
321DMDEx16NM_004006.2:c.1813-8_1813-6delTTTLRG_199t1:c.1813-8_1813-6delTTT, NM_000109.2:c.1789-8_1789-6delTTT, NM_000109.3:c.1789-8_1789-6delTTT, NM_004006.1:c.1813-8_1813-6delTTT, NM_004006.2:c.1813-8_1813-6delTTT, NM_004007.1:c.1444-8_1444-6delTTT, NM_004007.2:c.1444-8_1444-6delTTT, NM_004009.2:c.1801-8_1801-6delTTT, NM_004009.3:c.1801-8_1801-6delTTT, NM_004010.2:c.1444-8_1444-6delTTT, NM_004010.3:c.1444-8_1444-6delTTTVOUS01/05/2017
322DMDEx16NM_004006.2:c.1813-3C>GLRG_199t1:c.1813-3C>G, NM_000109.2:c.1789-3C>G, NM_000109.3:c.1789-3C>G, NM_004006.1:c.1813-3C>G, NM_004006.2:c.1813-3C>G, NM_004007.1:c.1444-3C>G, NM_004007.2:c.1444-3C>G, NM_004009.2:c.1801-3C>G, NM_004009.3:c.1801-3C>G, NM_004010.2:c.1444-3C>G, NM_004010.3:c.1444-3C>GVOUS10/11/2016
323DMDEx16NM_004006.2:c.1813-3C>TNM_000109.2:c.1789-3C>T, NM_000109.3:c.1789-3C>T, NM_004006.1:c.1813-3C>T, NM_004006.2:c.1813-3C>T, NM_004007.1:c.1444-3C>T, NM_004007.2:c.1444-3C>T, NM_004009.2:c.1801-3C>T, NM_004009.3:c.1801-3C>T, NM_004010.2:c.1444-3C>T, NM_004010.3:c.1444-3C>TVOUS10/23/2015
324DMDEx16NM_004006.2:c.1813-3C>ANM_000109.2:c.1789-3C>A, NM_000109.3:c.1789-3C>A, NM_004006.1:c.1813-3C>A, NM_004006.2:c.1813-3C>A, NM_004007.1:c.1444-3C>A, NM_004007.2:c.1444-3C>A, NM_004009.2:c.1801-3C>A, NM_004009.3:c.1801-3C>A, NM_004010.2:c.1444-3C>A, NM_004010.3:c.1444-3C>ALikely benign06/16/2015 
325DMDEx16NM_004006.2:c.1839A>Tp.Lys613Asn | p.K613NNM_000109.2:c.1815A>T, NM_000109.3:c.1815A>T, NM_004006.1:c.1839A>T, NM_004006.2:c.1839A>T, NM_004007.1:c.1470A>T, NM_004007.2:c.1470A>T, NM_004009.2:c.1827A>T, NM_004009.3:c.1827A>T, NM_004010.2:c.1470A>T, NM_004010.3:c.1470A>TVOUS12/16/2015
326DMDEx16NM_004006.2:c.1848C>Ap.Ser616= | p.S616=NM_000109.2:c.1824C>A, NM_000109.3:c.1824C>A, NM_004006.1:c.1848C>A, NM_004006.2:c.1848C>A, NM_004007.1:c.1479C>A, NM_004007.2:c.1479C>A, NM_004009.2:c.1836C>A, NM_004009.3:c.1836C>A, NM_004010.2:c.1479C>A, NM_004010.3:c.1479C>AVOUS08/24/2015
327DMDEx16NM_004006.2:c.1869C>Tp.Leu623= | p.L623=NM_000109.2:c.1845C>T, NM_000109.3:c.1845C>T, NM_004006.1:c.1869C>T, NM_004006.2:c.1869C>T, NM_004007.1:c.1500C>T, NM_004007.2:c.1500C>T, NM_004009.2:c.1857C>T, NM_004009.3:c.1857C>T, NM_004010.2:c.1500C>T, NM_004010.3:c.1500C>TBenign04/29/2014 
328DMDEx16NM_004006.2:c.1869C>Gp.Leu623= | p.L623=LRG_199t1:c.1869C>G, NM_000109.2:c.1845C>G, NM_000109.3:c.1845C>G, NM_004006.1:c.1869C>G, NM_004006.2:c.1869C>G, NM_004007.1:c.1500C>G, NM_004007.2:c.1500C>G, NM_004009.2:c.1857C>G, NM_004009.3:c.1857C>G, NM_004010.2:c.1500C>G, NM_004010.3:c.1500C>GLikely benign10/27/2016 
329DMDEx16NM_004006.2:c.1886C>Ap.Ser629* | p.S629XLRG_199t1:c.1886C>A, NM_000109.2:c.1862C>A, NM_000109.3:c.1862C>A, NM_004006.1:c.1886C>A, NM_004006.2:c.1886C>A, NM_004007.1:c.1517C>A, NM_004007.2:c.1517C>A, NM_004009.2:c.1874C>A, NM_004009.3:c.1874C>A, NM_004010.2:c.1517C>A, NM_004010.3:c.1517C>APathogenic04/09/2013 
330DMDEx16NM_004006.2:c.1888A>Gp.Thr630Ala | p.T630ANM_000109.2:c.1864A>G, NM_000109.3:c.1864A>G, NM_004006.1:c.1888A>G, NM_004006.2:c.1888A>G, NM_004007.1:c.1519A>G, NM_004007.2:c.1519A>G, NM_004009.2:c.1876A>G, NM_004009.3:c.1876A>G, NM_004010.2:c.1519A>G, NM_004010.3:c.1519A>GBenign11/21/2015 
331DMDEx16NM_004006.2:c.1897A>Tp.Asn633Tyr | p.N633YLRG_199t1:c.1897A>T, NM_000109.2:c.1873A>T, NM_000109.3:c.1873A>T, NM_004006.1:c.1897A>T, NM_004006.2:c.1897A>T, NM_004007.1:c.1528A>T, NM_004007.2:c.1528A>T, NM_004009.2:c.1885A>T, NM_004009.3:c.1885A>T, NM_004010.2:c.1528A>T, NM_004010.3:c.1528A>TVOUS02/28/2017
332DMDEx16NM_004006.2:c.1900A>Tp.Lys634* | p.K634XPathogenic** 
333DMDEx16NM_004006.2:c.1900_1903dupAAGTNM_000109.2:c.1875_1876insAAGT, NM_000109.2:c.1876_1879dup, NM_000109.3:c.1875_1876insAAGT, NM_000109.3:c.1876_1879dup, NM_004006.1:c.1899_1900insAAGT, NM_004006.1:c.1900_1903dup, NM_004006.2:c.1899_1900insAAGT, NM_004006.2:c.1900_1903dup, NM_004007.1:c.1530_1531insAAGT, NM_004007.1:c.1531_1534dup, NM_004007.2:c.1530_1531insAAGT, NM_004007.2:c.1531_1534dup, NM_004009.2:c.1887_1888insAAGT, NM_004009.2:c.1888_1891dup, NM_004009.3:c.1887_1888insAAGT, NM_004009.3:c.1888_1891dup, NM_004010.2:c.1530_1531insAAGT, NM_004010.2:c.1531_1534dup, NM_004010.3:c.1530_1531insAAGT, NM_004010.3:c.1531_1534dupPathogenic** 
334DMDEx16NM_004006.2:c.1912C>Tp.Gln638* | p.Q638XNM_000109.2:c.1888C>T, NM_000109.3:c.1888C>T, NM_004006.1:c.1912C>T, NM_004006.2:c.1912C>T, NM_004007.1:c.1543C>T, NM_004007.2:c.1543C>T, NM_004009.2:c.1900C>T, NM_004009.3:c.1900C>T, NM_004010.2:c.1543C>T, NM_004010.3:c.1543C>TPathogenic02/24/2015 
335DMDEx16NM_004006.2:c.1919C>Tp.Thr640Met | p.T640MLRG_199t1:c.1919C>T, NM_000109.2:c.1895C>T, NM_000109.3:c.1895C>T, NM_004006.1:c.1919C>T, NM_004006.2:c.1919C>T, NM_004007.1:c.1550C>T, NM_004007.2:c.1550C>T, NM_004009.2:c.1907C>T, NM_004009.3:c.1907C>T, NM_004010.2:c.1550C>T, NM_004010.3:c.1550C>TVOUS12/28/2017
336DMDEx16NM_004006.2:c.1934A>Gp.Asp645Gly | p.D645GNM_000109.2:c.1910A>G, NM_000109.3:c.1910A>G, NM_004006.1:c.1934A>G, NM_004006.2:c.1934A>G, NM_004007.1:c.1565A>G, NM_004007.2:c.1565A>G, NM_004009.2:c.1922A>G, NM_004009.3:c.1922A>G, NM_004010.2:c.1565A>G, NM_004010.3:c.1565A>GLikely benign08/29/2016 
337DMDEx16NM_004006.2:c.1952G>Ap.Trp651* | p.W651XPathogenic** 
338DMDEx16NM_004006.2:c.1956delTLRG_199t1:c.1956delT, NM_000109.2:c.1932delT, NM_000109.3:c.1932delT, NM_004006.1:c.1956delT, NM_004006.2:c.1956delT, NM_004007.1:c.1587delT, NM_004007.2:c.1587delT, NM_004009.2:c.1944delT, NM_004009.3:c.1944delT, NM_004010.2:c.1587delT, NM_004010.3:c.1587delTPathogenic05/05/2016 
339DMDEx16NM_004006.2:c.1978_1979delAAp.Lys660Glufs*59 | p.K660EfsX59LRG_199t1:c.1978_1979delAA, NM_000109.2:c.1954_1955delAA, NM_000109.3:c.1954_1955delAA, NM_004006.1:c.1978_1979delAA, NM_004006.2:c.1978_1979delAA, NM_004007.1:c.1609_1610delAA, NM_004007.2:c.1609_1610delAA, NM_004009.2:c.1966_1967delAA, NM_004009.3:c.1966_1967delAA, NM_004010.2:c.1609_1610delAA, NM_004010.3:c.1609_1610delAAPathogenic05/17/2018 
340DMDEx16NM_004006.2:c.1988C>Tp.Ala663Val | p.A663VNM_000109.2:c.1964C>T, NM_000109.3:c.1964C>T, NM_004006.1:c.1988C>T, NM_004006.2:c.1988C>T, NM_004007.1:c.1619C>T, NM_004007.2:c.1619C>T, NM_004009.2:c.1976C>T, NM_004009.3:c.1976C>T, NM_004010.2:c.1619C>T, NM_004010.3:c.1619C>TVOUS09/09/2015
341DMDEx16NM_004006.2:c.1990C>Tp.Gln664* | p.Q664XPathogenic12/11/2012 
342DMDEx17NM_004006.2:Ex17:Non-amplificationOther Reportable10/31/2014 
343DMDEx17NM_004006.2:c.1997C>Tp.Ser666Leu | p.S666LNM_000109.2:c.1973C>T, NM_000109.3:c.1973C>T, NM_004006.1:c.1997C>T, NM_004006.2:c.1997C>T, NM_004007.1:c.1628C>T, NM_004007.2:c.1628C>T, NM_004009.2:c.1985C>T, NM_004009.3:c.1985C>T, NM_004010.2:c.1628C>T, NM_004010.3:c.1628C>TBenign08/01/2013 
344DMDEx17NM_004006.2:c.2032_2033delCANM_000109.2:c.2008_2009delCA, NM_000109.3:c.2008_2009delCA, NM_004006.1:c.2032_2033delCA, NM_004006.2:c.2032_2033delCA, NM_004007.1:c.1663_1664delCA, NM_004007.2:c.1663_1664delCA, NM_004009.2:c.2020_2021delCA, NM_004009.3:c.2020_2021delCA, NM_004010.2:c.1663_1664delCA, NM_004010.3:c.1663_1664delCAPathogenic** 
345DMDEx17NM_004006.2:c.2032C>Tp.Gln678* | p.Q678XPathogenic10/05/2012 
346DMDEx17NM_004006.2:c.2039C>Ap.Thr680Asn | p.T680NNM_000109.2:c.2015C>A, NM_000109.3:c.2015C>A, NM_004006.1:c.2039C>A, NM_004006.2:c.2039C>A, NM_004007.1:c.1670C>A, NM_004007.2:c.1670C>A, NM_004009.2:c.2027C>A, NM_004009.3:c.2027C>A, NM_004010.2:c.1670C>A, NM_004010.3:c.1670C>AVOUS12/09/2014
347DMDEx17NM_004006.2:c.2052_2053delAGLRG_199t1:c.2052_2053delAG, NM_000109.2:c.2028_2029delAG, NM_000109.3:c.2028_2029delAG, NM_004006.1:c.2052_2053delAG, NM_004006.2:c.2052_2053delAG, NM_004007.1:c.1683_1684delAG, NM_004007.2:c.1683_1684delAG, NM_004009.2:c.2040_2041delAG, NM_004009.3:c.2040_2041delAG, NM_004010.2:c.1683_1684delAG, NM_004010.3:c.1683_1684delAGPathogenic05/12/2016 
348DMDEx17NM_004006.2:c.2096C>Gp.Ala699Gly | p.A699GNM_000109.2:c.2072C>G, NM_000109.3:c.2072C>G, NM_004006.1:c.2096C>G, NM_004006.2:c.2096C>G, NM_004007.1:c.1727C>G, NM_004007.2:c.1727C>G, NM_004009.2:c.2084C>G, NM_004009.3:c.2084C>G, NM_004010.2:c.1727C>G, NM_004010.3:c.1727C>GBenign02/18/2015 
349DMDEx17NM_004006.2:c.2117C>Ap.Pro706Gln | p.P706QNM_000109.2:c.2093C>A, NM_000109.3:c.2093C>A, NM_004006.1:c.2117C>A, NM_004006.2:c.2117C>A, NM_004007.1:c.1748C>A, NM_004007.2:c.1748C>A, NM_004009.2:c.2105C>A, NM_004009.3:c.2105C>A, NM_004010.2:c.1748C>A, NM_004010.3:c.1748C>AVOUS06/17/2014
350DMDEx17NM_004006.2:c.2125delCNM_000109.2:c.2101delC, NM_000109.3:c.2101delC, NM_004006.1:c.2125delC, NM_004006.2:c.2125delC, NM_004007.1:c.1756delC, NM_004007.2:c.1756delC, NM_004009.2:c.2113delC, NM_004009.3:c.2113delC, NM_004010.2:c.1756delC, NM_004010.3:c.1756delCPathogenic02/25/2013 
351DMDEx17NM_004006.2:c.2129delAp.Lys710Argfs*19 | p.K710RfsX19LRG_199t1:c.2129delA, NM_000109.2:c.2105delA, NM_000109.3:c.2105delA, NM_004006.1:c.2129delA, NM_004006.2:c.2129delA, NM_004007.1:c.1760delA, NM_004007.2:c.1760delA, NM_004009.2:c.2117delA, NM_004009.3:c.2117delA, NM_004010.2:c.1760delA, NM_004010.3:c.1760delAPathogenic01/10/2018 
352DMDEx17NM_004006.2:c.2132delAp.Lys711Argfs*18 | p.K711RfsX18LRG_199t1:c.2132delA, NM_000109.2:c.2108delA, NM_000109.3:c.2108delA, NM_004006.1:c.2132delA, NM_004006.2:c.2132delA, NM_004007.1:c.1763delA, NM_004007.2:c.1763delA, NM_004009.2:c.2120delA, NM_004009.3:c.2120delA, NM_004010.2:c.1763delA, NM_004010.3:c.1763delAPathogenic05/02/2017 
353DMDEx17NM_004006.2:c.2137C>Tp.Gln713* | p.Q713XPathogenic** 
354DMDEx17NM_004006.2:c.2143A>Tp.Thr715Ser | p.T715SNM_000109.2:c.2119A>T, NM_000109.3:c.2119A>T, NM_004006.1:c.2143A>T, NM_004006.2:c.2143A>T, NM_004007.1:c.1774A>T, NM_004007.2:c.1774A>T, NM_004009.2:c.2131A>T, NM_004009.3:c.2131A>T, NM_004010.2:c.1774A>T, NM_004010.3:c.1774A>TBenign11/17/2014 
355DMDEx17NM_004006.2:c.2143A>Cp.Thr715Pro | p.T715PLRG_199t1:c.2143A>C, NM_000109.2:c.2119A>C, NM_000109.3:c.2119A>C, NM_004006.1:c.2143A>C, NM_004006.2:c.2143A>C, NM_004007.1:c.1774A>C, NM_004007.2:c.1774A>C, NM_004009.2:c.2131A>C, NM_004009.3:c.2131A>C, NM_004010.2:c.1774A>C, NM_004010.3:c.1774A>CVOUS12/22/2017
356DMDEx17NM_004006.2:c.2146G>Cp.Val716Leu | p.V716LNM_000109.2:c.2122G>C, NM_000109.3:c.2122G>C, NM_004006.1:c.2146G>C, NM_004006.2:c.2146G>C, NM_004007.1:c.1777G>C, NM_004007.2:c.1777G>C, NM_004009.2:c.2134G>C, NM_004009.3:c.2134G>C, NM_004010.2:c.1777G>C, NM_004010.3:c.1777G>CVOUS04/23/2018
357DMDEx17NM_004006.2:c.2166A>Gp.Lys722= | p.K722=LRG_199t1:c.2166A>G, NM_000109.2:c.2142A>G, NM_000109.3:c.2142A>G, NM_004006.1:c.2166A>G, NM_004006.2:c.2166A>G, NM_004007.1:c.1797A>G, NM_004007.2:c.1797A>G, NM_004009.2:c.2154A>G, NM_004009.3:c.2154A>G, NM_004010.2:c.1797A>G, NM_004010.3:c.1797A>GVOUS05/24/2017
358DMDEx17NM_004006.2:c.2168+1G>APathogenic05/31/2019 
359DMDEx17NM_004006.2:c.2168+1G>CPathogenic05/31/2019 
360DMDEx17NM_004006.2:c.2168+2T>GNM_000109.2:c.2144+2T>G, NM_000109.3:c.2144+2T>G, NM_004006.1:c.2168+2T>G, NM_004006.2:c.2168+2T>G, NM_004007.1:c.1799+2T>G, NM_004007.2:c.1799+2T>G, NM_004009.2:c.2156+2T>G, NM_004009.3:c.2156+2T>G, NM_004010.2:c.1799+2T>G, NM_004010.3:c.1799+2T>GPathogenic10/06/2015 
361DMDEx17NM_004006.2:c.2168+13T>CNM_000109.2:c.2144+13T>C, NM_000109.3:c.2144+13T>C, NM_004006.1:c.2168+13T>C, NM_004006.2:c.2168+13T>C, NM_004007.1:c.1799+13T>C, NM_004007.2:c.1799+13T>C, NM_004009.2:c.2156+13T>C, NM_004009.3:c.2156+13T>C, NM_004010.2:c.1799+13T>C, NM_004010.3:c.1799+13T>CBenign04/24/2017 
362DMDEx18NM_004006.2:c.2169-7G>TVOUS**
363DMDEx18NM_004006.2:c.2169-3_2169-1delinsAANM_000109.2:c.2145-3_2145-1delinsAA, NM_000109.3:c.2145-3_2145-1delinsAA, NM_004006.1:c.2169-3_2169-1delinsAA, NM_004006.2:c.2169-3_2169-1delinsAA, NM_004007.1:c.1800-3_1800-1delinsAA, NM_004007.2:c.1800-3_1800-1delinsAA, NM_004009.2:c.2157-3_2157-1delinsAA, NM_004009.3:c.2157-3_2157-1delinsAA, NM_004010.2:c.1800-3_1800-1delinsAA, NM_004010.3:c.1800-3_1800-1delinsAAPathogenic** 
364DMDEx18NM_004006.2:c.2173G>Tp.Asp725Tyr | p.D725YNM_000109.2:c.2149G>T, NM_000109.3:c.2149G>T, NM_004006.1:c.2173G>T, NM_004006.2:c.2173G>T, NM_004007.1:c.1804G>T, NM_004007.2:c.1804G>T, NM_004009.2:c.2161G>T, NM_004009.3:c.2161G>T, NM_004010.2:c.1804G>T, NM_004010.3:c.1804G>TBenign09/03/2015 
365DMDEx18NM_004006.2:c.2176G>Tp.Val726Phe | p.V726FLRG_199t1:c.2176G>T, NM_000109.2:c.2152G>T, NM_000109.3:c.2152G>T, NM_004006.1:c.2176G>T, NM_004006.2:c.2176G>T, NM_004007.1:c.1807G>T, NM_004007.2:c.1807G>T, NM_004009.2:c.2164G>T, NM_004009.3:c.2164G>T, NM_004010.2:c.1807G>T, NM_004010.3:c.1807G>TVOUS05/01/2018
366DMDEx18NM_004006.2:c.2183T>Cp.Ile728Thr | p.I728TLRG_199t1:c.2183T>C, NM_000109.2:c.2159T>C, NM_000109.3:c.2159T>C, NM_004006.1:c.2183T>C, NM_004006.2:c.2183T>C, NM_004007.1:c.1814T>C, NM_004007.2:c.1814T>C, NM_004009.2:c.2171T>C, NM_004009.3:c.2171T>C, NM_004010.2:c.1814T>C, NM_004010.3:c.1814T>CVOUS03/01/2016
367DMDEx18NM_004006.2:c.2195dupAp.His732Glnfs*15 | p.H732QfsX15LRG_199t1:c.2195dupA, NM_000109.2:c.2171dupA, NM_000109.3:c.2171dupA, NM_004006.1:c.2195dupA, NM_004006.2:c.2195dupA, NM_004007.1:c.1826dupA, NM_004007.2:c.1826dupA, NM_004009.2:c.2183dupA, NM_004009.3:c.2183dupA, NM_004010.2:c.1826dupA, NM_004010.3:c.1826dupAPathogenic08/04/2017 
368DMDEx18NM_004006.2:c.2199C>Tp.Ser733= | p.S733=NM_000109.2:c.2175C>T, NM_000109.3:c.2175C>T, NM_004006.1:c.2199C>T, NM_004006.2:c.2199C>T, NM_004007.1:c.1830C>T, NM_004007.2:c.1830C>T, NM_004009.2:c.2187C>T, NM_004009.3:c.2187C>T, NM_004010.2:c.1830C>T, NM_004010.3:c.1830C>TBenign09/19/2015 
369DMDEx18NM_004006.2:c.2200T>Cp.Trp734Arg | p.W734RNM_000109.2:c.2176T>C, NM_000109.3:c.2176T>C, NM_004006.1:c.2200T>C, NM_004006.2:c.2200T>C, NM_004007.1:c.1831T>C, NM_004007.2:c.1831T>C, NM_004009.2:c.2188T>C, NM_004009.3:c.2188T>C, NM_004010.2:c.1831T>C, NM_004010.3:c.1831T>CVOUS06/02/2015
370DMDEx18NM_004006.2:c.2210G>Ap.Arg737His | p.R737HLRG_199t1:c.2210G>A, NM_000109.2:c.2186G>A, NM_000109.3:c.2186G>A, NM_004006.1:c.2210G>A, NM_004006.2:c.2210G>A, NM_004007.1:c.1841G>A, NM_004007.2:c.1841G>A, NM_004009.2:c.2198G>A, NM_004009.3:c.2198G>A, NM_004010.2:c.1841G>A, NM_004010.3:c.1841G>AVOUS08/18/2016
371DMDEx18NM_004006.2:c.2243C>Tp.Ala748Val | p.A748VLRG_199t1:c.2243C>T, NM_000109.2:c.2219C>T, NM_000109.3:c.2219C>T, NM_004006.1:c.2243C>T, NM_004006.2:c.2243C>T, NM_004007.1:c.1874C>T, NM_004007.2:c.1874C>T, NM_004009.2:c.2231C>T, NM_004009.3:c.2231C>T, NM_004010.2:c.1874C>T, NM_004010.3:c.1874C>TVOUS08/24/2018
372DMDEx18NM_004006.2:c.2245A>Gp.Ile749Val | p.I749VNM_000109.2:c.2221A>G, NM_000109.3:c.2221A>G, NM_004006.1:c.2245A>G, NM_004006.2:c.2245A>G, NM_004007.1:c.1876A>G, NM_004007.2:c.1876A>G, NM_004009.2:c.2233A>G, NM_004009.3:c.2233A>G, NM_004010.2:c.1876A>G, NM_004010.3:c.1876A>GVOUS01/25/2016
373DMDEx18NM_004006.2:c.2249T>Cp.Phe750Ser | p.F750SLRG_199t1:c.2249T>C, NM_000109.2:c.2225T>C, NM_000109.3:c.2225T>C, NM_004006.1:c.2249T>C, NM_004006.2:c.2249T>C, NM_004007.1:c.1880T>C, NM_004007.2:c.1880T>C, NM_004009.2:c.2237T>C, NM_004009.3:c.2237T>C, NM_004010.2:c.1880T>C, NM_004010.3:c.1880T>CVOUS11/28/2016
374DMDEx18NM_004006.2:c.2261G>Tp.Gly754Val | p.G754VNM_000109.2:c.2237G>T, NM_000109.3:c.2237G>T, NM_004006.1:c.2261G>T, NM_004006.2:c.2261G>T, NM_004007.1:c.1892G>T, NM_004007.2:c.1892G>T, NM_004009.2:c.2249G>T, NM_004009.3:c.2249G>T, NM_004010.2:c.1892G>T, NM_004010.3:c.1892G>TBenign01/19/2018 
375DMDEx18NM_004006.2:c.2281_2285delGAAAAp.Glu761Serfs*10 | p.E761SfsX10LRG_199t1:c.2281_2285delGAAAA, NM_000109.2:c.2257_2261delGAAAA, NM_000109.3:c.2257_2261delGAAAA, NM_004006.1:c.2281_2285delGAAAA, NM_004006.2:c.2281_2285delGAAAA, NM_004007.1:c.1912_1916delGAAAA, NM_004007.2:c.1912_1916delGAAAA, NM_004009.2:c.2269_2273delGAAAA, NM_004009.3:c.2269_2273delGAAAA, NM_004010.2:c.1912_1916delGAAAA, NM_004010.3:c.1912_1916delGAAAAPathogenic07/21/2019 
376DMDEx18NM_004006.2:c.2291A>Gp.Asn764Ser | p.N764SLRG_199t1:c.2291A>G, NM_000109.2:c.2267A>G, NM_000109.3:c.2267A>G, NM_004006.1:c.2291A>G, NM_004006.2:c.2291A>G, NM_004007.1:c.1922A>G, NM_004007.2:c.1922A>G, NM_004009.2:c.2279A>G, NM_004009.3:c.2279A>G, NM_004010.2:c.1922A>G, NM_004010.3:c.1922A>GVOUS06/03/2016
377DMDEx19NM_004006.2:c.2293-15G>CVOUS**
378DMDEx19NM_004006.2:c.2293-8T>CLRG_199t1:c.2293-8T>C, NM_000109.2:c.2269-8T>C, NM_000109.3:c.2269-8T>C, NM_004006.1:c.2293-8T>C, NM_004006.2:c.2293-8T>C, NM_004007.1:c.1924-8T>C, NM_004007.2:c.1924-8T>C, NM_004009.2:c.2281-8T>C, NM_004009.3:c.2281-8T>C, NM_004010.2:c.1924-8T>C, NM_004010.3:c.1924-8T>CVOUS04/20/2018
379DMDEx19NM_004006.2:c.2293-3C>TNM_000109.2:c.2269-3C>T, NM_000109.3:c.2269-3C>T, NM_004006.1:c.2293-3C>T, NM_004006.2:c.2293-3C>T, NM_004007.1:c.1924-3C>T, NM_004007.2:c.1924-3C>T, NM_004009.2:c.2281-3C>T, NM_004009.3:c.2281-3C>T, NM_004010.2:c.1924-3C>T, NM_004010.3:c.1924-3C>TVOUS07/14/2015
380DMDEx19NM_004006.2:c.2294_2297delCCATNM_000109.2:c.2270_2273delCCAT, NM_000109.3:c.2270_2273delCCAT, NM_004006.1:c.2294_2297delCCAT, NM_004006.2:c.2294_2297delCCAT, NM_004007.1:c.1925_1928delCCAT, NM_004007.2:c.1925_1928delCCAT, NM_004009.2:c.2282_2285delCCAT, NM_004009.3:c.2282_2285delCCAT, NM_004010.2:c.1925_1928delCCAT, NM_004010.3:c.1925_1928delCCATPathogenic05/30/2013 
381DMDEx19NM_004006.2:c.2302C>Tp.Arg768* | p.R768XLRG_199t1:c.2302C>T, NM_000109.2:c.2278C>T, NM_000109.3:c.2278C>T, NM_004006.1:c.2302C>T, NM_004006.2:c.2302C>T, NM_004007.1:c.1933C>T, NM_004007.2:c.1933C>T, NM_004009.2:c.2290C>T, NM_004009.3:c.2290C>T, NM_004010.2:c.1933C>T, NM_004010.3:c.1933C>TPathogenic08/15/2017 
382DMDEx19NM_004006.2:c.2316_2317delGANM_000109.2:c.2292_2293delGA, NM_000109.3:c.2292_2293delGA, NM_004006.1:c.2316_2317delGA, NM_004006.2:c.2316_2317delGA, NM_004007.1:c.1947_1948delGA, NM_004007.2:c.1947_1948delGA, NM_004009.2:c.2304_2305delGA, NM_004009.3:c.2304_2305delGA, NM_004010.2:c.1947_1948delGA, NM_004010.3:c.1947_1948delGAPathogenic08/11/2015 
383DMDEx19NM_004006.2:c.2323A>Gp.Arg775Gly | p.R775GLRG_199t1:c.2323A>G, NM_000109.2:c.2299A>G, NM_000109.3:c.2299A>G, NM_004006.1:c.2323A>G, NM_004006.2:c.2323A>G, NM_004007.1:c.1954A>G, NM_004007.2:c.1954A>G, NM_004009.2:c.2311A>G, NM_004009.3:c.2311A>G, NM_004010.2:c.1954A>G, NM_004010.3:c.1954A>GVOUS09/14/2016
384DMDEx19NM_004006.2:c.2330T>Cp.Leu777Pro | p.L777PNM_000109.2:c.2306T>C, NM_000109.3:c.2306T>C, NM_004006.1:c.2330T>C, NM_004006.2:c.2330T>C, NM_004007.1:c.1961T>C, NM_004007.2:c.1961T>C, NM_004009.2:c.2318T>C, NM_004009.3:c.2318T>C, NM_004010.2:c.1961T>C, NM_004010.3:c.1961T>CVOUS04/17/2015
385DMDEx19NM_004006.2:c.2331G>Cp.Leu777= | p.L777=Benign** 
386DMDEx19NM_004006.2:c.2332C>Tp.Gln778* | p.Q778XNM_000109.2:c.2308C>T, NM_000109.3:c.2308C>T, NM_004006.1:c.2332C>T, NM_004006.2:c.2332C>T, NM_004007.1:c.1963C>T, NM_004007.2:c.1963C>T, NM_004009.2:c.2320C>T, NM_004009.3:c.2320C>T, NM_004010.2:c.1963C>T, NM_004010.3:c.1963C>TPathogenic04/19/2013 
387DMDEx19NM_004006.2:c.2344A>Cp.Arg782= | p.R782=LRG_199t1:c.2344A>C, NM_000109.2:c.2320A>C, NM_000109.3:c.2320A>C, NM_004006.1:c.2344A>C, NM_004006.2:c.2344A>C, NM_004007.1:c.1975A>C, NM_004007.2:c.1975A>C, NM_004009.2:c.2332A>C, NM_004009.3:c.2332A>C, NM_004010.2:c.1975A>C, NM_004010.3:c.1975A>CVOUS05/04/2016
388DMDEx19NM_004006.2:c.2360T>Ap.Leu787Gln | p.L787QLRG_199t1:c.2360T>A, NM_000109.2:c.2336T>A, NM_000109.3:c.2336T>A, NM_004006.1:c.2360T>A, NM_004006.2:c.2360T>A, NM_004007.1:c.1991T>A, NM_004007.2:c.1991T>A, NM_004009.2:c.2348T>A, NM_004009.3:c.2348T>A, NM_004010.2:c.1991T>A, NM_004010.3:c.1991T>AVOUS11/22/2016
389DMDEx19NM_004006.2:c.2368C>Tp.Gln790* | p.Q790XLRG_199t1:c.2368C>T, NM_000109.2:c.2344C>T, NM_000109.3:c.2344C>T, NM_004006.1:c.2368C>T, NM_004006.2:c.2368C>T, NM_004007.1:c.1999C>T, NM_004007.2:c.1999C>T, NM_004009.2:c.2356C>T, NM_004009.3:c.2356C>T, NM_004010.2:c.1999C>T, NM_004010.3:c.1999C>TPathogenic09/19/2018 
390DMDEx19NM_004006.2:c.2380G>Ap.Glu794Lys | p.E794KLRG_199t1:c.2380G>A, NM_000109.2:c.2356G>A, NM_000109.3:c.2356G>A, NM_004006.1:c.2380G>A, NM_004006.2:c.2380G>A, NM_004007.1:c.2011G>A, NM_004007.2:c.2011G>A, NM_004009.2:c.2368G>A, NM_004009.3:c.2368G>A, NM_004010.2:c.2011G>A, NM_004010.3:c.2011G>AVOUS09/25/2019
391DMDEx19NM_004006.2:c.2380+1G>CPathogenic11/01/2012 
392DMDEx19NM_004006.2:c.2380+2T>CPathogenic** 
393DMDEx19NM_004006.2:c.2380+3A>TLRG_199t1:c.2380+3A>T, NM_000109.2:c.2356+3A>T, NM_000109.3:c.2356+3A>T, NM_004006.1:c.2380+3A>T, NM_004006.2:c.2380+3A>T, NM_004007.1:c.2011+3A>T, NM_004007.2:c.2011+3A>T, NM_004009.2:c.2368+3A>T, NM_004009.3:c.2368+3A>T, NM_004010.2:c.2011+3A>T, NM_004010.3:c.2011+3A>TVOUS05/23/2018
394DMDEx19NM_004006.2:c.2380+10C>TNM_000109.2:c.2356+10C>T, NM_000109.3:c.2356+10C>T, NM_004006.1:c.2380+10C>T, NM_004006.2:c.2380+10C>T, NM_004007.1:c.2011+10C>T, NM_004007.2:c.2011+10C>T, NM_004009.2:c.2368+10C>T, NM_004009.3:c.2368+10C>T, NM_004010.2:c.2011+10C>T, NM_004010.3:c.2011+10C>TLikely benign05/14/2015 
395DMDEx19NM_004006.2:c.2380+11G>ANM_000109.2:c.2356+11G>A, NM_000109.3:c.2356+11G>A, NM_004006.1:c.2380+11G>A, NM_004006.2:c.2380+11G>A, NM_004007.1:c.2011+11G>A, NM_004007.2:c.2011+11G>A, NM_004009.2:c.2368+11G>A, NM_004009.3:c.2368+11G>A, NM_004010.2:c.2011+11G>A, NM_004010.3:c.2011+11G>ABenign02/24/2016 
396DMDEx20NM_004006.2:c.2381-3T>CNM_000109.2:c.2357-3T>C, NM_000109.3:c.2357-3T>C, NM_004006.1:c.2381-3T>C, NM_004006.2:c.2381-3T>C, NM_004007.1:c.2012-3T>C, NM_004007.2:c.2012-3T>C, NM_004009.2:c.2369-3T>C, NM_004009.3:c.2369-3T>C, NM_004010.2:c.2012-3T>C, NM_004010.3:c.2012-3T>CBenign09/14/2014 
397DMDEx20NM_004006.2:c.2381-1G>TPathogenic11/01/2012 
398DMDEx20NM_004006.2:c.2386G>Ap.Val796Ile | p.V796INM_000109.2:c.2362G>A, NM_000109.3:c.2362G>A, NM_004006.1:c.2386G>A, NM_004006.2:c.2386G>A, NM_004007.1:c.2017G>A, NM_004007.2:c.2017G>A, NM_004009.2:c.2374G>A, NM_004009.3:c.2374G>A, NM_004010.2:c.2017G>A, NM_004010.3:c.2017G>ABenign08/27/2018 
399DMDEx20NM_004006.2:c.2391T>Gp.Asn797Lys | p.N797KNM_000109.2:c.2367T>G, NM_000109.3:c.2367T>G, NM_004006.1:c.2391T>G, NM_004006.2:c.2391T>G, NM_004007.1:c.2022T>G, NM_004007.2:c.2022T>G, NM_004009.2:c.2379T>G, NM_004009.3:c.2379T>G, NM_004010.2:c.2022T>G, NM_004010.3:c.2022T>GBenign09/24/2015 
400DMDEx20NM_004006.2:c.2416G>Tp.Glu806* | p.E806XLRG_199t1:c.2416G>T, NM_000109.2:c.2392G>T, NM_000109.3:c.2392G>T, NM_004006.1:c.2416G>T, NM_004006.2:c.2416G>T, NM_004007.1:c.2047G>T, NM_004007.2:c.2047G>T, NM_004009.2:c.2404G>T, NM_004009.3:c.2404G>T, NM_004010.2:c.2047G>T, NM_004010.3:c.2047G>TPathogenic01/12/2017 
401DMDEx20NM_004006.2:c.2419C>Tp.Gln807* | p.Q807XLRG_199t1:c.2419C>T, NM_000109.2:c.2395C>T, NM_000109.3:c.2395C>T, NM_004006.1:c.2419C>T, NM_004006.2:c.2419C>T, NM_004007.1:c.2050C>T, NM_004007.2:c.2050C>T, NM_004009.2:c.2407C>T, NM_004009.3:c.2407C>T, NM_004010.2:c.2050C>T, NM_004010.3:c.2050C>TPathogenic06/19/2018 
402DMDEx20NM_004006.2:c.2436G>Ap.Trp812* | p.W812XLRG_199t1:c.2436G>A, NM_000109.2:c.2412G>A, NM_000109.3:c.2412G>A, NM_004006.1:c.2436G>A, NM_004006.2:c.2436G>A, NM_004007.1:c.2067G>A, NM_004007.2:c.2067G>A, NM_004009.2:c.2424G>A, NM_004009.3:c.2424G>A, NM_004010.2:c.2067G>A, NM_004010.3:c.2067G>APathogenic** 
403DMDEx20NM_004006.2:c.2457A>Cp.Leu819= | p.L819=NM_000109.2:c.2433A>C, NM_000109.3:c.2433A>C, NM_004006.1:c.2457A>C, NM_004006.2:c.2457A>C, NM_004007.1:c.2088A>C, NM_004007.2:c.2088A>C, NM_004009.2:c.2445A>C, NM_004009.3:c.2445A>C, NM_004010.2:c.2088A>C, NM_004010.3:c.2088A>CVOUS06/29/2018
404DMDEx20NM_004006.2:c.2479G>Tp.Glu827* | p.E827XNM_000109.2:c.2455G>T, NM_000109.3:c.2455G>T, NM_004006.1:c.2479G>T, NM_004006.2:c.2479G>T, NM_004007.1:c.2110G>T, NM_004007.2:c.2110G>T, NM_004009.2:c.2467G>T, NM_004009.3:c.2467G>T, NM_004010.2:c.2110G>T, NM_004010.3:c.2110G>TPathogenic06/04/2015 
405DMDEx20NM_004006.2:c.2479delGLRG_199t1:c.2479delG, NM_000109.2:c.2455delG, NM_000109.3:c.2455delG, NM_004006.1:c.2479delG, NM_004006.2:c.2479delG, NM_004007.1:c.2110delG, NM_004007.2:c.2110delG, NM_004009.2:c.2467delG, NM_004009.3:c.2467delG, NM_004010.2:c.2110delG, NM_004010.3:c.2110delGPathogenic** 
406DMDEx20NM_004006.2:c.2482T>Gp.Tyr828* | p.Y828XPathogenic** 
407DMDEx20NM_004006.2:c.2484T>Gp.Tyr828* | p.Y828XNM_000109.2:c.2460T>G, NM_000109.3:c.2460T>G, NM_004006.1:c.2484T>G, NM_004006.2:c.2484T>G, NM_004007.1:c.2115T>G, NM_004007.2:c.2115T>G, NM_004009.2:c.2472T>G, NM_004009.3:c.2472T>G, NM_004010.2:c.2115T>G, NM_004010.3:c.2115T>GPathogenic04/15/2014 
408DMDEx20NM_004006.2:c.2490C>Tp.Asn830= | p.N830=NM_000109.2:c.2466C>T, NM_000109.3:c.2466C>T, NM_004006.1:c.2490C>T, NM_004006.2:c.2490C>T, NM_004007.1:c.2121C>T, NM_004007.2:c.2121C>T, NM_004009.2:c.2478C>T, NM_004009.3:c.2478C>T, NM_004010.2:c.2121C>T, NM_004010.3:c.2121C>TBenign11/24/2015 
409DMDEx20NM_004006.2:c.2492_2494delACALRG_199t1:c.2492_2494delACA, NM_000109.2:c.2468_2470delACA, NM_000109.3:c.2468_2470delACA, NM_004006.1:c.2492_2494delACA, NM_004006.2:c.2492_2494delACA, NM_004007.1:c.2123_2125delACA, NM_004007.2:c.2123_2125delACA, NM_004009.2:c.2480_2482delACA, NM_004009.3:c.2480_2482delACA, NM_004010.2:c.2123_2125delACA, NM_004010.3:c.2123_2125delACAVOUS07/25/2016
410DMDEx20NM_004006.2:c.2498T>Ap.Ile833Asn | p.I833NLRG_199t1:c.2498T>A, NM_000109.2:c.2474T>A, NM_000109.3:c.2474T>A, NM_004006.1:c.2498T>A, NM_004006.2:c.2498T>A, NM_004007.1:c.2129T>A, NM_004007.2:c.2129T>A, NM_004009.2:c.2486T>A, NM_004009.3:c.2486T>A, NM_004010.2:c.2129T>A, NM_004010.3:c.2129T>AVOUS01/23/2017
411DMDEx20NM_004006.2:c.2508T>Cp.Tyr836= | p.Y836=LRG_199t1:c.2508T>C, NM_000109.2:c.2484T>C, NM_000109.3:c.2484T>C, NM_004006.1:c.2508T>C, NM_004006.2:c.2508T>C, NM_004007.1:c.2139T>C, NM_004007.2:c.2139T>C, NM_004009.2:c.2496T>C, NM_004009.3:c.2496T>C, NM_004010.2:c.2139T>C, NM_004010.3:c.2139T>CVOUS09/14/2016
412DMDEx20NM_004006.2:c.2512C>Tp.Gln838* | p.Q838XNM_000109.2:c.2488C>T, NM_000109.3:c.2488C>T, NM_004006.1:c.2512C>T, NM_004006.2:c.2512C>T, NM_004007.1:c.2143C>T, NM_004007.2:c.2143C>T, NM_004009.2:c.2500C>T, NM_004009.3:c.2500C>T, NM_004010.2:c.2143C>T, NM_004010.3:c.2143C>TPathogenic08/28/2018 
413DMDEx20NM_004006.2:c.2518C>Ap.Gln840Lys | p.Q840KNM_000109.2:c.2494C>A, NM_000109.3:c.2494C>A, NM_004006.1:c.2518C>A, NM_004006.2:c.2518C>A, NM_004007.1:c.2149C>A, NM_004007.2:c.2149C>A, NM_004009.2:c.2506C>A, NM_004009.3:c.2506C>A, NM_004010.2:c.2149C>A, NM_004010.3:c.2149C>AVOUS12/14/2015
414DMDEx20NM_004006.2:c.2521_2523delCAALRG_199t1:c.2521_2523delCAA, NM_000109.2:c.2497_2499delCAA, NM_000109.3:c.2497_2499delCAA, NM_004006.1:c.2521_2523delCAA, NM_004006.2:c.2521_2523delCAA, NM_004007.1:c.2152_2154delCAA, NM_004007.2:c.2152_2154delCAA, NM_004009.2:c.2509_2511delCAA, NM_004009.3:c.2509_2511delCAA, NM_004010.2:c.2152_2154delCAA, NM_004010.3:c.2152_2154delCAAVOUS04/20/2016
415DMDEx20NM_004006.2:c.2523delAp.Gln841Hisfs*5 | p.Q841HfsX5LRG_199t1:c.2523delA, NM_000109.2:c.2499delA, NM_000109.3:c.2499delA, NM_004006.1:c.2523delA, NM_004006.2:c.2523delA, NM_004007.1:c.2154delA, NM_004007.2:c.2154delA, NM_004009.2:c.2511delA, NM_004009.3:c.2511delA, NM_004010.2:c.2154delA, NM_004010.3:c.2154delAPathogenic** 
416DMDEx20NM_004006.2:c.2539A>Gp.Thr847Ala | p.T847ANM_000109.2:c.2515A>G, NM_000109.3:c.2515A>G, NM_004006.1:c.2539A>G, NM_004006.2:c.2539A>G, NM_004007.1:c.2170A>G, NM_004007.2:c.2170A>G, NM_004009.2:c.2527A>G, NM_004009.3:c.2527A>G, NM_004010.2:c.2170A>G, NM_004010.3:c.2170A>GVOUS12/18/2018
417DMDEx20NM_004006.2:c.2547delTPathogenic05/06/2013 
418DMDEx20NM_004006.2:c.2556G>Ap.Trp852* | p.W852XLRG_199t1:c.2556G>A, NM_000109.2:c.2532G>A, NM_000109.3:c.2532G>A, NM_004006.1:c.2556G>A, NM_004006.2:c.2556G>A, NM_004007.1:c.2187G>A, NM_004007.2:c.2187G>A, NM_004009.2:c.2544G>A, NM_004009.3:c.2544G>A, NM_004010.2:c.2187G>A, NM_004010.3:c.2187G>APathogenic01/23/2018 
419DMDEx20NM_004006.2:c.2569C>Tp.Pro857Ser | p.P857SLRG_199t1:c.2569C>T, NM_000109.2:c.2545C>T, NM_000109.3:c.2545C>T, NM_004006.1:c.2569C>T, NM_004006.2:c.2569C>T, NM_004007.1:c.2200C>T, NM_004007.2:c.2200C>T, NM_004009.2:c.2557C>T, NM_004009.3:c.2557C>T, NM_004010.2:c.2200C>T, NM_004010.3:c.2200C>TLikely benign03/23/2017 
420DMDEx20NM_004006.2:c.2573C>Ap.Thr858Asn | p.T858NVOUS**
421DMDEx20NM_004006.2:c.2575A>Tp.Thr859Ser | p.T859SNM_000109.2:c.2551A>T, NM_000109.3:c.2551A>T, NM_004006.1:c.2575A>T, NM_004006.2:c.2575A>T, NM_004007.1:c.2206A>T, NM_004007.2:c.2206A>T, NM_004009.2:c.2563A>T, NM_004009.3:c.2563A>T, NM_004010.2:c.2206A>T, NM_004010.3:c.2206A>TLikely benign07/18/2017 
422DMDEx20NM_004006.2:c.2581T>Ap.Ser861Thr | p.S861TNM_000109.2:c.2557T>A, NM_000109.3:c.2557T>A, NM_004006.1:c.2581T>A, NM_004006.2:c.2581T>A, NM_004007.1:c.2212T>A, NM_004007.2:c.2212T>A, NM_004009.2:c.2569T>A, NM_004009.3:c.2569T>A, NM_004010.2:c.2212T>A, NM_004010.3:c.2212T>AVOUS08/27/2013
423DMDEx20NM_004006.2:c.2601_2602delAAp.Gln869Valfs*5 | p.Q869VfsX5NM_004006.2:c.2601_2602delAAPathogenic07/09/2014 
424DMDEx20NM_004006.2:c.2603delGNM_000109.2:c.2579delG, NM_000109.3:c.2579delG, NM_004006.1:c.2603delG, NM_004006.2:c.2603delG, NM_004007.1:c.2234delG, NM_004007.2:c.2234delG, NM_004009.2:c.2591delG, NM_004009.3:c.2591delG, NM_004010.2:c.2234delG, NM_004010.3:c.2234delGPathogenic08/10/2015 
425DMDEx20NM_004006.2:c.2607G>Cp.Gln869His | p.Q869HVOUS**
426DMDEx20NM_004006.2:c.2612A>Cp.Lys871Thr | p.K871TVOUS**
427DMDEx20NM_004006.2:c.2614_2615insGGTGGCTCACNM_000109.2:c.2590_2591insGGTGGCTCAC, NM_000109.3:c.2590_2591insGGTGGCTCAC, NM_004006.1:c.2614_2615insGGTGGCTCAC, NM_004006.2:c.2614_2615insGGTGGCTCAC, NM_004007.1:c.2245_2246insGGTGGCTCAC, NM_004007.2:c.2245_2246insGGTGGCTCAC, NM_004009.2:c.2602_2603insGGTGGCTCAC, NM_004009.3:c.2602_2603insGGTGGCTCAC, NM_004010.2:c.2245_2246insGGTGGCTCAC, NM_004010.3:c.2245_2246insGGTGGCTCACVOUS**
428DMDEx20NM_004006.2:c.2614A>Tp.Ile872Phe | p.I872FLRG_199t1:c.2614A>T, NM_000109.2:c.2590A>T, NM_000109.3:c.2590A>T, NM_004006.1:c.2614A>T, NM_004006.2:c.2614A>T, NM_004007.1:c.2245A>T, NM_004007.2:c.2245A>T, NM_004009.2:c.2602A>T, NM_004009.3:c.2602A>T, NM_004010.2:c.2245A>T, NM_004010.3:c.2245A>TVOUS05/23/2017
429DMDEx20NM_004006.2:c.2617T>Cp.Cys873Arg | p.C873RLRG_199t1:c.2617T>C, NM_000109.2:c.2593T>C, NM_000109.3:c.2593T>C, NM_004006.1:c.2617T>C, NM_004006.2:c.2617T>C, NM_004007.1:c.2248T>C, NM_004007.2:c.2248T>C, NM_004009.2:c.2605T>C, NM_004009.3:c.2605T>C, NM_004010.2:c.2248T>C, NM_004010.3:c.2248T>CVOUS08/09/2018
430DMDEx20NM_004006.2:c.2621A>Gp.Lys874Arg | p.K874RLRG_199t1:c.2621A>G, NM_000109.2:c.2597A>G, NM_000109.3:c.2597A>G, NM_004006.1:c.2621A>G, NM_004006.2:c.2621A>G, NM_004007.1:c.2252A>G, NM_004007.2:c.2252A>G, NM_004009.2:c.2609A>G, NM_004009.3:c.2609A>G, NM_004010.2:c.2252A>G, NM_004010.3:c.2252A>GVOUS07/17/2019
431DMDEx20NM_004006.2:c.2622+1G>ALRG_199t1:c.2622+1G>A, NM_000109.2:c.2598+1G>A, NM_000109.3:c.2598+1G>A, NM_004006.1:c.2622+1G>A, NM_004006.2:c.2622+1G>A, NM_004007.1:c.2253+1G>A, NM_004007.2:c.2253+1G>A, NM_004009.2:c.2610+1G>A, NM_004009.3:c.2610+1G>A, NM_004010.2:c.2253+1G>A, NM_004010.3:c.2253+1G>APathogenic10/17/2016 
432DMDEx20NM_004006.2:c.2622+33A>GLRG_199t1:c.2622+33A>G, NM_000109.2:c.2598+33A>G, NM_000109.3:c.2598+33A>G, NM_004006.1:c.2622+33A>G, NM_004006.2:c.2622+33A>G, NM_004007.1:c.2253+33A>G, NM_004007.2:c.2253+33A>G, NM_004009.2:c.2610+33A>G, NM_004009.3:c.2610+33A>G, NM_004010.2:c.2253+33A>G, NM_004010.3:c.2253+33A>GBenign02/01/2017 
433DMDEx21NM_004006.2:c.2623-11C>GNM_000109.2:c.2599-11C>G, NM_000109.3:c.2599-11C>G, NM_004006.1:c.2623-11C>G, NM_004006.2:c.2623-11C>G, NM_004007.1:c.2254-11C>G, NM_004007.2:c.2254-11C>G, NM_004009.2:c.2611-11C>G, NM_004009.3:c.2611-11C>G, NM_004010.2:c.2254-11C>G, NM_004010.3:c.2254-11C>GBenign12/16/2015 
434DMDEx21NM_004006.2:c.2623-3C>GLRG_199t1:c.2623-3C>G, NM_000109.2:c.2599-3C>G, NM_000109.3:c.2599-3C>G, NM_004006.1:c.2623-3C>G, NM_004006.2:c.2623-3C>G, NM_004007.1:c.2254-3C>G, NM_004007.2:c.2254-3C>G, NM_004009.2:c.2611-3C>G, NM_004009.3:c.2611-3C>G, NM_004010.2:c.2254-3C>G, NM_004010.3:c.2254-3C>GPathogenic05/16/2017 
435DMDEx21NM_004006.2:c.2636G>Ap.Arg879Gln | p.R879QLRG_199t1:c.2636G>A, NM_000109.2:c.2612G>A, NM_000109.3:c.2612G>A, NM_004006.1:c.2636G>A, NM_004006.2:c.2636G>A, NM_004007.1:c.2267G>A, NM_004007.2:c.2267G>A, NM_004009.2:c.2624G>A, NM_004009.3:c.2624G>A, NM_004010.2:c.2267G>A, NM_004010.3:c.2267G>AVOUS07/22/2016
436DMDEx21NM_004006.2:c.2636_2638delGGCinsATTLRG_199t1:c.2636_2638delinsATT, NM_000109.2:c.2612_2614delinsATT, NM_000109.3:c.2612_2614delinsATT, NM_004006.1:c.2636_2638delinsATT, NM_004006.2:c.2636_2638delinsATT, NM_004007.1:c.2267_2269delinsATT, NM_004007.2:c.2267_2269delinsATT, NM_004009.2:c.2624_2626delinsATT, NM_004009.3:c.2624_2626delinsATT, NM_004010.2:c.2267_2269delinsATT, NM_004010.3:c.2267_2269delinsATTVOUS07/25/2016
437DMDEx21NM_004006.2:c.2637G>Tp.Arg879= | p.R879=LRG_199t1:c.2637G>T, NM_000109.2:c.2613G>T, NM_000109.3:c.2613G>T, NM_004006.1:c.2637G>T, NM_004006.2:c.2637G>T, NM_004007.1:c.2268G>T, NM_004007.2:c.2268G>T, NM_004009.2:c.2625G>T, NM_004009.3:c.2625G>T, NM_004010.2:c.2268G>T, NM_004010.3:c.2268G>TVOUS07/22/2016
438DMDEx21NM_004006.2:c.2638C>Tp.Leu880= | p.L880=LRG_199t1:c.2638C>T, NM_000109.2:c.2614C>T, NM_000109.3:c.2614C>T, NM_004006.1:c.2638C>T, NM_004006.2:c.2638C>T, NM_004007.1:c.2269C>T, NM_004007.2:c.2269C>T, NM_004009.2:c.2626C>T, NM_004009.3:c.2626C>T, NM_004010.2:c.2269C>T, NM_004010.3:c.2269C>TVOUS07/22/2016
439DMDEx21NM_004006.2:c.2645A>Gp.Asp882Gly | p.D882GNM_000109.2:c.2621A>G, NM_000109.3:c.2621A>G, NM_004006.1:c.2645A>G, NM_004006.2:c.2645A>G, NM_004007.1:c.2276A>G, NM_004007.2:c.2276A>G, NM_004009.2:c.2633A>G, NM_004009.3:c.2633A>G, NM_004010.2:c.2276A>G, NM_004010.3:c.2276A>GBenign04/04/2016 
440DMDEx21NM_004006.2:c.2650C>Tp.Gln884* | p.Q884XNM_000109.2:c.2626C>T, NM_000109.3:c.2626C>T, NM_004006.1:c.2650C>T, NM_004006.2:c.2650C>T, NM_004007.1:c.2281C>T, NM_004007.2:c.2281C>T, NM_004009.2:c.2638C>T, NM_004009.3:c.2638C>T, NM_004010.2:c.2281C>T, NM_004010.3:c.2281C>TPathogenic05/22/2015 
441DMDEx21NM_004006.2:c.2682C>Tp.Ser894= | p.S894=Benign** 
442DMDEx21NM_004006.2:c.2699A>Tp.Lys900Ile | p.K900ILRG_199t1:c.2699A>T, NM_000109.2:c.2675A>T, NM_000109.3:c.2675A>T, NM_004006.1:c.2699A>T, NM_004006.2:c.2699A>T, NM_004007.1:c.2330A>T, NM_004007.2:c.2330A>T, NM_004009.2:c.2687A>T, NM_004009.3:c.2687A>T, NM_004010.2:c.2330A>T, NM_004010.3:c.2330A>TVOUS09/26/2016
443DMDEx21NM_004006.2:c.2745A>Cp.Thr915= | p.T915=NM_000109.2:c.2721A>C, NM_000109.3:c.2721A>C, NM_004006.1:c.2745A>C, NM_004006.2:c.2745A>C, NM_004007.1:c.2376A>C, NM_004007.2:c.2376A>C, NM_004009.2:c.2733A>C, NM_004009.3:c.2733A>C, NM_004010.2:c.2376A>C, NM_004010.3:c.2376A>CLikely benign02/12/2015 
444DMDEx21NM_004006.2:c.2755A>Tp.Lys919* | p.K919XNM_000109.2:c.2731A>T, NM_000109.3:c.2731A>T, NM_004006.1:c.2755A>T, NM_004006.2:c.2755A>T, NM_004007.1:c.2386A>T, NM_004007.2:c.2386A>T, NM_004009.2:c.2743A>T, NM_004009.3:c.2743A>T, NM_004010.2:c.2386A>T, NM_004010.3:c.2386A>TPathogenic04/07/2014 
445DMDEx21NM_004006.2:c.2758C>Tp.Gln920* | p.Q920XPathogenic** 
446DMDEx21NM_004006.2:c.2797C>Tp.Gln933* | p.Q933XLRG_199t1:c.2797C>T, NM_000109.2:c.2773C>T, NM_000109.3:c.2773C>T, NM_004006.1:c.2797C>T, NM_004006.2:c.2797C>T, NM_004007.1:c.2428C>T, NM_004007.2:c.2428C>T, NM_004009.2:c.2785C>T, NM_004009.3:c.2785C>T, NM_004010.2:c.2428C>T, NM_004010.3:c.2428C>TPathogenic12/01/2017 
447DMDEx21NM_004006.2:c.2803+1G>TPathogenic** 
448DMDEx21NM_004006.2:c.2803+1G>APathogenic** 
449DMDEx21NM_004006.2:c.2803+1G>CNM_000109.2:c.2779+1G>C, NM_000109.3:c.2779+1G>C, NM_004006.1:c.2803+1G>C, NM_004006.2:c.2803+1G>C, NM_004007.1:c.2434+1G>C, NM_004007.2:c.2434+1G>C, NM_004009.2:c.2791+1G>C, NM_004009.3:c.2791+1G>C, NM_004010.2:c.2434+1G>C, NM_004010.3:c.2434+1G>CPathogenic04/30/2015 
450DMDEx22NM_004006.2:c.2804-2A>TNM_000109.2:c.2780-2A>T, NM_000109.3:c.2780-2A>T, NM_004006.1:c.2804-2A>T, NM_004006.2:c.2804-2A>T, NM_004007.1:c.2435-2A>T, NM_004007.2:c.2435-2A>T, NM_004009.2:c.2792-2A>T, NM_004009.3:c.2792-2A>T, NM_004010.2:c.2435-2A>T, NM_004010.3:c.2435-2A>TPathogenic06/17/2014 
451DMDEx22NM_004006.2:c.2804-1G>APathogenic11/01/2012 
452DMDEx22NM_004006.2:c.2804-1G>TLRG_199t1:c.2804-1G>T, NM_000109.2:c.2780-1G>T, NM_000109.3:c.2780-1G>T, NM_004006.1:c.2804-1G>T, NM_004006.2:c.2804-1G>T, NM_004007.1:c.2435-1G>T, NM_004007.2:c.2435-1G>T, NM_004009.2:c.2792-1G>T, NM_004009.3:c.2792-1G>T, NM_004010.2:c.2435-1G>T, NM_004010.3:c.2435-1G>TPathogenic06/14/2017 
453DMDEx22NM_004006.2:c.2815_2816delTTNM_004006.2:c.2815_2816delTTPathogenic09/17/2014 
454DMDEx22NM_004006.2:c.2816T>Ap.Leu939* | p.L939XNM_000109.2:c.2792T>A, NM_000109.3:c.2792T>A, NM_004006.1:c.2816T>A, NM_004006.2:c.2816T>A, NM_004007.1:c.2447T>A, NM_004007.2:c.2447T>A, NM_004009.2:c.2804T>A, NM_004009.3:c.2804T>A, NM_004010.2:c.2447T>A, NM_004010.3:c.2447T>APathogenic02/10/2014 
455DMDEx22NM_004006.2:c.2824A>Gp.Met942Val | p.M942VLRG_199t1:c.2824A>G, NM_000109.2:c.2800A>G, NM_000109.3:c.2800A>G, NM_004006.1:c.2824A>G, NM_004006.2:c.2824A>G, NM_004007.1:c.2455A>G, NM_004007.2:c.2455A>G, NM_004009.2:c.2812A>G, NM_004009.3:c.2812A>G, NM_004010.2:c.2455A>G, NM_004010.3:c.2455A>GVOUS09/09/2016
456DMDEx22NM_004006.2:c.2827C>Tp.Arg943Cys | p.R943CNM_000109.2:c.2803C>T, NM_000109.3:c.2803C>T, NM_004006.1:c.2827C>T, NM_004006.2:c.2827C>T, NM_004007.1:c.2458C>T, NM_004007.2:c.2458C>T, NM_004009.2:c.2815C>T, NM_004009.3:c.2815C>T, NM_004010.2:c.2458C>T, NM_004010.3:c.2458C>TBenign08/11/2016 
457DMDEx22NM_004006.2:c.2828G>Ap.Arg943His | p.R943HNM_000109.2:c.2804G>A, NM_000109.3:c.2804G>A, NM_004006.1:c.2828G>A, NM_004006.2:c.2828G>A, NM_004007.1:c.2459G>A, NM_004007.2:c.2459G>A, NM_004009.2:c.2816G>A, NM_004009.3:c.2816G>A, NM_004010.2:c.2459G>A, NM_004010.3:c.2459G>AVOUS08/06/2013
458DMDEx22NM_004006.2:c.2842A>Gp.Met948Val | p.M948VVOUS**
459DMDEx22NM_004006.2:c.2861G>Ap.Trp954* | p.W954XLRG_199t1:c.2861G>A, NM_000109.2:c.2837G>A, NM_000109.3:c.2837G>A, NM_004006.1:c.2861G>A, NM_004006.2:c.2861G>A, NM_004007.1:c.2492G>A, NM_004007.2:c.2492G>A, NM_004009.2:c.2849G>A, NM_004009.3:c.2849G>A, NM_004010.2:c.2492G>A, NM_004010.3:c.2492G>APathogenic06/21/2016 
460DMDEx22NM_004006.2:c.2866C>Tp.Gln956* | p.Q956XPathogenic** 
461DMDEx22NM_004006.2:c.2884C>Gp.Leu962Val | p.L962VLRG_199t1:c.2884C>G, NM_000109.2:c.2860C>G, NM_000109.3:c.2860C>G, NM_004006.1:c.2884C>G, NM_004006.2:c.2884C>G, NM_004007.1:c.2515C>G, NM_004007.2:c.2515C>G, NM_004009.2:c.2872C>G, NM_004009.3:c.2872C>G, NM_004010.2:c.2515C>G, NM_004010.3:c.2515C>GLikely benign04/06/2017 
462DMDEx22NM_004006.2:c.2893C>Ap.Pro965Thr | p.P965TLRG_199t1:c.2893C>A, NM_000109.2:c.2869C>A, NM_000109.3:c.2869C>A, NM_004006.1:c.2893C>A, NM_004006.2:c.2893C>A, NM_004007.1:c.2524C>A, NM_004007.2:c.2524C>A, NM_004009.2:c.2881C>A, NM_004009.3:c.2881C>A, NM_004010.2:c.2524C>A, NM_004010.3:c.2524C>AVOUS10/25/2017
463DMDEx22NM_004006.2:c.2914delTp.Tyr972Metfs*32 | p.Y972MfsX32LRG_199t1:c.2914delT, NM_000109.2:c.2890delT, NM_000109.3:c.2890delT, NM_004006.1:c.2914delT, NM_004006.2:c.2914delT, NM_004007.1:c.2545delT, NM_004007.2:c.2545delT, NM_004009.2:c.2902delT, NM_004009.3:c.2902delT, NM_004010.2:c.2545delT, NM_004010.3:c.2545delTPathogenic12/01/2017 
464DMDEx22NM_004006.2:c.2929dupCPathogenic** 
465DMDEx22NM_004006.2:c.2933_2934delGANM_000109.2:c.2909_2910delGA, NM_000109.3:c.2909_2910delGA, NM_004006.1:c.2933_2934delGA, NM_004006.2:c.2933_2934delGA, NM_004007.1:c.2564_2565delGA, NM_004007.2:c.2564_2565delGA, NM_004009.2:c.2921_2922delGA, NM_004009.3:c.2921_2922delGA, NM_004010.2:c.2564_2565delGA, NM_004010.3:c.2564_2565delGAPathogenic05/07/2015 
466DMDEx22NM_004006.2:c.2937C>Tp.Leu979= | p.L979=NM_000109.2:c.2913C>T, NM_000109.3:c.2913C>T, NM_004006.1:c.2937C>T, NM_004006.2:c.2937C>T, NM_004007.1:c.2568C>T, NM_004007.2:c.2568C>T, NM_004009.2:c.2925C>T, NM_004009.3:c.2925C>T, NM_004010.2:c.2568C>T, NM_004010.3:c.2568C>TVOUS11/11/2015
467DMDEx22NM_004006.2:c.2949+4dupTNM_000109.2:c.2925+4_2925+5insT, NM_000109.3:c.2925+4_2925+5insT, NM_004006.1:c.2949+4_2949+5insT, NM_004006.2:c.2949+4_2949+5insT, NM_004007.1:c.2580+4_2580+5insT, NM_004007.2:c.2580+4_2580+5insT, NM_004009.2:c.2937+4_2937+5insT, NM_004009.3:c.2937+4_2937+5insT, NM_004010.2:c.2580+4_2580+5insT, NM_004010.3:c.2580+4_2580+5insTVOUS01/12/2016
468DMDEx23NM_004006.2:c.2950-2A>TNM_000109.2:c.2926-2A>T, NM_000109.3:c.2926-2A>T, NM_004006.1:c.2950-2A>T, NM_004006.2:c.2950-2A>T, NM_004007.1:c.2581-2A>T, NM_004007.2:c.2581-2A>T, NM_004009.2:c.2938-2A>T, NM_004009.3:c.2938-2A>T, NM_004010.2:c.2581-2A>T, NM_004010.3:c.2581-2A>TPathogenic11/13/2015 
469DMDEx23NM_004006.2:c.2954T>Ap.Leu985* | p.L985XLRG_199t1:c.2954T>A, NM_000109.2:c.2930T>A, NM_000109.3:c.2930T>A, NM_004006.1:c.2954T>A, NM_004006.2:c.2954T>A, NM_004007.1:c.2585T>A, NM_004007.2:c.2585T>A, NM_004009.2:c.2942T>A, NM_004009.3:c.2942T>A, NM_004010.2:c.2585T>A, NM_004010.3:c.2585T>APathogenic** 
470DMDEx23NM_004006.2:c.2956C>Tp.Gln986* | p.Q986XNM_000109.2:c.2932C>T, NM_000109.3:c.2932C>T, NM_004006.1:c.2956C>T, NM_004006.2:c.2956C>T, NM_004007.1:c.2587C>T, NM_004007.2:c.2587C>T, NM_004009.2:c.2944C>T, NM_004009.3:c.2944C>T, NM_004010.2:c.2587C>T, NM_004010.3:c.2587C>TPathogenic05/05/2014 
471DMDEx23NM_004006.2:c.2967G>Tp.Leu989= | p.L989=NM_000109.2:c.2943G>T, NM_000109.3:c.2943G>T, NM_004006.1:c.2967G>T, NM_004006.2:c.2967G>T, NM_004007.1:c.2598G>T, NM_004007.2:c.2598G>T, NM_004009.2:c.2955G>T, NM_004009.3:c.2955G>T, NM_004010.2:c.2598G>T, NM_004010.3:c.2598G>TVOUS02/17/2016
472DMDEx23NM_004006.2:c.2968C>Tp.Gln990* | p.Q990XLRG_199t1:c.2968C>T, NM_000109.2:c.2944C>T, NM_000109.3:c.2944C>T, NM_004006.1:c.2968C>T, NM_004006.2:c.2968C>T, NM_004007.1:c.2599C>T, NM_004007.2:c.2599C>T, NM_004009.2:c.2956C>T, NM_004009.3:c.2956C>T, NM_004010.2:c.2599C>T, NM_004010.3:c.2599C>TPathogenic01/09/2017 
473DMDEx23NM_004006.2:c.2971G>Cp.Glu991Gln | p.E991QNM_000109.2:c.2947G>C, NM_000109.3:c.2947G>C, NM_004006.1:c.2971G>C, NM_004006.2:c.2971G>C, NM_004007.1:c.2602G>C, NM_004007.2:c.2602G>C, NM_004009.2:c.2959G>C, NM_004009.3:c.2959G>C, NM_004010.2:c.2602G>C, NM_004010.3:c.2602G>CLikely benign08/04/2014 
474DMDEx23NM_004006.2:c.2977C>Tp.Gln993* | p.Q993XPathogenic** 
475DMDEx23NM_004006.2:c.2988A>Gp.Leu996= | p.L996=NM_000109.2:c.2964A>G, NM_000109.3:c.2964A>G, NM_004006.1:c.2988A>G, NM_004006.2:c.2988A>G, NM_004007.1:c.2619A>G, NM_004007.2:c.2619A>G, NM_004009.2:c.2976A>G, NM_004009.3:c.2976A>G, NM_004010.2:c.2619A>G, NM_004010.3:c.2619A>GVOUS06/03/2016
476DMDEx23NM_004006.2:c.3016A>Tp.Met1006Leu | p.M1006LLRG_199t1:c.3016A>T, NM_000109.2:c.2992A>T, NM_000109.3:c.2992A>T, NM_004006.1:c.3016A>T, NM_004006.2:c.3016A>T, NM_004007.1:c.2647A>T, NM_004007.2:c.2647A>T, NM_004009.2:c.3004A>T, NM_004009.3:c.3004A>T, NM_004010.2:c.2647A>T, NM_004010.3:c.2647A>TVOUS12/14/2016
477DMDEx23NM_004006.2:c.3020C>Tp.Ser1007Leu | p.S1007LLRG_199t1:c.3020C>T, NM_000109.2:c.2996C>T, NM_000109.3:c.2996C>T, NM_004006.1:c.3020C>T, NM_004006.2:c.3020C>T, NM_004007.1:c.2651C>T, NM_004007.2:c.2651C>T, NM_004009.2:c.3008C>T, NM_004009.3:c.3008C>T, NM_004010.2:c.2651C>T, NM_004010.3:c.2651C>TLikely benign11/10/2017 
478DMDEx23NM_004006.2:c.3021G>Ap.Ser1007= | p.S1007=NM_000109.2:c.2997G>A, NM_000109.3:c.2997G>A, NM_004006.1:c.3021G>A, NM_004006.2:c.3021G>A, NM_004007.1:c.2652G>A, NM_004007.2:c.2652G>A, NM_004009.2:c.3009G>A, NM_004009.3:c.3009G>A, NM_004010.2:c.2652G>A, NM_004010.3:c.2652G>ABenign03/31/2014 
479DMDEx23NM_004006.2:c.3022A>Tp.Lys1008* | p.K1008XPathogenic** 
480DMDEx23NM_004006.2:c.3047G>Ap.Arg1016Gln | p.R1016QNM_000109.2:c.3023G>A, NM_000109.3:c.3023G>A, NM_004006.1:c.3047G>A, NM_004006.2:c.3047G>A, NM_004007.1:c.2678G>A, NM_004007.2:c.2678G>A, NM_004009.2:c.3035G>A, NM_004009.3:c.3035G>A, NM_004010.2:c.2678G>A, NM_004010.3:c.2678G>AVOUS09/11/2015
481DMDEx23NM_004006.2:c.3059C>Gp.Ser1020* | p.S1020XPathogenic** 
482DMDEx23NM_004006.2:c.3076G>Tp.Glu1026* | p.E1026XPathogenic** 
483DMDEx23NM_004006.2:c.3080G>Cp.Gly1027Ala | p.G1027ANM_000109.2:c.3056G>C, NM_000109.3:c.3056G>C, NM_004006.1:c.3080G>C, NM_004006.2:c.3080G>C, NM_004007.1:c.2711G>C, NM_004007.2:c.2711G>C, NM_004009.2:c.3068G>C, NM_004009.3:c.3068G>C, NM_004010.2:c.2711G>C, NM_004010.3:c.2711G>CVOUS02/09/2016
484DMDEx23NM_004006.2:c.3082C>Tp.Arg1028Cys | p.R1028CLRG_199t1:c.3082C>T, NM_000109.2:c.3058C>T, NM_000109.3:c.3058C>T, NM_004006.1:c.3082C>T, NM_004006.2:c.3082C>T, NM_004007.1:c.2713C>T, NM_004007.2:c.2713C>T, NM_004009.2:c.3070C>T, NM_004009.3:c.3070C>T, NM_004010.2:c.2713C>T, NM_004010.3:c.2713C>TVOUS08/27/2020
485DMDEx23NM_004006.2:c.3087G>Ap.Trp1029* | p.W1029XPathogenic** 
486DMDEx23NM_004006.2:c.3096C>Gp.Leu1032= | p.L1032=LRG_199t1:c.3096C>G, NM_000109.2:c.3072C>G, NM_000109.3:c.3072C>G, NM_004006.1:c.3096C>G, NM_004006.2:c.3096C>G, NM_004007.1:c.2727C>G, NM_004007.2:c.2727C>G, NM_004009.2:c.3084C>G, NM_004009.3:c.3084C>G, NM_004010.2:c.2727C>G, NM_004010.3:c.2727C>GVOUS07/10/2018
487DMDEx23NM_004006.2:c.3098C>Tp.Ser1033Phe | p.S1033FNM_000109.2:c.3074C>T, NM_000109.3:c.3074C>T, NM_004006.1:c.3098C>T, NM_004006.2:c.3098C>T, NM_004007.1:c.2729C>T, NM_004007.2:c.2729C>T, NM_004009.2:c.3086C>T, NM_004009.3:c.3086C>T, NM_004010.2:c.2729C>T, NM_004010.3:c.2729C>TVOUS08/19/2014
488DMDEx23NM_004006.2:c.3101C>Tp.Ser1034Phe | p.S1034FNM_000109.2:c.3077C>T, NM_000109.3:c.3077C>T, NM_004006.1:c.3101C>T, NM_004006.2:c.3101C>T, NM_004007.1:c.2732C>T, NM_004007.2:c.2732C>T, NM_004009.2:c.3089C>T, NM_004009.3:c.3089C>T, NM_004010.2:c.2732C>T, NM_004010.3:c.2732C>TVOUS12/09/2014
489DMDEx23NM_004006.2:c.3121C>Tp.Gln1041* | p.Q1041XLRG_199t1:c.3121C>T, NM_000109.2:c.3097C>T, NM_000109.3:c.3097C>T, NM_004006.1:c.3121C>T, NM_004006.2:c.3121C>T, NM_004007.1:c.2752C>T, NM_004007.2:c.2752C>T, NM_004009.2:c.3109C>T, NM_004009.3:c.3109C>T, NM_004010.2:c.2752C>T, NM_004010.3:c.2752C>TPathogenic08/07/2017 
490DMDEx23NM_004006.2:c.3124A>Tp.Lys1042* | p.K1042XPathogenic** 
491DMDEx23NM_004006.2:c.3151C>Tp.Arg1051* | p.R1051XLRG_199t1:c.3151C>T, NM_000109.2:c.3127C>T, NM_000109.3:c.3127C>T, NM_004006.1:c.3151C>T, NM_004006.2:c.3151C>T, NM_004007.1:c.2782C>T, NM_004007.2:c.2782C>T, NM_004009.2:c.3139C>T, NM_004009.3:c.3139C>T, NM_004010.2:c.2782C>T, NM_004010.3:c.2782C>TPathogenic09/19/2016 
492DMDEx23NM_004006.2:c.3162+4A>GNM_000109.2:c.3138+4A>G, NM_000109.3:c.3138+4A>G, NM_004006.1:c.3162+4A>G, NM_004006.2:c.3162+4A>G, NM_004007.1:c.2793+4A>G, NM_004007.2:c.2793+4A>G, NM_004009.2:c.3150+4A>G, NM_004009.3:c.3150+4A>G, NM_004010.2:c.2793+4A>G, NM_004010.3:c.2793+4A>GVOUS10/19/2016
493DMDEx24NM_004006.2:c.3163-18T>CVOUS**
494DMDEx24NM_004006.2:c.3178C>Ap.Leu1060Met | p.L1060MLRG_199t1:c.3178C>A, NM_000109.2:c.3154C>A, NM_000109.3:c.3154C>A, NM_004006.1:c.3178C>A, NM_004006.2:c.3178C>A, NM_004007.1:c.2809C>A, NM_004007.2:c.2809C>A, NM_004009.2:c.3166C>A, NM_004009.3:c.3166C>A, NM_004010.2:c.2809C>A, NM_004010.3:c.2809C>AVOUS09/16/2016
495DMDEx24NM_004006.2:c.3190A>Gp.Met1064Val | p.M1064VLRG_199t1:c.3190A>G, NM_000109.2:c.3166A>G, NM_000109.3:c.3166A>G, NM_004006.1:c.3190A>G, NM_004006.2:c.3190A>G, NM_004007.1:c.2821A>G, NM_004007.2:c.2821A>G, NM_004009.2:c.3178A>G, NM_004009.3:c.3178A>G, NM_004010.2:c.2821A>G, NM_004010.3:c.2821A>GVOUS03/27/2018
496DMDEx24NM_004006.2:c.3191T>Cp.Met1064Thr | p.M1064TLRG_199t1:c.3191T>C, NM_000109.2:c.3167T>C, NM_000109.3:c.3167T>C, NM_004006.1:c.3191T>C, NM_004006.2:c.3191T>C, NM_004007.1:c.2822T>C, NM_004007.2:c.2822T>C, NM_004009.2:c.3179T>C, NM_004009.3:c.3179T>C, NM_004010.2:c.2822T>C, NM_004010.3:c.2822T>CVOUS12/22/2017
497DMDEx24NM_004006.2:c.3217G>Ap.Glu1073Lys | p.E1073KNM_000109.2:c.3193G>A, NM_000109.3:c.3193G>A, NM_004006.1:c.3217G>A, NM_004006.2:c.3217G>A, NM_004007.1:c.2848G>A, NM_004007.2:c.2848G>A, NM_004009.2:c.3205G>A, NM_004009.3:c.3205G>A, NM_004010.2:c.2848G>A, NM_004010.3:c.2848G>AVOUS05/21/2015
498DMDEx24NM_004006.2:c.3220G>Tp.Glu1074* | p.E1074XLRG_199t1:c.3220G>T, NM_000109.2:c.3196G>T, NM_000109.3:c.3196G>T, NM_004006.1:c.3220G>T, NM_004006.2:c.3220G>T, NM_004007.1:c.2851G>T, NM_004007.2:c.2851G>T, NM_004009.2:c.3208G>T, NM_004009.3:c.3208G>T, NM_004010.2:c.2851G>T, NM_004010.3:c.2851G>TPathogenic07/27/2017 
499DMDEx24NM_004006.2:c.3237G>Ap.Gly1079= | p.G1079=NM_000109.2:c.3213G>A, NM_000109.3:c.3213G>A, NM_004006.1:c.3237G>A, NM_004006.2:c.3237G>A, NM_004007.1:c.2868G>A, NM_004007.2:c.2868G>A, NM_004009.2:c.3225G>A, NM_004009.3:c.3225G>A, NM_004010.2:c.2868G>A, NM_004010.3:c.2868G>AVOUS01/12/2016
500DMDEx24NM_004006.2:c.3238delGNM_000109.2:c.3214delG, NM_000109.3:c.3214delG, NM_004006.1:c.3238delG, NM_004006.2:c.3238delG, NM_004007.1:c.2869delG, NM_004007.2:c.2869delG, NM_004009.2:c.3226delG, NM_004009.3:c.3226delG, NM_004010.2:c.2869delG, NM_004010.3:c.2869delGPathogenic12/15/2015 
501DMDEx24NM_004006.2:c.3239A>Gp.Asp1080Gly | p.D1080GLRG_199t1:c.3239A>G, NM_000109.2:c.3215A>G, NM_000109.3:c.3215A>G, NM_004006.1:c.3239A>G, NM_004006.2:c.3239A>G, NM_004007.1:c.2870A>G, NM_004007.2:c.2870A>G, NM_004009.2:c.3227A>G, NM_004009.3:c.3227A>G, NM_004010.2:c.2870A>G, NM_004010.3:c.2870A>GVOUS03/17/2016
502DMDEx24NM_004006.2:c.3246_3247insTTTCTAAAAANM_000109.2:c.3222_3223insTTTCTAAAAA, NM_000109.3:c.3222_3223insTTTCTAAAAA, NM_004006.1:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004007.1:c.2877_2878insTTTCTAAAAA, NM_004007.2:c.2877_2878insTTTCTAAAAA, NM_004009.2:c.3234_3235insTTTCTAAAAA, NM_004009.3:c.3234_3235insTTTCTAAAAA, NM_004010.2:c.2877_2878insTTTCTAAAAA, NM_004010.3:c.2877_2878insTTTCTAAAAAPathogenic** 
503DMDEx24NM_004006.2:c.3257dupAp.Gln1087Alafs*11 | p.Q1087AfsX11LRG_199t1:c.3257dupA, NM_000109.2:c.3233dupA, NM_000109.3:c.3233dupA, NM_004006.1:c.3257dupA, NM_004006.2:c.3257dupA, NM_004007.1:c.2888dupA, NM_004007.2:c.2888dupA, NM_004009.2:c.3245dupA, NM_004009.3:c.3245dupA, NM_004010.2:c.2888dupA, NM_004010.3:c.2888dupAPathogenic05/04/2018 
504DMDEx24NM_004006.2:c.3269A>Tp.Gln1090Leu | p.Q1090LNM_000109.2:c.3245A>T, NM_000109.3:c.3245A>T, NM_004006.1:c.3269A>T, NM_004006.2:c.3269A>T, NM_004007.1:c.2900A>T, NM_004007.2:c.2900A>T, NM_004009.2:c.3257A>T, NM_004009.3:c.3257A>T, NM_004010.2:c.2900A>T, NM_004010.3:c.2900A>TVOUS09/26/2014
505DMDEx24NM_004006.2:c.3276+1G>ANM_000109.2:c.3252+1G>A, NM_000109.3:c.3252+1G>A, NM_004006.1:c.3276+1G>A, NM_004006.2:c.3276+1G>A, NM_004007.1:c.2907+1G>A, NM_004007.2:c.2907+1G>A, NM_004009.2:c.3264+1G>A, NM_004009.3:c.3264+1G>A, NM_004010.2:c.2907+1G>A, NM_004010.3:c.2907+1G>APathogenic10/13/2013 
506DMDEx24NM_004006.2:c.3276+2delTLRG_199t1:c.3276+2delT, NM_000109.2:c.3252+2delT, NM_000109.3:c.3252+2delT, NM_004006.1:c.3276+2delT, NM_004006.2:c.3276+2delT, NM_004007.1:c.2907+2delT, NM_004007.2:c.2907+2delT, NM_004009.2:c.3264+2delT, NM_004009.3:c.3264+2delT, NM_004010.2:c.2907+2delT, NM_004010.3:c.2907+2delTPathogenic03/05/2017 
507DMDEx24NM_004006.2:c.3276+14_3276+15delATVOUS**
508DMDEx24NM_004006.2:c.3276+17A>TLRG_199t1:c.3276+17A>T, NM_000109.2:c.3252+17A>T, NM_000109.3:c.3252+17A>T, NM_004006.1:c.3276+17A>T, NM_004006.2:c.3276+17A>T, NM_004007.1:c.2907+17A>T, NM_004007.2:c.2907+17A>T, NM_004009.2:c.3264+17A>T, NM_004009.3:c.3264+17A>T, NM_004010.2:c.2907+17A>T, NM_004010.3:c.2907+17A>TBenign04/04/2016 
509DMDEx25NM_004006.2:c.3281T>Cp.Leu1094Ser | p.L1094SLRG_199t1:c.3281T>C, NM_000109.2:c.3257T>C, NM_000109.3:c.3257T>C, NM_004006.1:c.3281T>C, NM_004006.2:c.3281T>C, NM_004007.1:c.2912T>C, NM_004007.2:c.2912T>C, NM_004009.2:c.3269T>C, NM_004009.3:c.3269T>C, NM_004010.2:c.2912T>C, NM_004010.3:c.2912T>CVOUS06/06/2017
510DMDEx25NM_004006.2:c.3295C>Tp.Gln1099* | p.Q1099XPathogenic10/23/2012 
511DMDEx25NM_004006.2:c.3309_3313delCAGTCp.Ser1104Lysfs*5 | p.S1104KfsX5LRG_199t1:c.3309_3313delCAGTC, NM_000109.2:c.3285_3289delCAGTC, NM_000109.3:c.3285_3289delCAGTC, NM_004006.1:c.3309_3313delCAGTC, NM_004006.2:c.3309_3313delCAGTC, NM_004007.1:c.2940_2944delCAGTC, NM_004007.2:c.2940_2944delCAGTC, NM_004009.2:c.3297_3301delCAGTC, NM_004009.3:c.3297_3301delCAGTC, NM_004010.2:c.2940_2944delCAGTC, NM_004010.3:c.2940_2944delCAGTCPathogenic06/06/2017 
512DMDEx25NM_004006.2:c.3327T>Cp.Asn1109= | p.N1109=LRG_199t1:c.3327T>C, NM_000109.2:c.3303T>C, NM_000109.3:c.3303T>C, NM_004006.1:c.3327T>C, NM_004006.2:c.3327T>C, NM_004007.1:c.2958T>C, NM_004007.2:c.2958T>C, NM_004009.2:c.3315T>C, NM_004009.3:c.3315T>C, NM_004010.2:c.2958T>C, NM_004010.3:c.2958T>CVOUS05/12/2016
513DMDEx25NM_004006.2:c.3334G>Ap.Gly1112Arg | p.G1112RLRG_199t1:c.3334G>A, NM_000109.2:c.3310G>A, NM_000109.3:c.3310G>A, NM_004006.1:c.3334G>A, NM_004006.2:c.3334G>A, NM_004007.1:c.2965G>A, NM_004007.2:c.2965G>A, NM_004009.2:c.3322G>A, NM_004009.3:c.3322G>A, NM_004010.2:c.2965G>A, NM_004010.3:c.2965G>AVOUS07/27/2018
514DMDEx25NM_004006.2:c.3344T>Cp.Ile1115Thr | p.I1115TNM_000109.2:c.3320T>C, NM_000109.3:c.3320T>C, NM_004006.1:c.3344T>C, NM_004006.2:c.3344T>C, NM_004007.1:c.2975T>C, NM_004007.2:c.2975T>C, NM_004009.2:c.3332T>C, NM_004009.3:c.3332T>C, NM_004010.2:c.2975T>C, NM_004010.3:c.2975T>CVOUS08/11/2014
515DMDEx25NM_004006.2:c.3365_3366delAGLRG_199t1:c.3365_3366delAG, NM_000109.2:c.3341_3342delAG, NM_000109.3:c.3341_3342delAG, NM_004006.1:c.3365_3366delAG, NM_004006.2:c.3365_3366delAG, NM_004007.1:c.2996_2997delAG, NM_004007.2:c.2996_2997delAG, NM_004009.2:c.3353_3354delAG, NM_004009.3:c.3353_3354delAG, NM_004010.2:c.2996_2997delAG, NM_004010.3:c.2996_2997delAGPathogenic03/02/2017 
516DMDEx25NM_004006.2:c.3374C>Ap.Ser1125* | p.S1125XLRG_199t1:c.3374C>A, NM_000109.2:c.3350C>A, NM_000109.3:c.3350C>A, NM_004006.1:c.3374C>A, NM_004006.2:c.3374C>A, NM_004007.1:c.3005C>A, NM_004007.2:c.3005C>A, NM_004009.2:c.3362C>A, NM_004009.3:c.3362C>A, NM_004010.2:c.3005C>A, NM_004010.3:c.3005C>APathogenic09/14/2018 
517DMDEx25NM_004006.2:c.3374C>Tp.Ser1125Leu | p.S1125LNM_000109.2:c.3350C>T, NM_000109.3:c.3350C>T, NM_004006.1:c.3374C>T, NM_004006.2:c.3374C>T, NM_004007.1:c.3005C>T, NM_004007.2:c.3005C>T, NM_004009.2:c.3362C>T, NM_004009.3:c.3362C>T, NM_004010.2:c.3005C>T, NM_004010.3:c.3005C>TVOUS09/13/2013
518DMDEx25NM_004006.2:c.3375G>Ap.Ser1125= | p.S1125=NM_000109.2:c.3351G>A, NM_000109.3:c.3351G>A, NM_004006.1:c.3375G>A, NM_004006.2:c.3375G>A, NM_004007.1:c.3006G>A, NM_004007.2:c.3006G>A, NM_004009.2:c.3363G>A, NM_004009.3:c.3363G>A, NM_004010.2:c.3006G>A, NM_004010.3:c.3006G>AVOUS04/03/2017
519DMDEx25NM_004006.2:c.3406A>Tp.Thr1136Ser | p.T1136SNM_000109.2:c.3382A>T, NM_000109.3:c.3382A>T, NM_004006.1:c.3406A>T, NM_004006.2:c.3406A>T, NM_004007.1:c.3037A>T, NM_004007.2:c.3037A>T, NM_004009.2:c.3394A>T, NM_004009.3:c.3394A>T, NM_004010.2:c.3037A>T, NM_004010.3:c.3037A>TBenign07/03/2013 
520DMDEx25NM_004006.2:c.3413G>Ap.Trp1138* | p.W1138XLRG_199t1:c.3413G>A, NM_000109.2:c.3389G>A, NM_000109.3:c.3389G>A, NM_004006.1:c.3413G>A, NM_004006.2:c.3413G>A, NM_004007.1:c.3044G>A, NM_004007.2:c.3044G>A, NM_004009.2:c.3401G>A, NM_004009.3:c.3401G>A, NM_004010.2:c.3044G>A, NM_004010.3:c.3044G>APathogenic08/25/2016 
521DMDEx25NM_004006.2:c.3415G>Ap.Asp1139Asn | p.D1139NLRG_199t1:c.3415G>A, NM_000109.2:c.3391G>A, NM_000109.3:c.3391G>A, NM_004006.1:c.3415G>A, NM_004006.2:c.3415G>A, NM_004007.1:c.3046G>A, NM_004007.2:c.3046G>A, NM_004009.2:c.3403G>A, NM_004009.3:c.3403G>A, NM_004010.2:c.3046G>A, NM_004010.3:c.3046G>AVOUS01/04/2018
522DMDEx25NM_004006.2:c.3417T>Cp.Asp1139= | p.D1139=LRG_199t1:c.3417T>C, NM_000109.2:c.3393T>C, NM_000109.3:c.3393T>C, NM_004006.1:c.3417T>C, NM_004006.2:c.3417T>C, NM_004007.1:c.3048T>C, NM_004007.2:c.3048T>C, NM_004009.2:c.3405T>C, NM_004009.3:c.3405T>C, NM_004010.2:c.3048T>C, NM_004010.3:c.3048T>CVOUS01/04/2017
523DMDEx25NM_004006.2:c.3419A>Gp.His1140Arg | p.H1140RNM_000109.2:c.3395A>G, NM_000109.3:c.3395A>G, NM_004006.1:c.3419A>G, NM_004006.2:c.3419A>G, NM_004007.1:c.3050A>G, NM_004007.2:c.3050A>G, NM_004009.2:c.3407A>G, NM_004009.3:c.3407A>G, NM_004010.2:c.3050A>G, NM_004010.3:c.3050A>GVOUS05/08/2015
524DMDEx25NM_004006.2:c.3422T>Gp.Met1141Arg | p.M1141RNM_000109.2:c.3398T>G, NM_000109.3:c.3398T>G, NM_004006.1:c.3422T>G, NM_004006.2:c.3422T>G, NM_004007.1:c.3053T>G, NM_004007.2:c.3053T>G, NM_004009.2:c.3410T>G, NM_004009.3:c.3410T>G, NM_004010.2:c.3053T>G, NM_004010.3:c.3053T>GVOUS10/29/2015
525DMDEx25NM_004006.2:c.3432+1G>ANM_000109.2:c.3408+1G>A, NM_000109.3:c.3408+1G>A, NM_004006.1:c.3432+1G>A, NM_004006.2:c.3432+1G>A, NM_004007.1:c.3063+1G>A, NM_004007.2:c.3063+1G>A, NM_004009.2:c.3420+1G>A, NM_004009.3:c.3420+1G>A, NM_004010.2:c.3063+1G>A, NM_004010.3:c.3063+1G>APathogenic03/05/2017 
526DMDEx25NM_004006.2:c.3432+3A>GLRG_199t1:c.3432+3A>G, NM_000109.2:c.3408+3A>G, NM_000109.3:c.3408+3A>G, NM_004006.1:c.3432+3A>G, NM_004006.2:c.3432+3A>G, NM_004007.1:c.3063+3A>G, NM_004007.2:c.3063+3A>G, NM_004009.2:c.3420+3A>G, NM_004009.3:c.3420+3A>G, NM_004010.2:c.3063+3A>G, NM_004010.3:c.3063+3A>GPathogenic03/02/2017 
527DMDEx25NM_004006.2:c.3432+10A>GLRG_199t1:c.3432+10A>G, NM_000109.2:c.3408+10A>G, NM_000109.3:c.3408+10A>G, NM_004006.1:c.3432+10A>G, NM_004006.2:c.3432+10A>G, NM_004007.1:c.3063+10A>G, NM_004007.2:c.3063+10A>G, NM_004009.2:c.3420+10A>G, NM_004009.3:c.3420+10A>G, NM_004010.2:c.3063+10A>G, NM_004010.3:c.3063+10A>GVOUS11/17/2017
528DMDEx25NM_004006.2:c.3432+2036A>CIVS25+2036A>C, NM_000109.2:c.3408+2036A>C, NM_000109.3:c.3408+2036A>C, NM_004006.1:c.3432+2036A>C, NM_004006.2:c.3432+2036A>C, NM_004007.1:c.3063+2036A>C, NM_004007.2:c.3063+2036A>C, NM_004009.2:c.3420+2036A>C, NM_004009.3:c.3420+2036A>C, NM_004010.2:c.3063+2036A>C, NM_004010.3:c.3063+2036A>CLikely benign11/23/2016 
529DMDEx25NM_004006.2:c.3432+2089A>TVOUS**
530DMDEx26NM_004006.2:c.3433-2_3433-1delAGinsCCLRG_199t1:c.3433-2_3433-1delinsCC, NM_000109.2:c.3409-2_3409-1delinsCC, NM_000109.3:c.3409-2_3409-1delinsCC, NM_004006.1:c.3433-2_3433-1delinsCC, NM_004006.2:c.3433-2_3433-1delinsCC, NM_004007.1:c.3064-2_3064-1delinsCC, NM_004007.2:c.3064-2_3064-1delinsCC, NM_004009.2:c.3421-2_3421-1delinsCC, NM_004009.3:c.3421-2_3421-1delinsCC, NM_004010.2:c.3064-2_3064-1delinsCC, NM_004010.3:c.3064-2_3064-1delinsCCPathogenic05/16/2017 
531DMDEx26NM_004006.2:c.3433-1G>ALRG_199t1:c.3433-1G>A, NM_000109.2:c.3409-1G>A, NM_000109.3:c.3409-1G>A, NM_004006.1:c.3433-1G>A, NM_004006.2:c.3433-1G>A, NM_004007.1:c.3064-1G>A, NM_004007.2:c.3064-1G>A, NM_004009.2:c.3421-1G>A, NM_004009.3:c.3421-1G>A, NM_004010.2:c.3064-1G>A, NM_004010.3:c.3064-1G>APathogenic** 
532DMDEx26NM_004006.2:c.3445A>Gp.Lys1149Glu | p.K1149ENM_000109.2:c.3421A>G, NM_000109.3:c.3421A>G, NM_004006.1:c.3445A>G, NM_004006.2:c.3445A>G, NM_004007.1:c.3076A>G, NM_004007.2:c.3076A>G, NM_004009.2:c.3433A>G, NM_004009.3:c.3433A>G, NM_004010.2:c.3076A>G, NM_004010.3:c.3076A>GVOUS01/15/2016
533DMDEx26NM_004006.2:c.3446A>Gp.Lys1149Arg | p.K1149RLRG_199t1:c.3446A>G, NM_000109.2:c.3422A>G, NM_000109.3:c.3422A>G, NM_004006.1:c.3446A>G, NM_004006.2:c.3446A>G, NM_004007.1:c.3077A>G, NM_004007.2:c.3077A>G, NM_004009.2:c.3434A>G, NM_004009.3:c.3434A>G, NM_004010.2:c.3077A>G, NM_004010.3:c.3077A>GVOUS10/23/2012
534DMDEx26NM_004006.2:c.3450G>Ap.Glu1150= | p.E1150=LRG_199t1:c.3450G>A, NM_000109.2:c.3426G>A, NM_000109.3:c.3426G>A, NM_004006.1:c.3450G>A, NM_004006.2:c.3450G>A, NM_004007.1:c.3081G>A, NM_004007.2:c.3081G>A, NM_004009.2:c.3438G>A, NM_004009.3:c.3438G>A, NM_004010.2:c.3081G>A, NM_004010.3:c.3081G>AVOUS10/10/2016
535DMDEx26NM_004006.2:c.3461G>Tp.Gly1154Val | p.G1154VLRG_199t1:c.3461G>T, NM_000109.2:c.3437G>T, NM_000109.3:c.3437G>T, NM_004006.1:c.3461G>T, NM_004006.2:c.3461G>T, NM_004007.1:c.3092G>T, NM_004007.2:c.3092G>T, NM_004009.2:c.3449G>T, NM_004009.3:c.3449G>T, NM_004010.2:c.3092G>T, NM_004010.3:c.3092G>TVOUS04/02/2018
536DMDEx26NM_004006.2:c.3467_3468delGGinsCp.Leu1156Serfs*5 | p.L1156SfsX5LRG_199t1:c.3467_3468delinsC, NM_000109.2:c.3443_3444delinsC, NM_000109.3:c.3443_3444delinsC, NM_004006.1:c.3467_3468delinsC, NM_004006.2:c.3467_3468delinsC, NM_004007.1:c.3098_3099delinsC, NM_004007.2:c.3098_3099delinsC, NM_004009.2:c.3455_3456delinsC, NM_004009.3:c.3455_3456delinsC, NM_004010.2:c.3098_3099delinsC, NM_004010.3:c.3098_3099delinsCPathogenic03/18/2016 
537DMDEx26NM_004006.2:c.3497_3500delTATCPathogenic08/29/2014 
538DMDEx26NM_004006.2:c.3500C>Gp.Ser1167* | p.S1167XLRG_199t1:c.3500C>G, NM_000109.2:c.3476C>G, NM_000109.3:c.3476C>G, NM_004006.1:c.3500C>G, NM_004006.2:c.3500C>G, NM_004007.1:c.3131C>G, NM_004007.2:c.3131C>G, NM_004009.2:c.3488C>G, NM_004009.3:c.3488C>G, NM_004010.2:c.3131C>G, NM_004010.3:c.3131C>GPathogenic01/30/2018 
539DMDEx26NM_004006.2:c.3502G>Tp.Glu1168* | p.E1168XPathogenic** 
540DMDEx26NM_004006.2:c.3532G>Tp.Glu1178* | p.E1178XNM_000109.2:c.3508G>T, NM_000109.3:c.3508G>T, NM_004006.1:c.3532G>T, NM_004006.2:c.3532G>T, NM_004007.1:c.3163G>T, NM_004007.2:c.3163G>T, NM_004009.2:c.3520G>T, NM_004009.3:c.3520G>T, NM_004010.2:c.3163G>T, NM_004010.3:c.3163G>TPathogenic04/23/2014 
541DMDEx26NM_004006.2:c.3535G>Tp.Glu1179* | p.E1179XNM_000109.2:c.3511G>T, NM_000109.3:c.3511G>T, NM_004006.1:c.3535G>T, NM_004006.2:c.3535G>T, NM_004007.1:c.3166G>T, NM_004007.2:c.3166G>T, NM_004009.2:c.3523G>T, NM_004009.3:c.3523G>T, NM_004010.2:c.3166G>T, NM_004010.3:c.3166G>TPathogenic06/03/2014 
542DMDEx26NM_004006.2:c.3580C>Tp.Gln1194* | p.Q1194XNM_000109.2:c.3556C>T, NM_000109.3:c.3556C>T, NM_004006.1:c.3580C>T, NM_004006.2:c.3580C>T, NM_004007.1:c.3211C>T, NM_004007.2:c.3211C>T, NM_004009.2:c.3568C>T, NM_004009.3:c.3568C>T, NM_004010.2:c.3211C>T, NM_004010.3:c.3211C>TPathogenic05/06/2013 
543DMDEx26NM_004006.2:c.3603G>Tp.Lys1201Asn | p.K1201NLRG_199t1:c.3603G>T, NM_000109.2:c.3579G>T, NM_000109.3:c.3579G>T, NM_004006.1:c.3603G>T, NM_004006.2:c.3603G>T, NM_004007.1:c.3234G>T, NM_004007.2:c.3234G>T, NM_004009.2:c.3591G>T, NM_004009.3:c.3591G>T, NM_004010.2:c.3234G>T, NM_004010.3:c.3234G>TVOUS12/21/2016
544DMDEx26NM_004006.2:c.3603+1G>TLRG_199t1:c.3603+1G>T, NM_000109.2:c.3579+1G>T, NM_000109.3:c.3579+1G>T, NM_004006.1:c.3603+1G>T, NM_004006.2:c.3603+1G>T, NM_004007.1:c.3234+1G>T, NM_004007.2:c.3234+1G>T, NM_004009.2:c.3591+1G>T, NM_004009.3:c.3591+1G>T, NM_004010.2:c.3234+1G>T, NM_004010.3:c.3234+1G>TPathogenic07/17/2017 
545DMDEx26NM_004006.2:c.3603+2dupTLRG_199t1:c.3603+2_3603+3insT, LRG_199t1:c.3603+2dupT, NM_000109.2:c.3579+2_3579+3insT, NM_000109.2:c.3579+2dupT, NM_000109.3:c.3579+2_3579+3insT, NM_000109.3:c.3579+2dupT, NM_004006.1:c.3603+2_3603+3insT, NM_004006.1:c.3603+2dupT, NM_004006.2:c.3603+2_3603+3insT, NM_004006.2:c.3603+2dupT, NM_004007.1:c.3234+2_3234+3insT, NM_004007.1:c.3234+2dupT, NM_004007.2:c.3234+2_3234+3insT, NM_004007.2:c.3234+2dupT, NM_004009.2:c.3591+2_3591+3insT, NM_004009.2:c.3591+2dupT, NM_004009.3:c.3591+2_3591+3insT, NM_004009.3:c.3591+2dupT, NM_004010.2:c.3234+2_3234+3insT, NM_004010.2:c.3234+2dupT, NM_004010.3:c.3234+2_3234+3insT, NM_004010.3:c.3234+2dupTPathogenic12/11/2017 
546DMDEx26NM_004006.2:c.3603+2T>ANM_000109.2:c.3579+2T>A, NM_000109.3:c.3579+2T>A, NM_004006.1:c.3603+2T>A, NM_004006.2:c.3603+2T>A, NM_004007.1:c.3234+2T>A, NM_004007.2:c.3234+2T>A, NM_004009.2:c.3591+2T>A, NM_004009.3:c.3591+2T>A, NM_004010.2:c.3234+2T>A, NM_004010.3:c.3234+2T>APathogenic08/22/2016 
547DMDEx26NM_004006.2:c.3603+3delANM_000109.2:c.3579+3delA, NM_000109.3:c.3579+3delA, NM_004006.1:c.3603+3delA, NM_004006.2:c.3603+3delA, NM_004007.1:c.3234+3delA, NM_004007.2:c.3234+3delA, NM_004009.2:c.3591+3delA, NM_004009.3:c.3591+3delA, NM_004010.2:c.3234+3delA, NM_004010.3:c.3234+3delABenign** 
548DMDEx26NM_004006.2:c.3603+7A>GLRG_199t1:c.3603+7A>G, NM_000109.2:c.3579+7A>G, NM_000109.3:c.3579+7A>G, NM_004006.1:c.3603+7A>G, NM_004006.2:c.3603+7A>G, NM_004007.1:c.3234+7A>G, NM_004007.2:c.3234+7A>G, NM_004009.2:c.3591+7A>G, NM_004009.3:c.3591+7A>G, NM_004010.2:c.3234+7A>G, NM_004010.3:c.3234+7A>GVOUS09/02/2016
549DMDEx26NM_004006.2:c.3603+8A>GNM_000109.2:c.3579+8A>G, NM_000109.3:c.3579+8A>G, NM_004006.1:c.3603+8A>G, NM_004006.2:c.3603+8A>G, NM_004007.1:c.3234+8A>G, NM_004007.2:c.3234+8A>G, NM_004009.2:c.3591+8A>G, NM_004009.3:c.3591+8A>G, NM_004010.2:c.3234+8A>G, NM_004010.3:c.3234+8A>GBenign09/21/2012 
550DMDEx26NM_004006.2:c.3603+15dupANM_000109.2:c.3579+14_3579+15insA, NM_000109.2:c.3579+15_3579+16insA, NM_000109.3:c.3579+14_3579+15insA, NM_000109.3:c.3579+15_3579+16insA, NM_004006.1:c.3603+14_3603+15insA, NM_004006.1:c.3603+15_3603+16insA, NM_004006.2:c.3603+14_3603+15insA, NM_004006.2:c.3603+15_3603+16insA, NM_004007.1:c.3234+14_3234+15insA, NM_004007.1:c.3234+15_3234+16insA, NM_004007.2:c.3234+14_3234+15insA, NM_004007.2:c.3234+15_3234+16insA, NM_004009.2:c.3591+14_3591+15insA, NM_004009.2:c.3591+15_3591+16insA, NM_004009.3:c.3591+14_3591+15insA, NM_004009.3:c.3591+15_3591+16insA, NM_004010.2:c.3234+14_3234+15insA, NM_004010.2:c.3234+15_3234+16insA, NM_004010.3:c.3234+14_3234+15insA, NM_004010.3:c.3234+15_3234+16insALikely benign04/28/2015 
551DMDEx27NM_004006.2:c.3605G>Tp.Arg1202Ile | p.R1202ILRG_199t1:c.3605G>T, NM_000109.2:c.3581G>T, NM_000109.3:c.3581G>T, NM_004006.1:c.3605G>T, NM_004006.2:c.3605G>T, NM_004007.1:c.3236G>T, NM_004007.2:c.3236G>T, NM_004009.2:c.3593G>T, NM_004009.3:c.3593G>T, NM_004010.2:c.3236G>T, NM_004010.3:c.3236G>TVOUS03/23/2021
552DMDEx27NM_004006.2:c.3607G>Ap.Ala1203Thr | p.A1203TLRG_199t1:c.3607G>A, NM_000109.2:c.3583G>A, NM_000109.3:c.3583G>A, NM_004006.1:c.3607G>A, NM_004006.2:c.3607G>A, NM_004007.1:c.3238G>A, NM_004007.2:c.3238G>A, NM_004009.2:c.3595G>A, NM_004009.3:c.3595G>A, NM_004010.2:c.3238G>A, NM_004010.3:c.3238G>AVOUS12/28/2017
553DMDEx27NM_004006.2:c.3626A>Gp.Gln1209Arg | p.Q1209RLRG_199t1:c.3626A>G, NM_000109.2:c.3602A>G, NM_000109.3:c.3602A>G, NM_004006.1:c.3626A>G, NM_004006.2:c.3626A>G, NM_004007.1:c.3257A>G, NM_004007.2:c.3257A>G, NM_004009.2:c.3614A>G, NM_004009.3:c.3614A>G, NM_004010.2:c.3257A>G, NM_004010.3:c.3257A>GVOUS07/24/2018
554DMDEx27NM_004006.2:c.3635C>Tp.Ala1212Val | p.A1212VLRG_199t1:c.3635C>T, NM_000109.2:c.3611C>T, NM_000109.3:c.3611C>T, NM_004006.1:c.3635C>T, NM_004006.2:c.3635C>T, NM_004007.1:c.3266C>T, NM_004007.2:c.3266C>T, NM_004009.2:c.3623C>T, NM_004009.3:c.3623C>T, NM_004010.2:c.3266C>T, NM_004010.3:c.3266C>TLikely benign12/13/2016 
555DMDEx27NM_004006.2:c.3637A>Gp.Lys1213Glu | p.K1213ENM_000109.2:c.3613A>G, NM_000109.3:c.3613A>G, NM_004006.1:c.3637A>G, NM_004006.2:c.3637A>G, NM_004007.1:c.3268A>G, NM_004007.2:c.3268A>G, NM_004009.2:c.3625A>G, NM_004009.3:c.3625A>G, NM_004010.2:c.3268A>G, NM_004010.3:c.3268A>GVOUS02/01/2016
556DMDEx27NM_004006.2:c.3639dupAPathogenic03/18/2013 
557DMDEx27NM_004006.2:c.3649C>Gp.Leu1217Val | p.L1217VNM_000109.2:c.3625C>G, NM_000109.3:c.3625C>G, NM_004006.1:c.3649C>G, NM_004006.2:c.3649C>G, NM_004007.1:c.3280C>G, NM_004007.2:c.3280C>G, NM_004009.2:c.3637C>G, NM_004009.3:c.3637C>G, NM_004010.2:c.3280C>G, NM_004010.3:c.3280C>GVOUS11/24/2015
558DMDEx27NM_004006.2:c.3663A>Gp.Val1221= | p.V1221=LRG_199t1:c.3663A>G, NM_000109.2:c.3639A>G, NM_000109.3:c.3639A>G, NM_004006.1:c.3663A>G, NM_004006.2:c.3663A>G, NM_004007.1:c.3294A>G, NM_004007.2:c.3294A>G, NM_004009.2:c.3651A>G, NM_004009.3:c.3651A>G, NM_004010.2:c.3294A>G, NM_004010.3:c.3294A>GVOUS04/19/2018
559DMDEx27NM_004006.2:c.3666T>Cp.Asn1222= | p.N1222=LRG_199t1:c.3666T>C, NM_000109.2:c.3642T>C, NM_000109.3:c.3642T>C, NM_004006.1:c.3666T>C, NM_004006.2:c.3666T>C, NM_004007.1:c.3297T>C, NM_004007.2:c.3297T>C, NM_004009.2:c.3654T>C, NM_004009.3:c.3654T>C, NM_004010.2:c.3297T>C, NM_004010.3:c.3297T>CLikely benign06/14/2018 
560DMDEx27NM_004006.2:c.3688C>Tp.Pro1230Ser | p.P1230SNM_000109.2:c.3664C>T, NM_000109.3:c.3664C>T, NM_004006.1:c.3688C>T, NM_004006.2:c.3688C>T, NM_004007.1:c.3319C>T, NM_004007.2:c.3319C>T, NM_004009.2:c.3676C>T, NM_004009.3:c.3676C>T, NM_004010.2:c.3319C>T, NM_004010.3:c.3319C>TVOUS11/06/2015
561DMDEx27NM_004006.2:c.3696A>Cp.Ala1232= | p.A1232=NM_000109.2:c.3672A>C, NM_000109.3:c.3672A>C, NM_004006.1:c.3696A>C, NM_004006.2:c.3696A>C, NM_004007.1:c.3327A>C, NM_004007.2:c.3327A>C, NM_004009.2:c.3684A>C, NM_004009.3:c.3684A>C, NM_004010.2:c.3327A>C, NM_004010.3:c.3327A>CVOUS12/11/2014
562DMDEx27NM_004006.2:c.3697delCPathogenic** 
563DMDEx27NM_004006.2:c.3705C>Tp.Ala1235= | p.A1235=NM_000109.2:c.3681C>T, NM_000109.3:c.3681C>T, NM_004006.1:c.3705C>T, NM_004006.2:c.3705C>T, NM_004007.1:c.3336C>T, NM_004007.2:c.3336C>T, NM_004009.2:c.3693C>T, NM_004009.3:c.3693C>T, NM_004010.2:c.3336C>T, NM_004010.3:c.3336C>TBenign03/13/2013 
564DMDEx27NM_004006.2:c.3734C>Tp.Thr1245Ile | p.T1245INM_000109.2:c.3710C>T, NM_000109.3:c.3710C>T, NM_004006.1:c.3734C>T, NM_004006.2:c.3734C>T, NM_004007.1:c.3365C>T, NM_004007.2:c.3365C>T, NM_004009.2:c.3722C>T, NM_004009.3:c.3722C>T, NM_004010.2:c.3365C>T, NM_004010.3:c.3365C>TBenign08/10/2015 
565DMDEx27NM_004006.2:c.3747delGPathogenic11/13/2012 
566DMDEx27NM_004006.2:c.3747G>Ap.Trp1249* | p.W1249XLRG_199t1:c.3747G>A, NM_000109.2:c.3723G>A, NM_000109.3:c.3723G>A, NM_004006.1:c.3747G>A, NM_004006.2:c.3747G>A, NM_004007.1:c.3378G>A, NM_004007.2:c.3378G>A, NM_004009.2:c.3735G>A, NM_004009.3:c.3735G>A, NM_004010.2:c.3378G>A, NM_004010.3:c.3378G>APathogenic04/19/2016 
567DMDEx27NM_004006.2:c.3752G>Cp.Cys1251Ser | p.C1251SLRG_199t1:c.3752G>C, NM_000109.2:c.3728G>C, NM_000109.3:c.3728G>C, NM_004006.1:c.3752G>C, NM_004006.2:c.3752G>C, NM_004007.1:c.3383G>C, NM_004007.2:c.3383G>C, NM_004009.2:c.3740G>C, NM_004009.3:c.3740G>C, NM_004010.2:c.3383G>C, NM_004010.3:c.3383G>CVOUS02/28/2020
568DMDEx27NM_004006.2:c.3774C>Tp.Cys1258= | p.C1258=LRG_199t1:c.3774C>T, NM_000109.2:c.3750C>T, NM_000109.3:c.3750C>T, NM_004006.1:c.3774C>T, NM_004006.2:c.3774C>T, NM_004007.1:c.3405C>T, NM_004007.2:c.3405C>T, NM_004009.2:c.3762C>T, NM_004009.3:c.3762C>T, NM_004010.2:c.3405C>T, NM_004010.3:c.3405C>TVOUS10/06/2017
569DMDEx27NM_004006.2:c.3778A>Gp.Thr1260Ala | p.T1260ALRG_199t1:c.3778A>G, NM_000109.2:c.3754A>G, NM_000109.3:c.3754A>G, NM_004006.1:c.3778A>G, NM_004006.2:c.3778A>G, NM_004007.1:c.3409A>G, NM_004007.2:c.3409A>G, NM_004009.2:c.3766A>G, NM_004009.3:c.3766A>G, NM_004010.2:c.3409A>G, NM_004010.3:c.3409A>GVOUS06/08/2016
570DMDEx27NM_004006.2:c.3779_3785delCTTTGGAinsGGPathogenic04/09/2013 
571DMDEx27NM_004006.2:c.3786+16T>CNM_000109.2:c.3762+16T>C, NM_000109.3:c.3762+16T>C, NM_004006.1:c.3786+16T>C, NM_004006.2:c.3786+16T>C, NM_004007.1:c.3417+16T>C, NM_004007.2:c.3417+16T>C, NM_004009.2:c.3774+16T>C, NM_004009.3:c.3774+16T>C, NM_004010.2:c.3417+16T>C, NM_004010.3:c.3417+16T>CVOUS02/02/2016
572DMDEx28NM_004006.2:c.3787-18T>CNM_000109.2:c.3763-18T>C, NM_000109.3:c.3763-18T>C, NM_004006.1:c.3787-18T>C, NM_004006.2:c.3787-18T>C, NM_004007.1:c.3418-18T>C, NM_004007.2:c.3418-18T>C, NM_004009.2:c.3775-18T>C, NM_004009.3:c.3775-18T>C, NM_004010.2:c.3418-18T>C, NM_004010.3:c.3418-18T>CBenign08/10/2015 
573DMDEx28NM_004006.2:c.3794G>Cp.Trp1265Ser | p.W1265SNM_000109.2:c.3770G>C, NM_000109.3:c.3770G>C, NM_004006.1:c.3794G>C, NM_004006.2:c.3794G>C, NM_004007.1:c.3425G>C, NM_004007.2:c.3425G>C, NM_004009.2:c.3782G>C, NM_004009.3:c.3782G>C, NM_004010.2:c.3425G>C, NM_004010.3:c.3425G>CLikely benign12/04/2015 
574DMDEx28NM_004006.2:c.3814T>Cp.Leu1272= | p.L1272=NM_000109.2:c.3790T>C, NM_000109.3:c.3790T>C, NM_004006.1:c.3814T>C, NM_004006.2:c.3814T>C, NM_004007.1:c.3445T>C, NM_004007.2:c.3445T>C, NM_004009.2:c.3802T>C, NM_004009.3:c.3802T>C, NM_004010.2:c.3445T>C, NM_004010.3:c.3445T>CVOUS01/08/2016
575DMDEx28NM_004006.2:c.3816G>Cp.Leu1272Phe | p.L1272FNM_000109.2:c.3792G>C, NM_000109.3:c.3792G>C, NM_004006.1:c.3816G>C, NM_004006.2:c.3816G>C, NM_004007.1:c.3447G>C, NM_004007.2:c.3447G>C, NM_004009.2:c.3804G>C, NM_004009.3:c.3804G>C, NM_004010.2:c.3447G>C, NM_004010.3:c.3447G>CVOUS10/29/2015
576DMDEx28NM_004006.2:c.3838A>Tp.Lys1280* | p.K1280XNM_000109.2:c.3814A>T, NM_000109.3:c.3814A>T, NM_004006.1:c.3838A>T, NM_004006.2:c.3838A>T, NM_004007.1:c.3469A>T, NM_004007.2:c.3469A>T, NM_004009.2:c.3826A>T, NM_004009.3:c.3826A>T, NM_004010.2:c.3469A>T, NM_004010.3:c.3469A>TPathogenic02/02/2015 
577DMDEx28NM_004006.2:c.3841T>Cp.Trp1281Arg | p.W1281RLRG_199t1:c.3841T>C, NM_000109.2:c.3817T>C, NM_000109.3:c.3817T>C, NM_004006.1:c.3841T>C, NM_004006.2:c.3841T>C, NM_004007.1:c.3472T>C, NM_004007.2:c.3472T>C, NM_004009.2:c.3829T>C, NM_004009.3:c.3829T>C, NM_004010.2:c.3472T>C, NM_004010.3:c.3472T>CVOUS03/31/2016
578DMDEx28NM_004006.2:c.3885delTp.Pro1296Leufs*11 | p.P1296LfsX11LRG_199t1:c.3885delT, NM_000109.2:c.3861delT, NM_000109.3:c.3861delT, NM_004006.1:c.3885delT, NM_004006.2:c.3885delT, NM_004007.1:c.3516delT, NM_004007.2:c.3516delT, NM_004009.2:c.3873delT, NM_004009.3:c.3873delT, NM_004010.2:c.3516delT, NM_004010.3:c.3516delTPathogenic04/27/2017 
579DMDEx29NM_004006.2:c.3923C>Ap.Ser1308* | p.S1308XLRG_199t1:c.3923C>A, NM_000109.2:c.3899C>A, NM_000109.3:c.3899C>A, NM_004006.1:c.3923C>A, NM_004006.2:c.3923C>A, NM_004007.1:c.3554C>A, NM_004007.2:c.3554C>A, NM_004009.2:c.3911C>A, NM_004009.3:c.3911C>A, NM_004010.2:c.3554C>A, NM_004010.3:c.3554C>APathogenic12/01/2017 
580DMDEx29NM_004006.2:c.3936G>Cp.Leu1312Phe | p.L1312FNM_000109.2:c.3912G>C, NM_000109.3:c.3912G>C, NM_004006.1:c.3936G>C, NM_004006.2:c.3936G>C, NM_004007.1:c.3567G>C, NM_004007.2:c.3567G>C, NM_004009.2:c.3924G>C, NM_004009.3:c.3924G>C, NM_004010.2:c.3567G>C, NM_004010.3:c.3567G>CVOUS02/02/2016
581DMDEx29NM_004006.2:c.3940C>Tp.Arg1314* | p.R1314XLRG_199t1:c.3940C>T, NM_000109.2:c.3916C>T, NM_000109.3:c.3916C>T, NM_004006.1:c.3940C>T, NM_004006.2:c.3940C>T, NM_004007.1:c.3571C>T, NM_004007.2:c.3571C>T, NM_004009.2:c.3928C>T, NM_004009.3:c.3928C>T, NM_004010.2:c.3571C>T, NM_004010.3:c.3571C>TPathogenic06/22/2017 
582DMDEx29NM_004006.2:c.3951G>Ap.Glu1317= | p.E1317=NM_000109.2:c.3927G>A, NM_000109.3:c.3927G>A, NM_004006.1:c.3951G>A, NM_004006.2:c.3951G>A, NM_004007.1:c.3582G>A, NM_004007.2:c.3582G>A, NM_004009.2:c.3939G>A, NM_004009.3:c.3939G>A, NM_004010.2:c.3582G>A, NM_004010.3:c.3582G>AVOUS12/04/2018
583DMDEx29NM_004006.2:c.3959C>Gp.Pro1320Arg | p.P1320RNM_000109.2:c.3935C>G, NM_000109.3:c.3935C>G, NM_004006.1:c.3959C>G, NM_004006.2:c.3959C>G, NM_004007.1:c.3590C>G, NM_004007.2:c.3590C>G, NM_004009.2:c.3947C>G, NM_004009.3:c.3947C>G, NM_004010.2:c.3590C>G, NM_004010.3:c.3590C>GVOUS06/15/2018
584DMDEx29NM_004006.2:c.3966G>Tp.Gln1322His | p.Q1322HLRG_199t1:c.3966G>T, NM_000109.2:c.3942G>T, NM_000109.3:c.3942G>T, NM_004006.1:c.3966G>T, NM_004006.2:c.3966G>T, NM_004007.1:c.3597G>T, NM_004007.2:c.3597G>T, NM_004009.2:c.3954G>T, NM_004009.3:c.3954G>T, NM_004010.2:c.3597G>T, NM_004010.3:c.3597G>TVOUS07/10/2018
585DMDEx29NM_004006.2:c.3970C>Tp.Arg1324Cys | p.R1324CNM_000109.2:c.3946C>T, NM_000109.3:c.3946C>T, NM_004006.1:c.3970C>T, NM_004006.2:c.3970C>T, NM_004007.1:c.3601C>T, NM_004007.2:c.3601C>T, NM_004009.2:c.3958C>T, NM_004009.3:c.3958C>T, NM_004010.2:c.3601C>T, NM_004010.3:c.3601C>TLikely benign11/02/2015 
586DMDEx29NM_004006.2:c.4040T>Ap.Phe1347Tyr | p.F1347YLRG_199t1:c.4040T>A, NM_000109.2:c.4016T>A, NM_000109.3:c.4016T>A, NM_004006.1:c.4040T>A, NM_004006.2:c.4040T>A, NM_004007.1:c.3671T>A, NM_004007.2:c.3671T>A, NM_004009.2:c.4028T>A, NM_004009.3:c.4028T>A, NM_004010.2:c.3671T>A, NM_004010.3:c.3671T>AVOUS06/08/2018
587DMDEx29NM_004006.2:c.4049G>Ap.Arg1350His | p.R1350HLRG_199t1:c.4049G>A, NM_000109.2:c.4025G>A, NM_000109.3:c.4025G>A, NM_004006.1:c.4049G>A, NM_004006.2:c.4049G>A, NM_004007.1:c.3680G>A, NM_004007.2:c.3680G>A, NM_004009.2:c.4037G>A, NM_004009.3:c.4037G>A, NM_004010.2:c.3680G>A, NM_004010.3:c.3680G>AVOUS08/09/2016
588DMDEx29NM_004006.2:c.4071G>Cp.Glu1357Asp | p.E1357DNM_000109.2:c.4047G>C, NM_000109.3:c.4047G>C, NM_004006.1:c.4071G>C, NM_004006.2:c.4071G>C, NM_004007.1:c.3702G>C, NM_004007.2:c.3702G>C, NM_004009.2:c.4059G>C, NM_004009.3:c.4059G>C, NM_004010.2:c.3702G>C, NM_004010.3:c.3702G>CPathogenic** 
589DMDEx29NM_004006.2:c.4071+1G>ALRG_199t1:c.4071+1G>A, NM_000109.2:c.4047+1G>A, NM_000109.3:c.4047+1G>A, NM_004006.1:c.4071+1G>A, NM_004006.2:c.4071+1G>A, NM_004007.1:c.3702+1G>A, NM_004007.2:c.3702+1G>A, NM_004009.2:c.4059+1G>A, NM_004009.3:c.4059+1G>A, NM_004010.2:c.3702+1G>A, NM_004010.3:c.3702+1G>APathogenic01/06/2017 
590DMDEx30NM_004006.2:c.4072-245C>TLRG_199t1:c.4072-245C>T, NM_000109.2:c.4048-245C>T, NM_000109.3:c.4048-245C>T, NM_004006.1:c.4072-245C>T, NM_004006.2:c.4072-245C>T, NM_004007.1:c.3703-245C>T, NM_004007.2:c.3703-245C>T, NM_004009.2:c.4060-245C>T, NM_004009.3:c.4060-245C>T, NM_004010.2:c.3703-245C>T, NM_004010.3:c.3703-245C>T, NM_004011.2:c.48+4C>T, NM_004011.3:c.48+4C>T, NM_004012.2:c.-101C>T, NM_004012.3:c.-101C>TVOUS**
591DMDEx30NM_004006.2:c.4072-3T>CLRG_199t1:c.4072-3T>C, NM_000109.2:c.4048-3T>C, NM_000109.3:c.4048-3T>C, NM_004006.1:c.4072-3T>C, NM_004006.2:c.4072-3T>C, NM_004007.1:c.3703-3T>C, NM_004007.2:c.3703-3T>C, NM_004009.2:c.4060-3T>C, NM_004009.3:c.4060-3T>C, NM_004010.2:c.3703-3T>C, NM_004010.3:c.3703-3T>C, NM_004011.2:c.49-3T>C, NM_004011.3:c.49-3T>C, NM_004012.2:c.40-3T>C, NM_004012.3:c.40-3T>CVOUS08/09/2016
592DMDEx30NM_004006.2:c.4080G>Ap.Arg1360= | p.R1360=LRG_199t1:c.4080G>A, NM_000109.2:c.4056G>A, NM_000109.3:c.4056G>A, NM_004006.1:c.4080G>A, NM_004006.2:c.4080G>A, NM_004007.1:c.3711G>A, NM_004007.2:c.3711G>A, NM_004009.2:c.4068G>A, NM_004009.3:c.4068G>A, NM_004010.2:c.3711G>A, NM_004010.3:c.3711G>A, NM_004011.2:c.57G>A, NM_004011.3:c.57G>A, NM_004012.2:c.48G>A, NM_004012.3:c.48G>AVOUS03/21/2018
593DMDEx30NM_004006.2:c.4093C>Tp.Leu1365Phe | p.L1365FNM_000109.2:c.4069C>T, NM_000109.3:c.4069C>T, NM_004006.1:c.4093C>T, NM_004006.2:c.4093C>T, NM_004007.1:c.3724C>T, NM_004007.2:c.3724C>T, NM_004009.2:c.4081C>T, NM_004009.3:c.4081C>T, NM_004010.2:c.3724C>T, NM_004010.3:c.3724C>T, NM_004011.2:c.70C>T, NM_004011.3:c.70C>T, NM_004012.2:c.61C>T, NM_004012.3:c.61C>TLikely benign01/13/2016 
594DMDEx30NM_004006.2:c.4102A>Gp.Ser1368Gly | p.S1368GLRG_199t1:c.4102A>G, NM_000109.2:c.4078A>G, NM_000109.3:c.4078A>G, NM_004006.1:c.4102A>G, NM_004006.2:c.4102A>G, NM_004007.1:c.3733A>G, NM_004007.2:c.3733A>G, NM_004009.2:c.4090A>G, NM_004009.3:c.4090A>G, NM_004010.2:c.3733A>G, NM_004010.3:c.3733A>G, NM_004011.2:c.79A>G, NM_004011.3:c.79A>G, NM_004012.2:c.70A>G, NM_004012.3:c.70A>GVOUS12/07/2016
595DMDEx30NM_004006.2:c.4117C>Tp.Gln1373* | p.Q1373XNM_000109.2:c.4093C>T, NM_000109.3:c.4093C>T, NM_004006.1:c.4117C>T, NM_004006.2:c.4117C>T, NM_004007.1:c.3748C>T, NM_004007.2:c.3748C>T, NM_004009.2:c.4105C>T, NM_004009.3:c.4105C>T, NM_004010.2:c.3748C>T, NM_004010.3:c.3748C>T, NM_004011.2:c.94C>T, NM_004011.3:c.94C>T, NM_004012.2:c.85C>T, NM_004012.3:c.85C>TPathogenic11/28/2012 
596DMDEx30NM_004006.2:c.4120G>Tp.Glu1374* | p.E1374XLRG_199t1:c.4120G>T, NM_000109.2:c.4096G>T, NM_000109.3:c.4096G>T, NM_004006.1:c.4120G>T, NM_004006.2:c.4120G>T, NM_004007.1:c.3751G>T, NM_004007.2:c.3751G>T, NM_004009.2:c.4108G>T, NM_004009.3:c.4108G>T, NM_004010.2:c.3751G>T, NM_004010.3:c.3751G>T, NM_004011.2:c.97G>T, NM_004011.3:c.97G>T, NM_004012.2:c.88G>T, NM_004012.3:c.88G>TPathogenic09/27/2016 
597DMDEx30NM_004006.2:c.4125T>Cp.Thr1375= | p.T1375=NM_000109.2:c.4101T>C, NM_000109.3:c.4101T>C, NM_004006.1:c.4125T>C, NM_004006.2:c.4125T>C, NM_004007.1:c.3756T>C, NM_004007.2:c.3756T>C, NM_004009.2:c.4113T>C, NM_004009.3:c.4113T>C, NM_004010.2:c.3756T>C, NM_004010.3:c.3756T>C, NM_004011.2:c.102T>C, NM_004011.3:c.102T>C, NM_004012.2:c.93T>C, NM_004012.3:c.93T>CLikely benign01/19/2017 
598DMDEx30NM_004006.2:c.4151delAp.Glu1384Glyfs*34 | p.E1384GfsX34LRG_199t1:c.4151delA, NM_000109.2:c.4127delA, NM_000109.3:c.4127delA, NM_004006.1:c.4151delA, NM_004006.2:c.4151delA, NM_004007.1:c.3782delA, NM_004007.2:c.3782delA, NM_004009.2:c.4139delA, NM_004009.3:c.4139delA, NM_004010.2:c.3782delA, NM_004010.3:c.3782delA, NM_004011.2:c.128delA, NM_004011.3:c.128delA, NM_004012.2:c.119delA, NM_004012.3:c.119delAPathogenic08/09/2017 
599DMDEx30NM_004006.2:c.4162T>Gp.Phe1388Val | p.F1388VNM_000109.2:c.4138T>G, NM_000109.3:c.4138T>G, NM_004006.1:c.4162T>G, NM_004006.2:c.4162T>G, NM_004007.1:c.3793T>G, NM_004007.2:c.3793T>G, NM_004009.2:c.4150T>G, NM_004009.3:c.4150T>G, NM_004010.2:c.3793T>G, NM_004010.3:c.3793T>G, NM_004011.2:c.139T>G, NM_004011.3:c.139T>G, NM_004012.2:c.130T>G, NM_004012.3:c.130T>GBenign01/25/2016 
600DMDEx30NM_004006.2:c.4170C>Gp.Asp1390Glu | p.D1390ELRG_199t1:c.4170C>G, NM_000109.2:c.4146C>G, NM_000109.3:c.4146C>G, NM_004006.1:c.4170C>G, NM_004006.2:c.4170C>G, NM_004007.1:c.3801C>G, NM_004007.2:c.3801C>G, NM_004009.2:c.4158C>G, NM_004009.3:c.4158C>G, NM_004010.2:c.3801C>G, NM_004010.3:c.3801C>G, NM_004011.2:c.147C>G, NM_004011.3:c.147C>G, NM_004012.2:c.138C>G, NM_004012.3:c.138C>GVOUS04/25/2016
601DMDEx30NM_004006.2:c.4174C>Tp.Gln1392* | p.Q1392XLRG_199t1:c.4174C>T, NM_000109.2:c.4150C>T, NM_000109.3:c.4150C>T, NM_004006.1:c.4174C>T, NM_004006.2:c.4174C>T, NM_004007.1:c.3805C>T, NM_004007.2:c.3805C>T, NM_004009.2:c.4162C>T, NM_004009.3:c.4162C>T, NM_004010.2:c.3805C>T, NM_004010.3:c.3805C>T, NM_004011.2:c.151C>T, NM_004011.3:c.151C>T, NM_004012.2:c.142C>T, NM_004012.3:c.142C>TPathogenic09/27/2017 
602DMDEx30NM_004006.2:c.4233+2C>TNM_000109.2:c.4209+2C>T, NM_000109.3:c.4209+2C>T, NM_004006.1:c.4233+2C>T, NM_004006.2:c.4233+2C>T, NM_004007.1:c.3864+2C>T, NM_004007.2:c.3864+2C>T, NM_004009.2:c.4221+2C>T, NM_004009.3:c.4221+2C>T, NM_004010.2:c.3864+2C>T, NM_004010.3:c.3864+2C>T, NM_004011.2:c.210+2C>T, NM_004011.3:c.210+2C>T, NM_004012.2:c.201+2C>T, NM_004012.3:c.201+2C>TLikely benign05/28/2015 
603DMDEx31NM_004006.2:c.4234-13A>GNM_000109.2:c.4210-13A>G, NM_000109.3:c.4210-13A>G, NM_004006.1:c.4234-13A>G, NM_004006.2:c.4234-13A>G, NM_004007.1:c.3865-13A>G, NM_004007.2:c.3865-13A>G, NM_004009.2:c.4222-13A>G, NM_004009.3:c.4222-13A>G, NM_004010.2:c.3865-13A>G, NM_004010.3:c.3865-13A>G, NM_004011.2:c.211-13A>G, NM_004011.3:c.211-13A>G, NM_004012.2:c.202-13A>G, NM_004012.3:c.202-13A>GBenign01/21/2016 
604DMDEx31NM_004006.2:c.4236A>Cp.Lys1412Asn | p.K1412NLRG_199t1:c.4236A>C, NM_000109.2:c.4212A>C, NM_000109.3:c.4212A>C, NM_004006.1:c.4236A>C, NM_004006.2:c.4236A>C, NM_004007.1:c.3867A>C, NM_004007.2:c.3867A>C, NM_004009.2:c.4224A>C, NM_004009.3:c.4224A>C, NM_004010.2:c.3867A>C, NM_004010.3:c.3867A>C, NM_004011.2:c.213A>C, NM_004011.3:c.213A>C, NM_004012.2:c.204A>C, NM_004012.3:c.204A>CVOUS09/11/2019
605DMDEx31NM_004006.2:c.4244C>Tp.Ser1415Phe | p.S1415FLRG_199t1:c.4244C>T, NM_000109.2:c.4220C>T, NM_000109.3:c.4220C>T, NM_004006.1:c.4244C>T, NM_004006.2:c.4244C>T, NM_004007.1:c.3875C>T, NM_004007.2:c.3875C>T, NM_004009.2:c.4232C>T, NM_004009.3:c.4232C>T, NM_004010.2:c.3875C>T, NM_004010.3:c.3875C>T, NM_004011.2:c.221C>T, NM_004011.3:c.221C>T, NM_004012.2:c.212C>T, NM_004012.3:c.212C>TVOUS01/24/2018
606DMDEx31NM_004006.2:c.4275A>Gp.Glu1425= | p.E1425=NM_000109.2:c.4251A>G, NM_000109.3:c.4251A>G, NM_004006.1:c.4275A>G, NM_004006.2:c.4275A>G, NM_004007.1:c.3906A>G, NM_004007.2:c.3906A>G, NM_004009.2:c.4263A>G, NM_004009.3:c.4263A>G, NM_004010.2:c.3906A>G, NM_004010.3:c.3906A>G, NM_004011.2:c.252A>G, NM_004011.3:c.252A>G, NM_004012.2:c.243A>G, NM_004012.3:c.243A>GBenign07/22/2014 
607DMDEx31NM_004006.2:c.4290_4291delTALRG_199t1:c.4290_4291delTA, NM_000109.2:c.4266_4267delTA, NM_000109.3:c.4266_4267delTA, NM_004006.1:c.4290_4291delTA, NM_004006.2:c.4290_4291delTA, NM_004007.1:c.3921_3922delTA, NM_004007.2:c.3921_3922delTA, NM_004009.2:c.4278_4279delTA, NM_004009.3:c.4278_4279delTA, NM_004010.2:c.3921_3922delTA, NM_004010.3:c.3921_3922delTA, NM_004011.2:c.267_268delTA, NM_004011.3:c.267_268delTA, NM_004012.2:c.258_259delTA, NM_004012.3:c.258_259delTAPathogenic02/07/2017 
608DMDEx31NM_004006.2:c.4295delAp.Gln1432Argfs*25 | p.Q1432RfsX25LRG_199t1:c.4295delA, NM_000109.2:c.4271delA, NM_000109.3:c.4271delA, NM_004006.1:c.4295delA, NM_004006.2:c.4295delA, NM_004007.1:c.3926delA, NM_004007.2:c.3926delA, NM_004009.2:c.4283delA, NM_004009.3:c.4283delA, NM_004010.2:c.3926delA, NM_004010.3:c.3926delA, NM_004011.2:c.272delA, NM_004011.3:c.272delA, NM_004012.2:c.263delA, NM_004012.3:c.263delAPathogenic04/19/2017 
609DMDEx31NM_004006.2:c.4297G>Cp.Gly1433Arg | p.G1433RNM_000109.2:c.4273G>C, NM_000109.3:c.4273G>C, NM_004006.1:c.4297G>C, NM_004006.2:c.4297G>C, NM_004007.1:c.3928G>C, NM_004007.2:c.3928G>C, NM_004009.2:c.4285G>C, NM_004009.3:c.4285G>C, NM_004010.2:c.3928G>C, NM_004010.3:c.3928G>C, NM_004011.2:c.274G>C, NM_004011.3:c.274G>C, NM_004012.2:c.265G>C, NM_004012.3:c.265G>CVOUS06/16/2015
610DMDEx31NM_004006.2:c.4302G>Cp.Lys1434Asn | p.K1434NLRG_199t1:c.4302G>C, NM_000109.2:c.4278G>C, NM_000109.3:c.4278G>C, NM_004006.1:c.4302G>C, NM_004006.2:c.4302G>C, NM_004007.1:c.3933G>C, NM_004007.2:c.3933G>C, NM_004009.2:c.4290G>C, NM_004009.3:c.4290G>C, NM_004010.2:c.3933G>C, NM_004010.3:c.3933G>C, NM_004011.2:c.279G>C, NM_004011.3:c.279G>C, NM_004012.2:c.270G>C, NM_004012.3:c.270G>CVOUS11/07/2016
611DMDEx31NM_004006.2:c.4307C>Ap.Ala1436Asp | p.A1436DNM_000109.2:c.4283C>A, NM_000109.3:c.4283C>A, NM_004006.1:c.4307C>A, NM_004006.2:c.4307C>A, NM_004007.1:c.3938C>A, NM_004007.2:c.3938C>A, NM_004009.2:c.4295C>A, NM_004009.3:c.4295C>A, NM_004010.2:c.3938C>A, NM_004010.3:c.3938C>A, NM_004011.2:c.284C>A, NM_004011.3:c.284C>A, NM_004012.2:c.275C>A, NM_004012.3:c.275C>AVOUS11/03/2015
612DMDEx31NM_004006.2:c.4309G>Tp.Ala1437Ser | p.A1437SLRG_199t1:c.4309G>T, NM_000109.2:c.4285G>T, NM_000109.3:c.4285G>T, NM_004006.1:c.4309G>T, NM_004006.2:c.4309G>T, NM_004007.1:c.3940G>T, NM_004007.2:c.3940G>T, NM_004009.2:c.4297G>T, NM_004009.3:c.4297G>T, NM_004010.2:c.3940G>T, NM_004010.3:c.3940G>T, NM_004011.2:c.286G>T, NM_004011.3:c.286G>T, NM_004012.2:c.277G>T, NM_004012.3:c.277G>TVOUS05/24/2016
613DMDEx31NM_004006.2:c.4312C>Tp.Gln1438* | p.Q1438XLRG_199t1:c.4312C>T, NM_000109.2:c.4288C>T, NM_000109.3:c.4288C>T, NM_004006.1:c.4312C>T, NM_004006.2:c.4312C>T, NM_004007.1:c.3943C>T, NM_004007.2:c.3943C>T, NM_004009.2:c.4300C>T, NM_004009.3:c.4300C>T, NM_004010.2:c.3943C>T, NM_004010.3:c.3943C>T, NM_004011.2:c.289C>T, NM_004011.3:c.289C>T, NM_004012.2:c.280C>T, NM_004012.3:c.280C>TPathogenic09/01/2016 
614DMDEx31NM_004006.2:c.4314_4315delAAPathogenic** 
615DMDEx31NM_004006.2:c.4315A>Tp.Arg1439* | p.R1439XNM_000109.2:c.4291A>T, NM_000109.3:c.4291A>T, NM_004006.1:c.4315A>T, NM_004006.2:c.4315A>T, NM_004007.1:c.3946A>T, NM_004007.2:c.3946A>T, NM_004009.2:c.4303A>T, NM_004009.3:c.4303A>T, NM_004010.2:c.3946A>T, NM_004010.3:c.3946A>T, NM_004011.2:c.292A>T, NM_004011.3:c.292A>T, NM_004012.2:c.283A>T, NM_004012.3:c.283A>TPathogenic05/05/2015 
616DMDEx31NM_004006.2:c.4344+17A>TNM_000109.2:c.4320+17A>T, NM_000109.3:c.4320+17A>T, NM_004006.1:c.4344+17A>T, NM_004006.2:c.4344+17A>T, NM_004007.1:c.3975+17A>T, NM_004007.2:c.3975+17A>T, NM_004009.2:c.4332+17A>T, NM_004009.3:c.4332+17A>T, NM_004010.2:c.3975+17A>T, NM_004010.3:c.3975+17A>T, NM_004011.2:c.321+17A>T, NM_004011.3:c.321+17A>T, NM_004012.2:c.312+17A>T, NM_004012.3:c.312+17A>TBenign01/25/2016 
617DMDEx32NM_004006.2:c.4345-12C>GLRG_199t1:c.4345-12C>G, NM_000109.2:c.4321-12C>G, NM_000109.3:c.4321-12C>G, NM_004006.1:c.4345-12C>G, NM_004006.2:c.4345-12C>G, NM_004007.1:c.3976-12C>G, NM_004007.2:c.3976-12C>G, NM_004009.2:c.4333-12C>G, NM_004009.3:c.4333-12C>G, NM_004010.2:c.3976-12C>G, NM_004010.3:c.3976-12C>G, NM_004011.2:c.322-12C>G, NM_004011.3:c.322-12C>G, NM_004012.2:c.313-12C>G, NM_004012.3:c.313-12C>GVOUS02/06/2013
618DMDEx32NM_004006.2:c.4345-8C>TLRG_199t1:c.4345-8C>T, NM_000109.2:c.4321-8C>T, NM_000109.3:c.4321-8C>T, NM_004006.1:c.4345-8C>T, NM_004006.2:c.4345-8C>T, NM_004007.1:c.3976-8C>T, NM_004007.2:c.3976-8C>T, NM_004009.2:c.4333-8C>T, NM_004009.3:c.4333-8C>T, NM_004010.2:c.3976-8C>T, NM_004010.3:c.3976-8C>T, NM_004011.2:c.322-8C>T, NM_004011.3:c.322-8C>T, NM_004012.2:c.313-8C>T, NM_004012.3:c.313-8C>TVOUS09/14/2016
619DMDEx32NM_004006.2:c.4375C>Tp.Arg1459* | p.R1459XLRG_199t1:c.4375C>T, NM_000109.2:c.4351C>T, NM_000109.3:c.4351C>T, NM_004006.1:c.4375C>T, NM_004006.2:c.4375C>T, NM_004007.1:c.4006C>T, NM_004007.2:c.4006C>T, NM_004009.2:c.4363C>T, NM_004009.3:c.4363C>T, NM_004010.2:c.4006C>T, NM_004010.3:c.4006C>T, NM_004011.2:c.352C>T, NM_004011.3:c.352C>T, NM_004012.2:c.343C>T, NM_004012.3:c.343C>TPathogenic11/07/2017 
620DMDEx32NM_004006.2:c.4396A>Cp.Asn1466His | p.N1466HLRG_199t1:c.4396A>C, NM_000109.2:c.4372A>C, NM_000109.3:c.4372A>C, NM_004006.1:c.4396A>C, NM_004006.2:c.4396A>C, NM_004007.1:c.4027A>C, NM_004007.2:c.4027A>C, NM_004009.2:c.4384A>C, NM_004009.3:c.4384A>C, NM_004010.2:c.4027A>C, NM_004010.3:c.4027A>C, NM_004011.2:c.373A>C, NM_004011.3:c.373A>C, NM_004012.2:c.364A>C, NM_004012.3:c.364A>CVOUS07/22/2016
621DMDEx32NM_004006.2:c.4405C>Tp.Gln1469* | p.Q1469XLRG_199t1:c.4405C>T, NM_000109.2:c.4381C>T, NM_000109.3:c.4381C>T, NM_004006.1:c.4405C>T, NM_004006.2:c.4405C>T, NM_004007.1:c.4036C>T, NM_004007.2:c.4036C>T, NM_004009.2:c.4393C>T, NM_004009.3:c.4393C>T, NM_004010.2:c.4036C>T, NM_004010.3:c.4036C>T, NM_004011.2:c.382C>T, NM_004011.3:c.382C>T, NM_004012.2:c.373C>T, NM_004012.3:c.373C>TPathogenic11/02/2017 
622DMDEx32NM_004006.2:c.4409_4412dupGTCTPathogenic** 
623DMDEx32NM_004006.2:c.4414C>Tp.Gln1472* | p.Q1472XLRG_199t1:c.4414C>T, NM_000109.2:c.4390C>T, NM_000109.3:c.4390C>T, NM_004006.1:c.4414C>T, NM_004006.2:c.4414C>T, NM_004007.1:c.4045C>T, NM_004007.2:c.4045C>T, NM_004009.2:c.4402C>T, NM_004009.3:c.4402C>T, NM_004010.2:c.4045C>T, NM_004010.3:c.4045C>T, NM_004011.2:c.391C>T, NM_004011.3:c.391C>T, NM_004012.2:c.382C>T, NM_004012.3:c.382C>TPathogenic07/23/2018 
624DMDEx32NM_004006.2:c.4421G>Cp.Ser1474Thr | p.S1474TLRG_199t1:c.4421G>C, NM_000109.2:c.4397G>C, NM_000109.3:c.4397G>C, NM_004006.1:c.4421G>C, NM_004006.2:c.4421G>C, NM_004007.1:c.4052G>C, NM_004007.2:c.4052G>C, NM_004009.2:c.4409G>C, NM_004009.3:c.4409G>C, NM_004010.2:c.4052G>C, NM_004010.3:c.4052G>C, NM_004011.2:c.398G>C, NM_004011.3:c.398G>C, NM_004012.2:c.389G>C, NM_004012.3:c.389G>CVOUS**
625DMDEx32NM_004006.2:c.4435G>Ap.Asp1479Asn | p.D1479NLRG_199t1:c.4435G>A, NM_000109.2:c.4411G>A, NM_000109.3:c.4411G>A, NM_004006.1:c.4435G>A, NM_004006.2:c.4435G>A, NM_004007.1:c.4066G>A, NM_004007.2:c.4066G>A, NM_004009.2:c.4423G>A, NM_004009.3:c.4423G>A, NM_004010.2:c.4066G>A, NM_004010.3:c.4066G>A, NM_004011.2:c.412G>A, NM_004011.3:c.412G>A, NM_004012.2:c.403G>A, NM_004012.3:c.403G>AVOUS09/20/2016
626DMDEx32NM_004006.2:c.4456C>Tp.Pro1486Ser | p.P1486SLRG_199t1:c.4456C>T, NM_000109.2:c.4432C>T, NM_000109.3:c.4432C>T, NM_004006.1:c.4456C>T, NM_004006.2:c.4456C>T, NM_004007.1:c.4087C>T, NM_004007.2:c.4087C>T, NM_004009.2:c.4444C>T, NM_004009.3:c.4444C>T, NM_004010.2:c.4087C>T, NM_004010.3:c.4087C>T, NM_004011.2:c.433C>T, NM_004011.3:c.433C>T, NM_004012.2:c.424C>T, NM_004012.3:c.424C>TLikely benign01/13/2020 
627DMDEx32NM_004006.2:c.4471_4472delAANM_000109.2:c.4447_4448delAA, NM_000109.3:c.4447_4448delAA, NM_004006.1:c.4471_4472delAA, NM_004006.2:c.4471_4472delAA, NM_004007.1:c.4102_4103delAA, NM_004007.2:c.4102_4103delAA, NM_004009.2:c.4459_4460delAA, NM_004009.3:c.4459_4460delAA, NM_004010.2:c.4102_4103delAA, NM_004010.3:c.4102_4103delAA, NM_004011.2:c.448_449delAA, NM_004011.3:c.448_449delAA, NM_004012.2:c.439_440delAA, NM_004012.3:c.439_440delAAPathogenic07/24/2013 
628DMDEx32NM_004006.2:c.4483C>Tp.Gln1495* | p.Q1495XLRG_199t1:c.4483C>T, NM_000109.2:c.4459C>T, NM_000109.3:c.4459C>T, NM_004006.1:c.4483C>T, NM_004006.2:c.4483C>T, NM_004007.1:c.4114C>T, NM_004007.2:c.4114C>T, NM_004009.2:c.4471C>T, NM_004009.3:c.4471C>T, NM_004010.2:c.4114C>T, NM_004010.3:c.4114C>T, NM_004011.2:c.460C>T, NM_004011.3:c.460C>T, NM_004012.2:c.451C>T, NM_004012.3:c.451C>TPathogenic07/20/2016 
629DMDEx32NM_004006.2:c.4486delGPathogenic** 
630DMDEx32NM_004006.2:c.4495C>Tp.Gln1499* | p.Q1499XLRG_199t1:c.4495C>T, NM_000109.2:c.4471C>T, NM_000109.3:c.4471C>T, NM_004006.1:c.4495C>T, NM_004006.2:c.4495C>T, NM_004007.1:c.4126C>T, NM_004007.2:c.4126C>T, NM_004009.2:c.4483C>T, NM_004009.3:c.4483C>T, NM_004010.2:c.4126C>T, NM_004010.3:c.4126C>T, NM_004011.2:c.472C>T, NM_004011.3:c.472C>T, NM_004012.2:c.463C>T, NM_004012.3:c.463C>TPathogenic01/10/2017 
631DMDEx32NM_004006.2:c.4500delAPathogenic** 
632DMDEx32NM_004006.2:c.4518G>Ap.Val1506= | p.V1506=LRG_199t1:c.4518G>A, NM_000109.2:c.4494G>A, NM_000109.3:c.4494G>A, NM_004006.1:c.4518G>A, NM_004006.2:c.4518G>A, NM_004007.1:c.4149G>A, NM_004007.2:c.4149G>A, NM_004009.2:c.4506G>A, NM_004009.3:c.4506G>A, NM_004010.2:c.4149G>A, NM_004010.3:c.4149G>A, NM_004011.2:c.495G>A, NM_004011.3:c.495G>A, NM_004012.2:c.486G>A, NM_004012.3:c.486G>AVOUS11/21/2017
633DMDEx32NM_004006.2:c.4518G>Cp.Val1506= | p.V1506=LRG_199t1:c.4518G>C, NM_000109.2:c.4494G>C, NM_000109.3:c.4494G>C, NM_004006.1:c.4518G>C, NM_004006.2:c.4518G>C, NM_004007.1:c.4149G>C, NM_004007.2:c.4149G>C, NM_004009.2:c.4506G>C, NM_004009.3:c.4506G>C, NM_004010.2:c.4149G>C, NM_004010.3:c.4149G>C, NM_004011.2:c.495G>C, NM_004011.3:c.495G>C, NM_004012.2:c.486G>C, NM_004012.3:c.486G>CVOUS06/06/2017
634DMDEx32NM_004006.2:c.4518+5G>ANM_000109.2:c.4494+5G>A, NM_000109.3:c.4494+5G>A, NM_004006.1:c.4518+5G>A, NM_004006.2:c.4518+5G>A, NM_004007.1:c.4149+5G>A, NM_004007.2:c.4149+5G>A, NM_004009.2:c.4506+5G>A, NM_004009.3:c.4506+5G>A, NM_004010.2:c.4149+5G>A, NM_004010.3:c.4149+5G>A, NM_004011.2:c.495+5G>A, NM_004011.3:c.495+5G>A, NM_004012.2:c.486+5G>A, NM_004012.3:c.486+5G>APathogenic07/17/2017 
635DMDEx32NM_004006.2:c.4518+5G>CNM_000109.2:c.4494+5G>C, NM_000109.3:c.4494+5G>C, NM_004006.1:c.4518+5G>C, NM_004006.2:c.4518+5G>C, NM_004007.1:c.4149+5G>C, NM_004007.2:c.4149+5G>C, NM_004009.2:c.4506+5G>C, NM_004009.3:c.4506+5G>C, NM_004010.2:c.4149+5G>C, NM_004010.3:c.4149+5G>C, NM_004011.2:c.495+5G>C, NM_004011.3:c.495+5G>C, NM_004012.2:c.486+5G>C, NM_004012.3:c.486+5G>CVOUS09/11/2013
636DMDEx33NM_004006.2:c.4523delTNM_000109.2:c.4499delT, NM_000109.3:c.4499delT, NM_004006.1:c.4523delT, NM_004006.2:c.4523delT, NM_004007.1:c.4154delT, NM_004007.2:c.4154delT, NM_004009.2:c.4511delT, NM_004009.3:c.4511delT, NM_004010.2:c.4154delT, NM_004010.3:c.4154delT, NM_004011.2:c.500delT, NM_004011.3:c.500delT, NM_004012.2:c.491delT, NM_004012.3:c.491delTPathogenic06/25/2014 
637DMDEx33NM_004006.2:c.4529A>Gp.Lys1510Arg | p.K1510RNM_000109.2:c.4505A>G, NM_000109.3:c.4505A>G, NM_004006.1:c.4529A>G, NM_004006.2:c.4529A>G, NM_004007.1:c.4160A>G, NM_004007.2:c.4160A>G, NM_004009.2:c.4517A>G, NM_004009.3:c.4517A>G, NM_004010.2:c.4160A>G, NM_004010.3:c.4160A>G, NM_004011.2:c.506A>G, NM_004011.3:c.506A>G, NM_004012.2:c.497A>G, NM_004012.3:c.497A>GBenign01/08/2016 
638DMDEx33NM_004006.2:c.4534_4535delCTPathogenic01/21/2013 
639DMDEx33NM_004006.2:c.4545_4549delGAAGTp.Lys1516* | p.K1516XLRG_199t1:c.4545_4549delGAAGT, NM_000109.2:c.4521_4525delGAAGT, NM_000109.3:c.4521_4525delGAAGT, NM_004006.1:c.4545_4549delGAAGT, NM_004006.2:c.4545_4549delGAAGT, NM_004007.1:c.4176_4180delGAAGT, NM_004007.2:c.4176_4180delGAAGT, NM_004009.2:c.4533_4537delGAAGT, NM_004009.3:c.4533_4537delGAAGT, NM_004010.2:c.4176_4180delGAAGT, NM_004010.3:c.4176_4180delGAAGT, NM_004011.2:c.522_526delGAAGT, NM_004011.3:c.522_526delGAAGT, NM_004012.2:c.513_517delGAAGT, NM_004012.3:c.513_517delGAAGTPathogenic05/28/2015 
640DMDEx33NM_004006.2:c.4550_4556delCTGAAGTNM_000109.2:c.4526_4532delCTGAAGT, NM_000109.3:c.4526_4532delCTGAAGT, NM_004006.1:c.4550_4556delCTGAAGT, NM_004006.2:c.4550_4556delCTGAAGT, NM_004007.1:c.4181_4187delCTGAAGT, NM_004007.2:c.4181_4187delCTGAAGT, NM_004009.2:c.4538_4544delCTGAAGT, NM_004009.3:c.4538_4544delCTGAAGT, NM_004010.2:c.4181_4187delCTGAAGT, NM_004010.3:c.4181_4187delCTGAAGT, NM_004011.2:c.527_533delCTGAAGT, NM_004011.3:c.527_533delCTGAAGT, NM_004012.2:c.518_524delCTGAAGT, NM_004012.3:c.518_524delCTGAAGTPathogenic02/17/2016 
641DMDEx33NM_004006.2:c.4561A>Gp.Met1521Val | p.M1521VLRG_199t1:c.4561A>G, NM_000109.2:c.4537A>G, NM_000109.3:c.4537A>G, NM_004006.1:c.4561A>G, NM_004006.2:c.4561A>G, NM_004007.1:c.4192A>G, NM_004007.2:c.4192A>G, NM_004009.2:c.4549A>G, NM_004009.3:c.4549A>G, NM_004010.2:c.4192A>G, NM_004010.3:c.4192A>G, NM_004011.2:c.538A>G, NM_004011.3:c.538A>G, NM_004012.2:c.529A>G, NM_004012.3:c.529A>GVOUS12/05/2016
642DMDEx33NM_004006.2:c.4564G>Tp.Val1522Leu | p.V1522LLRG_199t1:c.4564G>T, NM_000109.2:c.4540G>T, NM_000109.3:c.4540G>T, NM_004006.1:c.4564G>T, NM_004006.2:c.4564G>T, NM_004007.1:c.4195G>T, NM_004007.2:c.4195G>T, NM_004009.2:c.4552G>T, NM_004009.3:c.4552G>T, NM_004010.2:c.4195G>T, NM_004010.3:c.4195G>T, NM_004011.2:c.541G>T, NM_004011.3:c.541G>T, NM_004012.2:c.532G>T, NM_004012.3:c.532G>TVOUS08/26/2016
643DMDEx33NM_004006.2:c.4591C>Tp.Gln1531* | p.Q1531XLRG_199t1:c.4591C>T, NM_000109.2:c.4567C>T, NM_000109.3:c.4567C>T, NM_004006.1:c.4591C>T, NM_004006.2:c.4591C>T, NM_004007.1:c.4222C>T, NM_004007.2:c.4222C>T, NM_004009.2:c.4579C>T, NM_004009.3:c.4579C>T, NM_004010.2:c.4222C>T, NM_004010.3:c.4222C>T, NM_004011.2:c.568C>T, NM_004011.3:c.568C>T, NM_004012.2:c.559C>T, NM_004012.3:c.559C>TPathogenic01/05/2017 
644DMDEx33NM_004006.2:c.4605G>Ap.Thr1535= | p.T1535=LRG_199t1:c.4605G>A, NM_000109.2:c.4581G>A, NM_000109.3:c.4581G>A, NM_004006.1:c.4605G>A, NM_004006.2:c.4605G>A, NM_004007.1:c.4236G>A, NM_004007.2:c.4236G>A, NM_004009.2:c.4593G>A, NM_004009.3:c.4593G>A, NM_004010.2:c.4236G>A, NM_004010.3:c.4236G>A, NM_004011.2:c.582G>A, NM_004011.3:c.582G>A, NM_004012.2:c.573G>A, NM_004012.3:c.573G>AVOUS07/14/2017
645DMDEx33NM_004006.2:c.4606G>Tp.Glu1536* | p.E1536XLRG_199t1:c.4606G>T, NM_000109.2:c.4582G>T, NM_000109.3:c.4582G>T, NM_004006.1:c.4606G>T, NM_004006.2:c.4606G>T, NM_004007.1:c.4237G>T, NM_004007.2:c.4237G>T, NM_004009.2:c.4594G>T, NM_004009.3:c.4594G>T, NM_004010.2:c.4237G>T, NM_004010.3:c.4237G>T, NM_004011.2:c.583G>T, NM_004011.3:c.583G>T, NM_004012.2:c.574G>T, NM_004012.3:c.574G>TPathogenic12/21/2016 
646DMDEx33NM_004006.2:c.4618G>Tp.Glu1540* | p.E1540XLRG_199t1:c.4618G>T, NM_000109.2:c.4594G>T, NM_000109.3:c.4594G>T, NM_004006.1:c.4618G>T, NM_004006.2:c.4618G>T, NM_004007.1:c.4249G>T, NM_004007.2:c.4249G>T, NM_004009.2:c.4606G>T, NM_004009.3:c.4606G>T, NM_004010.2:c.4249G>T, NM_004010.3:c.4249G>T, NM_004011.2:c.595G>T, NM_004011.3:c.595G>T, NM_004012.2:c.586G>T, NM_004012.3:c.586G>TPathogenic10/03/2016 
647DMDEx33NM_004006.2:c.4634dupTPathogenic** 
648DMDEx34NM_004006.2:c.4675-2A>GNM_000109.2:c.4651-2A>G, NM_000109.3:c.4651-2A>G, NM_004006.1:c.4675-2A>G, NM_004006.2:c.4675-2A>G, NM_004007.1:c.4306-2A>G, NM_004007.2:c.4306-2A>G, NM_004009.2:c.4663-2A>G, NM_004009.3:c.4663-2A>G, NM_004010.2:c.4306-2A>G, NM_004010.3:c.4306-2A>G, NM_004011.2:c.652-2A>G, NM_004011.3:c.652-2A>G, NM_004012.2:c.643-2A>G, NM_004012.3:c.643-2A>GPathogenic08/08/2014 
649DMDEx34NM_004006.2:c.4698G>Ap.Leu1566= | p.L1566=LRG_199t1:c.4698G>A, NM_000109.2:c.4674G>A, NM_000109.3:c.4674G>A, NM_004006.1:c.4698G>A, NM_004006.2:c.4698G>A, NM_004007.1:c.4329G>A, NM_004007.2:c.4329G>A, NM_004009.2:c.4686G>A, NM_004009.3:c.4686G>A, NM_004010.2:c.4329G>A, NM_004010.3:c.4329G>A, NM_004011.2:c.675G>A, NM_004011.3:c.675G>A, NM_004012.2:c.666G>A, NM_004012.3:c.666G>AVOUS09/27/2016
650DMDEx34NM_004006.2:c.4721G>Ap.Arg1574His | p.R1574HLRG_199t1:c.4721G>A, NM_000109.2:c.4697G>A, NM_000109.3:c.4697G>A, NM_004006.1:c.4721G>A, NM_004006.2:c.4721G>A, NM_004007.1:c.4352G>A, NM_004007.2:c.4352G>A, NM_004009.2:c.4709G>A, NM_004009.3:c.4709G>A, NM_004010.2:c.4352G>A, NM_004010.3:c.4352G>A, NM_004011.2:c.698G>A, NM_004011.3:c.698G>A, NM_004012.2:c.689G>A, NM_004012.3:c.689G>AVOUS04/18/2017
651DMDEx34NM_004006.2:c.4729C>Tp.Arg1577* | p.R1577XLRG_199t1:c.4729C>T, NM_000109.2:c.4705C>T, NM_000109.3:c.4705C>T, NM_004006.1:c.4729C>T, NM_004006.2:c.4729C>T, NM_004007.1:c.4360C>T, NM_004007.2:c.4360C>T, NM_004009.2:c.4717C>T, NM_004009.3:c.4717C>T, NM_004010.2:c.4360C>T, NM_004010.3:c.4360C>T, NM_004011.2:c.706C>T, NM_004011.3:c.706C>T, NM_004012.2:c.697C>T, NM_004012.3:c.697C>TPathogenic01/05/2017 
652DMDEx34NM_004006.2:c.4735G>Tp.Glu1579* | p.E1579XPathogenic** 
653DMDEx34NM_004006.2:c.4741A>Gp.Asn1581Asp | p.N1581DNM_000109.2:c.4717A>G, NM_000109.3:c.4717A>G, NM_004006.1:c.4741A>G, NM_004006.2:c.4741A>G, NM_004007.1:c.4372A>G, NM_004007.2:c.4372A>G, NM_004009.2:c.4729A>G, NM_004009.3:c.4729A>G, NM_004010.2:c.4372A>G, NM_004010.3:c.4372A>G, NM_004011.2:c.718A>G, NM_004011.3:c.718A>G, NM_004012.2:c.709A>G, NM_004012.3:c.709A>GVOUS02/12/2015
654DMDEx34NM_004006.2:c.4744G>Ap.Val1582Ile | p.V1582IVOUS**
655DMDEx34NM_004006.2:c.4773T>Cp.Asp1591= | p.D1591=LRG_199t1:c.4773T>C, NM_000109.2:c.4749T>C, NM_000109.3:c.4749T>C, NM_004006.1:c.4773T>C, NM_004006.2:c.4773T>C, NM_004007.1:c.4404T>C, NM_004007.2:c.4404T>C, NM_004009.2:c.4761T>C, NM_004009.3:c.4761T>C, NM_004010.2:c.4404T>C, NM_004010.3:c.4404T>C, NM_004011.2:c.750T>C, NM_004011.3:c.750T>C, NM_004012.2:c.741T>C, NM_004012.3:c.741T>CVOUS08/10/2016
656DMDEx34NM_004006.2:c.4775T>Cp.Met1592Thr | p.M1592TNM_000109.2:c.4751T>C, NM_000109.3:c.4751T>C, NM_004006.1:c.4775T>C, NM_004006.2:c.4775T>C, NM_004007.1:c.4406T>C, NM_004007.2:c.4406T>C, NM_004009.2:c.4763T>C, NM_004009.3:c.4763T>C, NM_004010.2:c.4406T>C, NM_004010.3:c.4406T>C, NM_004011.2:c.752T>C, NM_004011.3:c.752T>C, NM_004012.2:c.743T>C, NM_004012.3:c.743T>CVOUS10/18/2013
657DMDEx34NM_004006.2:c.4786_4787delAAp.Lys1596Glufs*5 | p.K1596EfsX5LRG_199t1:c.4786_4787delAA, NM_000109.2:c.4762_4763delAA, NM_000109.3:c.4762_4763delAA, NM_004006.1:c.4786_4787delAA, NM_004006.2:c.4786_4787delAA, NM_004007.1:c.4417_4418delAA, NM_004007.2:c.4417_4418delAA, NM_004009.2:c.4774_4775delAA, NM_004009.3:c.4774_4775delAA, NM_004010.2:c.4417_4418delAA, NM_004010.3:c.4417_4418delAA, NM_004011.2:c.763_764delAA, NM_004011.3:c.763_764delAA, NM_004012.2:c.754_755delAA, NM_004012.3:c.754_755delAAPathogenic01/04/2018 
658DMDEx34NM_004006.2:c.4806A>Tp.Gly1602= | p.G1602=LRG_199t1:c.4806A>T, NM_000109.2:c.4782A>T, NM_000109.3:c.4782A>T, NM_004006.1:c.4806A>T, NM_004006.2:c.4806A>T, NM_004007.1:c.4437A>T, NM_004007.2:c.4437A>T, NM_004009.2:c.4794A>T, NM_004009.3:c.4794A>T, NM_004010.2:c.4437A>T, NM_004010.3:c.4437A>T, NM_004011.2:c.783A>T, NM_004011.3:c.783A>T, NM_004012.2:c.774A>T, NM_004012.3:c.774A>TPathogenic08/11/2014 
659DMDEx34NM_004006.2:c.4811C>Gp.Pro1604Arg | p.P1604RNM_000109.2:c.4787C>G, NM_000109.3:c.4787C>G, NM_004006.1:c.4811C>G, NM_004006.2:c.4811C>G, NM_004007.1:c.4442C>G, NM_004007.2:c.4442C>G, NM_004009.2:c.4799C>G, NM_004009.3:c.4799C>G, NM_004010.2:c.4442C>G, NM_004010.3:c.4442C>G, NM_004011.2:c.788C>G, NM_004011.3:c.788C>G, NM_004012.2:c.779C>G, NM_004012.3:c.779C>GVOUS01/13/2015
660DMDEx34NM_004006.2:c.4842A>Tp.Gly1614= | p.G1614=VOUS**
661DMDEx34NM_004006.2:c.4843A>Tp.Lys1615* | p.K1615XNM_000109.2:c.4819A>T, NM_000109.3:c.4819A>T, NM_004006.1:c.4843A>T, NM_004006.2:c.4843A>T, NM_004007.1:c.4474A>T, NM_004007.2:c.4474A>T, NM_004009.2:c.4831A>T, NM_004009.3:c.4831A>T, NM_004010.2:c.4474A>T, NM_004010.3:c.4474A>T, NM_004011.2:c.820A>T, NM_004011.3:c.820A>T, NM_004012.2:c.811A>T, NM_004012.3:c.811A>TPathogenic11/17/2015 
662DMDEx34NM_004006.2:c.4845G>Ap.Lys1615= | p.K1615=LRG_199t1:c.4845G>A, NM_000109.2:c.4821G>A, NM_000109.3:c.4821G>A, NM_004006.1:c.4845G>A, NM_004006.2:c.4845G>A, NM_004007.1:c.4476G>A, NM_004007.2:c.4476G>A, NM_004009.2:c.4833G>A, NM_004009.3:c.4833G>A, NM_004010.2:c.4476G>A, NM_004010.3:c.4476G>A, NM_004011.2:c.822G>A, NM_004011.3:c.822G>A, NM_004012.2:c.813G>A, NM_004012.3:c.813G>AVOUS02/21/2017
663DMDEx34NM_004006.2:c.4845+1G>TLRG_199t1:c.4845+1G>T, NM_000109.2:c.4821+1G>T, NM_000109.3:c.4821+1G>T, NM_004006.1:c.4845+1G>T, NM_004006.2:c.4845+1G>T, NM_004007.1:c.4476+1G>T, NM_004007.2:c.4476+1G>T, NM_004009.2:c.4833+1G>T, NM_004009.3:c.4833+1G>T, NM_004010.2:c.4476+1G>T, NM_004010.3:c.4476+1G>T, NM_004011.2:c.822+1G>T, NM_004011.3:c.822+1G>T, NM_004012.2:c.813+1G>T, NM_004012.3:c.813+1G>TPathogenic09/14/2016 
664DMDEx34NM_004006.2:c.4845+8C>TLRG_199t1:c.4845+8C>T, NM_000109.2:c.4821+8C>T, NM_000109.3:c.4821+8C>T, NM_004006.1:c.4845+8C>T, NM_004006.2:c.4845+8C>T, NM_004007.1:c.4476+8C>T, NM_004007.2:c.4476+8C>T, NM_004009.2:c.4833+8C>T, NM_004009.3:c.4833+8C>T, NM_004010.2:c.4476+8C>T, NM_004010.3:c.4476+8C>T, NM_004011.2:c.822+8C>T, NM_004011.3:c.822+8C>T, NM_004012.2:c.813+8C>T, NM_004012.3:c.813+8C>TVOUS03/17/2016
665DMDEx35NM_004006.2:c.4847C>Gp.Ala1616Gly | p.A1616GLRG_199t1:c.4847C>G, NM_000109.2:c.4823C>G, NM_000109.3:c.4823C>G, NM_004006.1:c.4847C>G, NM_004006.2:c.4847C>G, NM_004007.1:c.4478C>G, NM_004007.2:c.4478C>G, NM_004009.2:c.4835C>G, NM_004009.3:c.4835C>G, NM_004010.2:c.4478C>G, NM_004010.3:c.4478C>G, NM_004011.2:c.824C>G, NM_004011.3:c.824C>G, NM_004012.2:c.815C>G, NM_004012.3:c.815C>GVOUS11/30/2018
666DMDEx35NM_004006.2:c.4851T>Gp.Thr1617= | p.T1617=LRG_199t1:c.4851T>G, NM_000109.2:c.4827T>G, NM_000109.3:c.4827T>G, NM_004006.1:c.4851T>G, NM_004006.2:c.4851T>G, NM_004007.1:c.4482T>G, NM_004007.2:c.4482T>G, NM_004009.2:c.4839T>G, NM_004009.3:c.4839T>G, NM_004010.2:c.4482T>G, NM_004010.3:c.4482T>G, NM_004011.2:c.828T>G, NM_004011.3:c.828T>G, NM_004012.2:c.819T>G, NM_004012.3:c.819T>GVOUS06/16/2016
667DMDEx35NM_004006.2:c.4862T>Cp.Ile1621Thr | p.I1621TLRG_199t1:c.4862T>C, NM_000109.2:c.4838T>C, NM_000109.3:c.4838T>C, NM_004006.1:c.4862T>C, NM_004006.2:c.4862T>C, NM_004007.1:c.4493T>C, NM_004007.2:c.4493T>C, NM_004009.2:c.4850T>C, NM_004009.3:c.4850T>C, NM_004010.2:c.4493T>C, NM_004010.3:c.4493T>C, NM_004011.2:c.839T>C, NM_004011.3:c.839T>C, NM_004012.2:c.830T>C, NM_004012.3:c.830T>CVOUS07/14/2017
668DMDEx35NM_004006.2:c.4870C>Tp.Gln1624* | p.Q1624XLRG_199t1:c.4870C>T, NM_000109.2:c.4846C>T, NM_000109.3:c.4846C>T, NM_004006.1:c.4870C>T, NM_004006.2:c.4870C>T, NM_004007.1:c.4501C>T, NM_004007.2:c.4501C>T, NM_004009.2:c.4858C>T, NM_004009.3:c.4858C>T, NM_004010.2:c.4501C>T, NM_004010.3:c.4501C>T, NM_004011.2:c.847C>T, NM_004011.3:c.847C>T, NM_004012.2:c.838C>T, NM_004012.3:c.838C>TPathogenic05/18/2016 
669DMDEx35NM_004006.2:c.4876G>Ap.Val1626Met | p.V1626MLRG_199t1:c.4876G>A, NM_000109.2:c.4852G>A, NM_000109.3:c.4852G>A, NM_004006.1:c.4876G>A, NM_004006.2:c.4876G>A, NM_004007.1:c.4507G>A, NM_004007.2:c.4507G>A, NM_004009.2:c.4864G>A, NM_004009.3:c.4864G>A, NM_004010.2:c.4507G>A, NM_004010.3:c.4507G>A, NM_004011.2:c.853G>A, NM_004011.3:c.853G>A, NM_004012.2:c.844G>A, NM_004012.3:c.844G>ALikely benign01/30/2017 
670DMDEx35NM_004006.2:c.4878G>Tp.Val1626= | p.V1626=NM_000109.2:c.4854G>T, NM_000109.3:c.4854G>T, NM_004006.1:c.4878G>T, NM_004006.2:c.4878G>T, NM_004007.1:c.4509G>T, NM_004007.2:c.4509G>T, NM_004009.2:c.4866G>T, NM_004009.3:c.4866G>T, NM_004010.2:c.4509G>T, NM_004010.3:c.4509G>T, NM_004011.2:c.855G>T, NM_004011.3:c.855G>T, NM_004012.2:c.846G>T, NM_004012.3:c.846G>TBenign01/25/2016 
671DMDEx35NM_004006.2:c.4881C>Ap.His1627Gln | p.H1627QNM_000109.2:c.4857C>A, NM_000109.3:c.4857C>A, NM_004006.1:c.4881C>A, NM_004006.2:c.4881C>A, NM_004007.1:c.4512C>A, NM_004007.2:c.4512C>A, NM_004009.2:c.4869C>A, NM_004009.3:c.4869C>A, NM_004010.2:c.4512C>A, NM_004010.3:c.4512C>A, NM_004011.2:c.858C>A, NM_004011.3:c.858C>A, NM_004012.2:c.849C>A, NM_004012.3:c.849C>AVOUS01/23/2016
672DMDEx35NM_004006.2:c.4899G>Tp.Glu1633Asp | p.E1633DLRG_199t1:c.4899G>T, NM_000109.2:c.4875G>T, NM_000109.3:c.4875G>T, NM_004006.1:c.4899G>T, NM_004006.2:c.4899G>T, NM_004007.1:c.4530G>T, NM_004007.2:c.4530G>T, NM_004009.2:c.4887G>T, NM_004009.3:c.4887G>T, NM_004010.2:c.4530G>T, NM_004010.3:c.4530G>T, NM_004011.2:c.876G>T, NM_004011.3:c.876G>T, NM_004012.2:c.867G>T, NM_004012.3:c.867G>TVOUS09/06/2016
673DMDEx35NM_004006.2:c.4902_4908delAGGAGAGPathogenic** 
674DMDEx35NM_004006.2:c.4910C>Tp.Ala1637Val | p.A1637VLRG_199t1:c.4910C>T, NM_000109.2:c.4886C>T, NM_000109.3:c.4886C>T, NM_004006.1:c.4910C>T, NM_004006.2:c.4910C>T, NM_004007.1:c.4541C>T, NM_004007.2:c.4541C>T, NM_004009.2:c.4898C>T, NM_004009.3:c.4898C>T, NM_004010.2:c.4541C>T, NM_004010.3:c.4541C>T, NM_004011.2:c.887C>T, NM_004011.3:c.887C>T, NM_004012.2:c.878C>T, NM_004012.3:c.878C>TVOUS02/08/2019
675DMDEx35NM_004006.2:c.4926_4971dupGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAATLRG_199t1:c.4971_4972insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_000109.2:c.4901_4902insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_000109.2:c.4947_4948insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_000109.3:c.4901_4902insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_000109.3:c.4947_4948insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004006.1:c.4925_4926insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004006.1:c.4971_4972insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004006.2:c.4925_4926insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004006.2:c.4971_4972insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004007.1:c.4556_4557insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004007.1:c.4602_4603insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004007.2:c.4556_4557insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004007.2:c.4602_4603insGGGCAAGAAGGAGACGTTGGTGGAAGATAAACTCAGTCTTCTGAAT, NM_004009.2:c.4913_4914insGGGCAAGAAGGAPathogenic** 
676DMDEx35NM_004006.2:c.4941G>Ap.Thr1647= | p.T1647=NM_000109.2:c.4917G>A, NM_000109.3:c.4917G>A, NM_004006.1:c.4941G>A, NM_004006.2:c.4941G>A, NM_004007.1:c.4572G>A, NM_004007.2:c.4572G>A, NM_004009.2:c.4929G>A, NM_004009.3:c.4929G>A, NM_004010.2:c.4572G>A, NM_004010.3:c.4572G>A, NM_004011.2:c.918G>A, NM_004011.3:c.918G>A, NM_004012.2:c.909G>A, NM_004012.3:c.909G>AVOUS10/06/2015
677DMDEx35NM_004006.2:c.4995C>Tp.Ser1665= | p.S1665=LRG_199t1:c.4995C>T, NM_000109.2:c.4971C>T, NM_000109.3:c.4971C>T, NM_004006.1:c.4995C>T, NM_004006.2:c.4995C>T, NM_004007.1:c.4626C>T, NM_004007.2:c.4626C>T, NM_004009.2:c.4983C>T, NM_004009.3:c.4983C>T, NM_004010.2:c.4626C>T, NM_004010.3:c.4626C>T, NM_004011.2:c.972C>T, NM_004011.3:c.972C>T, NM_004012.2:c.963C>T, NM_004012.3:c.963C>TVOUS05/25/2017
678DMDEx35NM_004006.2:c.4996_5004delinsTPathogenic** 
679DMDEx35NM_004006.2:c.4996C>Tp.Arg1666* | p.R1666XLRG_199t1:c.4996C>T, NM_000109.2:c.4972C>T, NM_000109.3:c.4972C>T, NM_004006.1:c.4996C>T, NM_004006.2:c.4996C>T, NM_004007.1:c.4627C>T, NM_004007.2:c.4627C>T, NM_004009.2:c.4984C>T, NM_004009.3:c.4984C>T, NM_004010.2:c.4627C>T, NM_004010.3:c.4627C>T, NM_004011.2:c.973C>T, NM_004011.3:c.973C>T, NM_004012.2:c.964C>T, NM_004012.3:c.964C>TPathogenic02/01/2017 
680DMDEx35NM_004006.2:c.5010G>Tp.Trp1670Cys | p.W1670CNM_000109.2:c.4986G>T, NM_000109.3:c.4986G>T, NM_004006.1:c.5010G>T, NM_004006.2:c.5010G>T, NM_004007.1:c.4641G>T, NM_004007.2:c.4641G>T, NM_004009.2:c.4998G>T, NM_004009.3:c.4998G>T, NM_004010.2:c.4641G>T, NM_004010.3:c.4641G>T, NM_004011.2:c.987G>T, NM_004011.3:c.987G>T, NM_004012.2:c.978G>T, NM_004012.3:c.978G>TVOUS12/29/2017
681DMDEx35NM_004006.2:c.5016T>Ap.Asn1672Lys | p.N1672KNM_000109.2:c.4992T>A, NM_000109.3:c.4992T>A, NM_004006.1:c.5016T>A, NM_004006.2:c.5016T>A, NM_004007.1:c.4647T>A, NM_004007.2:c.4647T>A, NM_004009.2:c.5004T>A, NM_004009.3:c.5004T>A, NM_004010.2:c.4647T>A, NM_004010.3:c.4647T>A, NM_004011.2:c.993T>A, NM_004011.3:c.993T>A, NM_004012.2:c.984T>A, NM_004012.3:c.984T>ABenign01/25/2016 
682DMDEx35NM_004006.2:c.5022G>Cp.Leu1674Phe | p.L1674FVOUS**
683DMDEx36NM_004006.2:c.5026-7A>GLRG_199t1:c.5026-7A>G, NM_000109.2:c.5002-7A>G, NM_000109.3:c.5002-7A>G, NM_004006.1:c.5026-7A>G, NM_004006.2:c.5026-7A>G, NM_004007.1:c.4657-7A>G, NM_004007.2:c.4657-7A>G, NM_004009.2:c.5014-7A>G, NM_004009.3:c.5014-7A>G, NM_004010.2:c.4657-7A>G, NM_004010.3:c.4657-7A>G, NM_004011.2:c.1003-7A>G, NM_004011.3:c.1003-7A>G, NM_004012.2:c.994-7A>G, NM_004012.3:c.994-7A>GVOUS**
684DMDEx36NM_004006.2:c.5032C>Tp.Gln1678* | p.Q1678XNM_000109.2:c.5008C>T, NM_000109.3:c.5008C>T, NM_004006.1:c.5032C>T, NM_004006.2:c.5032C>T, NM_004007.1:c.4663C>T, NM_004007.2:c.4663C>T, NM_004009.2:c.5020C>T, NM_004009.3:c.5020C>T, NM_004010.2:c.4663C>T, NM_004010.3:c.4663C>T, NM_004011.2:c.1009C>T, NM_004011.3:c.1009C>T, NM_004012.2:c.1000C>T, NM_004012.3:c.1000C>TPathogenic06/17/2015 
685DMDEx36NM_004006.2:c.5040C>Tp.His1680= | p.H1680=LRG_199t1:c.5040C>T, NM_000109.2:c.5016C>T, NM_000109.3:c.5016C>T, NM_004006.1:c.5040C>T, NM_004006.2:c.5040C>T, NM_004007.1:c.4671C>T, NM_004007.2:c.4671C>T, NM_004009.2:c.5028C>T, NM_004009.3:c.5028C>T, NM_004010.2:c.4671C>T, NM_004010.3:c.4671C>T, NM_004011.2:c.1017C>T, NM_004011.3:c.1017C>T, NM_004012.2:c.1008C>T, NM_004012.3:c.1008C>TVOUS09/27/2017
686DMDEx36NM_004006.2:c.5052delTPathogenic** 
687DMDEx36NM_004006.2:c.5064G>Tp.Val1688= | p.V1688=LRG_199t1:c.5064G>T, NM_000109.2:c.5040G>T, NM_000109.3:c.5040G>T, NM_004006.1:c.5064G>T, NM_004006.2:c.5064G>T, NM_004007.1:c.4695G>T, NM_004007.2:c.4695G>T, NM_004009.2:c.5052G>T, NM_004009.3:c.5052G>T, NM_004010.2:c.4695G>T, NM_004010.3:c.4695G>T, NM_004011.2:c.1041G>T, NM_004011.3:c.1041G>T, NM_004012.2:c.1032G>T, NM_004012.3:c.1032G>TVOUS08/23/2016
688DMDEx36NM_004006.2:c.5076A>Gp.Thr1692= | p.T1692=NM_000109.2:c.5052A>G, NM_000109.3:c.5052A>G, NM_004006.1:c.5076A>G, NM_004006.2:c.5076A>G, NM_004007.1:c.4707A>G, NM_004007.2:c.4707A>G, NM_004009.2:c.5064A>G, NM_004009.3:c.5064A>G, NM_004010.2:c.4707A>G, NM_004010.3:c.4707A>G, NM_004011.2:c.1053A>G, NM_004011.3:c.1053A>G, NM_004012.2:c.1044A>G, NM_004012.3:c.1044A>GVOUS09/09/2015
689DMDEx36NM_004006.2:c.5089C>Tp.Gln1697* | p.Q1697XNM_000109.2:c.5065C>T, NM_000109.3:c.5065C>T, NM_004006.1:c.5089C>T, NM_004006.2:c.5089C>T, NM_004007.1:c.4720C>T, NM_004007.2:c.4720C>T, NM_004009.2:c.5077C>T, NM_004009.3:c.5077C>T, NM_004010.2:c.4720C>T, NM_004010.3:c.4720C>T, NM_004011.2:c.1066C>T, NM_004011.3:c.1066C>T, NM_004012.2:c.1057C>T, NM_004012.3:c.1057C>TPathogenic08/20/2015 
690DMDEx36NM_004006.2:c.5097_5098delCAinsATGAATGAATTCATTNM_000109.2:c.5073_5074delinsATGAATGAATTCATT, NM_000109.3:c.5073_5074delinsATGAATGAATTCATT, NM_004006.1:c.5097_5098delinsATGAATGAATTCATT, NM_004006.2:c.5097_5098delinsATGAATGAATTCATT, NM_004007.1:c.4728_4729delinsATGAATGAATTCATT, NM_004007.2:c.4728_4729delinsATGAATGAATTCATT, NM_004009.2:c.5085_5086delinsATGAATGAATTCATT, NM_004009.3:c.5085_5086delinsATGAATGAATTCATT, NM_004010.2:c.4728_4729delinsATGAATGAATTCATT, NM_004010.3:c.4728_4729delinsATGAATGAATTCATT, NM_004011.2:c.1074_1075delinsATGAATGAATTCATT, NM_004011.3:c.1074_1075delinsATGAATGAATTCATT, NM_004012.2:c.1065_1066delinsATGAATGAATTCATT, NM_004012.3:c.1065_1066delinsATGAATGAATTCATTPathogenic07/11/2013 
691DMDEx36NM_004006.2:c.5124_5127delGAAAPathogenic03/28/2013 
692DMDEx36NM_004006.2:c.5134C>Tp.Gln1712* | p.Q1712XNM_000109.2:c.5110C>T, NM_000109.3:c.5110C>T, NM_004006.1:c.5134C>T, NM_004006.2:c.5134C>T, NM_004007.1:c.4765C>T, NM_004007.2:c.4765C>T, NM_004009.2:c.5122C>T, NM_004009.3:c.5122C>T, NM_004010.2:c.4765C>T, NM_004010.3:c.4765C>T, NM_004011.2:c.1111C>T, NM_004011.3:c.1111C>T, NM_004012.2:c.1102C>T, NM_004012.3:c.1102C>TPathogenic** 
693DMDEx36NM_004006.2:c.5139delALRG_199t1:c.5139delA, NM_000109.2:c.5115delA, NM_000109.3:c.5115delA, NM_004006.1:c.5139delA, NM_004006.2:c.5139delA, NM_004007.1:c.4770delA, NM_004007.2:c.4770delA, NM_004009.2:c.5127delA, NM_004009.3:c.5127delA, NM_004010.2:c.4770delA, NM_004010.3:c.4770delA, NM_004011.2:c.1116delA, NM_004011.3:c.1116delA, NM_004012.2:c.1107delA, NM_004012.3:c.1107delAPathogenic10/05/2016 
694DMDEx36NM_004006.2:c.5140G>Tp.Glu1714* | p.E1714XNM_000109.2:c.5116G>T, NM_000109.3:c.5116G>T, NM_004006.1:c.5140G>T, NM_004006.2:c.5140G>T, NM_004007.1:c.4771G>T, NM_004007.2:c.4771G>T, NM_004009.2:c.5128G>T, NM_004009.3:c.5128G>T, NM_004010.2:c.4771G>T, NM_004010.3:c.4771G>T, NM_004011.2:c.1117G>T, NM_004011.3:c.1117G>T, NM_004012.2:c.1108G>T, NM_004012.3:c.1108G>TPathogenic10/22/2015 
695DMDEx37NM_004006.2:c.5155-8G>TLRG_199t1:c.5155-8G>T, NM_000109.2:c.5131-8G>T, NM_000109.3:c.5131-8G>T, NM_004006.1:c.5155-8G>T, NM_004006.2:c.5155-8G>T, NM_004007.1:c.4786-8G>T, NM_004007.2:c.4786-8G>T, NM_004009.2:c.5143-8G>T, NM_004009.3:c.5143-8G>T, NM_004010.2:c.4786-8G>T, NM_004010.3:c.4786-8G>T, NM_004011.2:c.1132-8G>T, NM_004011.3:c.1132-8G>T, NM_004012.2:c.1123-8G>T, NM_004012.3:c.1123-8G>TVOUS04/04/2018
696DMDEx37NM_004006.2:c.5181A>Tp.Ile1727= | p.I1727=NM_000109.2:c.5157A>T, NM_000109.3:c.5157A>T, NM_004006.1:c.5181A>T, NM_004006.2:c.5181A>T, NM_004007.1:c.4812A>T, NM_004007.2:c.4812A>T, NM_004009.2:c.5169A>T, NM_004009.3:c.5169A>T, NM_004010.2:c.4812A>T, NM_004010.3:c.4812A>T, NM_004011.2:c.1158A>T, NM_004011.3:c.1158A>T, NM_004012.2:c.1149A>T, NM_004012.3:c.1149A>TVOUS07/11/2016
697DMDEx37NM_004006.2:c.5182C>Tp.Arg1728Cys | p.R1728CNM_000109.2:c.5158C>T, NM_000109.3:c.5158C>T, NM_004006.1:c.5182C>T, NM_004006.2:c.5182C>T, NM_004007.1:c.4813C>T, NM_004007.2:c.4813C>T, NM_004009.2:c.5170C>T, NM_004009.3:c.5170C>T, NM_004010.2:c.4813C>T, NM_004010.3:c.4813C>T, NM_004011.2:c.1159C>T, NM_004011.3:c.1159C>T, NM_004012.2:c.1150C>T, NM_004012.3:c.1150C>TLikely benign09/17/2015 
698DMDEx37NM_004006.2:c.5187A>Gp.Pro1729= | p.P1729=LRG_199t1:c.5187A>G, NM_000109.2:c.5163A>G, NM_000109.3:c.5163A>G, NM_004006.1:c.5187A>G, NM_004006.2:c.5187A>G, NM_004007.1:c.4818A>G, NM_004007.2:c.4818A>G, NM_004009.2:c.5175A>G, NM_004009.3:c.5175A>G, NM_004010.2:c.4818A>G, NM_004010.3:c.4818A>G, NM_004011.2:c.1164A>G, NM_004011.3:c.1164A>G, NM_004012.2:c.1155A>G, NM_004012.3:c.1155A>GVOUS11/30/2017
699DMDEx37NM_004006.2:c.5202A>Cp.Thr1734= | p.T1734=LRG_199t1:c.5202A>C, NM_000109.2:c.5178A>C, NM_000109.3:c.5178A>C, NM_004006.1:c.5202A>C, NM_004006.2:c.5202A>C, NM_004007.1:c.4833A>C, NM_004007.2:c.4833A>C, NM_004009.2:c.5190A>C, NM_004009.3:c.5190A>C, NM_004010.2:c.4833A>C, NM_004010.3:c.4833A>C, NM_004011.2:c.1179A>C, NM_004011.3:c.1179A>C, NM_004012.2:c.1170A>C, NM_004012.3:c.1170A>CVOUS12/28/2017
700DMDEx37NM_004006.2:c.5203C>Tp.Arg1735Cys | p.R1735CNM_000109.2:c.5179C>T, NM_000109.3:c.5179C>T, NM_004006.1:c.5203C>T, NM_004006.2:c.5203C>T, NM_004007.1:c.4834C>T, NM_004007.2:c.4834C>T, NM_004009.2:c.5191C>T, NM_004009.3:c.5191C>T, NM_004010.2:c.4834C>T, NM_004010.3:c.4834C>T, NM_004011.2:c.1180C>T, NM_004011.3:c.1180C>T, NM_004012.2:c.1171C>T, NM_004012.3:c.1171C>TLikely benign09/18/2015 
701DMDEx37NM_004006.2:c.5216C>Ap.Ala1739Glu | p.A1739ELRG_199t1:c.5216C>A, NM_000109.2:c.5192C>A, NM_000109.3:c.5192C>A, NM_004006.1:c.5216C>A, NM_004006.2:c.5216C>A, NM_004007.1:c.4847C>A, NM_004007.2:c.4847C>A, NM_004009.2:c.5204C>A, NM_004009.3:c.5204C>A, NM_004010.2:c.4847C>A, NM_004010.3:c.4847C>A, NM_004011.2:c.1193C>A, NM_004011.3:c.1193C>A, NM_004012.2:c.1184C>A, NM_004012.3:c.1184C>AVOUS12/22/2017
702DMDEx37NM_004006.2:c.5234G>Ap.Arg1745His | p.R1745HLRG_199t1:c.5234G>A, NM_000109.2:c.5210G>A, NM_000109.3:c.5210G>A, NM_004006.1:c.5234G>A, NM_004006.2:c.5234G>A, NM_004007.1:c.4865G>A, NM_004007.2:c.4865G>A, NM_004009.2:c.5222G>A, NM_004009.3:c.5222G>A, NM_004010.2:c.4865G>A, NM_004010.3:c.4865G>A, NM_004011.2:c.1211G>A, NM_004011.3:c.1211G>A, NM_004012.2:c.1202G>A, NM_004012.3:c.1202G>ABenign05/22/2019 
703DMDEx37NM_004006.2:c.5265C>Tp.Pro1755= | p.P1755=NM_000109.2:c.5241C>T, NM_000109.3:c.5241C>T, NM_004006.1:c.5265C>T, NM_004006.2:c.5265C>T, NM_004007.1:c.4896C>T, NM_004007.2:c.4896C>T, NM_004009.2:c.5253C>T, NM_004009.3:c.5253C>T, NM_004010.2:c.4896C>T, NM_004010.3:c.4896C>T, NM_004011.2:c.1242C>T, NM_004011.3:c.1242C>T, NM_004012.2:c.1233C>T, NM_004012.3:c.1233C>TLikely benign09/15/2015 
704DMDEx37NM_004006.2:c.5287C>Tp.Arg1763* | p.R1763XNM_000109.2:c.5263C>T, NM_000109.3:c.5263C>T, NM_004006.1:c.5287C>T, NM_004006.2:c.5287C>T, NM_004007.1:c.4918C>T, NM_004007.2:c.4918C>T, NM_004009.2:c.5275C>T, NM_004009.3:c.5275C>T, NM_004010.2:c.4918C>T, NM_004010.3:c.4918C>T, NM_004011.2:c.1264C>T, NM_004011.3:c.1264C>T, NM_004012.2:c.1255C>T, NM_004012.3:c.1255C>TPathogenic01/12/2017 
705DMDEx37NM_004006.2:c.5288G>Tp.Arg1763Leu | p.R1763LLRG_199t1:c.5288G>T, NM_000109.2:c.5264G>T, NM_000109.3:c.5264G>T, NM_004006.1:c.5288G>T, NM_004006.2:c.5288G>T, NM_004007.1:c.4919G>T, NM_004007.2:c.4919G>T, NM_004009.2:c.5276G>T, NM_004009.3:c.5276G>T, NM_004010.2:c.4919G>T, NM_004010.3:c.4919G>T, NM_004011.2:c.1265G>T, NM_004011.3:c.1265G>T, NM_004012.2:c.1256G>T, NM_004012.3:c.1256G>TVOUS10/15/2020
706DMDEx37NM_004006.2:c.5313dupTNM_000109.2:c.5288_5289insT, NM_000109.3:c.5288_5289insT, NM_004006.1:c.5312_5313insT, NM_004006.2:c.5312_5313insT, NM_004007.1:c.4943_4944insT, NM_004007.2:c.4943_4944insT, NM_004009.2:c.5300_5301insT, NM_004009.3:c.5300_5301insT, NM_004010.2:c.4943_4944insT, NM_004010.3:c.4943_4944insT, NM_004011.2:c.1289_1290insT, NM_004011.3:c.1289_1290insT, NM_004012.2:c.1280_1281insT, NM_004012.3:c.1280_1281insTPathogenic** 
707DMDEx38NM_004006.2:c.5326-22G>TBenign** 
708DMDEx38NM_004006.2:c.5326-3delTLRG_199t1:c.5326-3delT, NM_000109.2:c.5302-3delT, NM_000109.3:c.5302-3delT, NM_004006.1:c.5326-3delT, NM_004006.2:c.5326-3delT, NM_004007.1:c.4957-3delT, NM_004007.2:c.4957-3delT, NM_004009.2:c.5314-3delT, NM_004009.3:c.5314-3delT, NM_004010.2:c.4957-3delT, NM_004010.3:c.4957-3delT, NM_004011.2:c.1303-3delT, NM_004011.3:c.1303-3delT, NM_004012.2:c.1294-3delT, NM_004012.3:c.1294-3delTVOUS05/21/2018
709DMDEx38NM_004006.2:c.5326-3dupTNM_000109.2:c.5302-3_5302-2insT, NM_000109.3:c.5302-3_5302-2insT, NM_004006.1:c.5326-3_5326-2insT, NM_004006.2:c.5326-3_5326-2insT, NM_004007.1:c.4957-3_4957-2insT, NM_004007.2:c.4957-3_4957-2insT, NM_004009.2:c.5314-3_5314-2insT, NM_004009.3:c.5314-3_5314-2insT, NM_004010.2:c.4957-3_4957-2insT, NM_004010.3:c.4957-3_4957-2insT, NM_004011.2:c.1303-3_1303-2insT, NM_004011.3:c.1303-3_1303-2insT, NM_004012.2:c.1294-3_1294-2insT, NM_004012.3:c.1294-3_1294-2insTVOUS11/17/2016
710DMDEx38NM_004006.2:c.5334delTp.Pro1779Leufs*2 | p.P1779LfsX2LRG_199t1:c.5334delT, NM_000109.2:c.5310delT, NM_000109.3:c.5310delT, NM_004006.1:c.5334delT, NM_004006.2:c.5334delT, NM_004007.1:c.4965delT, NM_004007.2:c.4965delT, NM_004009.2:c.5322delT, NM_004009.3:c.5322delT, NM_004010.2:c.4965delT, NM_004010.3:c.4965delT, NM_004011.2:c.1311delT, NM_004011.3:c.1311delT, NM_004012.2:c.1302delT, NM_004012.3:c.1302delTPathogenic03/21/2017 
711DMDEx38NM_004006.2:c.5344G>Tp.Glu1782* | p.E1782XLRG_199t1:c.5344G>T, NM_000109.2:c.5320G>T, NM_000109.3:c.5320G>T, NM_004006.1:c.5344G>T, NM_004006.2:c.5344G>T, NM_004007.1:c.4975G>T, NM_004007.2:c.4975G>T, NM_004009.2:c.5332G>T, NM_004009.3:c.5332G>T, NM_004010.2:c.4975G>T, NM_004010.3:c.4975G>T, NM_004011.2:c.1321G>T, NM_004011.3:c.1321G>T, NM_004012.2:c.1312G>T, NM_004012.3:c.1312G>TPathogenic09/19/2016 
712DMDEx38NM_004006.2:c.5353C>Tp.Gln1785* | p.Q1785XLRG_199t1:c.5353C>T, NM_000109.2:c.5329C>T, NM_000109.3:c.5329C>T, NM_004006.1:c.5353C>T, NM_004006.2:c.5353C>T, NM_004007.1:c.4984C>T, NM_004007.2:c.4984C>T, NM_004009.2:c.5341C>T, NM_004009.3:c.5341C>T, NM_004010.2:c.4984C>T, NM_004010.3:c.4984C>T, NM_004011.2:c.1330C>T, NM_004011.3:c.1330C>T, NM_004012.2:c.1321C>T, NM_004012.3:c.1321C>TPathogenic09/28/2017 
713DMDEx38NM_004006.2:c.5358T>Cp.Phe1786= | p.F1786=NM_000109.2:c.5334T>C, NM_000109.3:c.5334T>C, NM_004006.1:c.5358T>C, NM_004006.2:c.5358T>C, NM_004007.1:c.4989T>C, NM_004007.2:c.4989T>C, NM_004009.2:c.5346T>C, NM_004009.3:c.5346T>C, NM_004010.2:c.4989T>C, NM_004010.3:c.4989T>C, NM_004011.2:c.1335T>C, NM_004011.3:c.1335T>C, NM_004012.2:c.1326T>C, NM_004012.3:c.1326T>CVOUS06/11/2015
714DMDEx38NM_004006.2:c.5360dupAp.Asn1787Lysfs*9 | p.N1787KfsX9LRG_199t1:c.5360_5361insA, LRG_199t1:c.5360dupA, NM_000109.2:c.5336_5337insA, NM_000109.2:c.5336dupA, NM_000109.3:c.5336_5337insA, NM_000109.3:c.5336dupA, NM_004006.1:c.5360_5361insA, NM_004006.1:c.5360dupA, NM_004006.2:c.5360_5361insA, NM_004006.2:c.5360dupA, NM_004007.1:c.4991_4992insA, NM_004007.1:c.4991dupA, NM_004007.2:c.4991_4992insA, NM_004007.2:c.4991dupA, NM_004009.2:c.5348_5349insA, NM_004009.2:c.5348dupA, NM_004009.3:c.5348_5349insA, NM_004009.3:c.5348dupA, NM_004010.2:c.4991_4992insA, NM_004010.2:c.4991dupA, NM_004010.3:c.4991_4992insA, NM_004010.3:c.4991dupA, NM_004011.2:c.1337_1338insA, NM_004011.2:c.1337dupA, NM_004011.3:c.1337_1338insA, NM_004011.3:c.1337dupA, NM_004012.2:c.1328_1329insA, NM_004012.2:c.1328dupA, NM_004012.3:c.1328_1329insA, NM_004012.3:c.1328dupAPathogenic06/06/2016 
715DMDEx38NM_004006.2:c.5363C>Gp.Ser1788* | p.S1788XNM_000109.2:c.5339C>G, NM_000109.3:c.5339C>G, NM_004006.1:c.5363C>G, NM_004006.2:c.5363C>G, NM_004007.1:c.4994C>G, NM_004007.2:c.4994C>G, NM_004009.2:c.5351C>G, NM_004009.3:c.5351C>G, NM_004010.2:c.4994C>G, NM_004010.3:c.4994C>G, NM_004011.2:c.1340C>G, NM_004011.3:c.1340C>G, NM_004012.2:c.1331C>G, NM_004012.3:c.1331C>GPathogenic12/20/2013 
716DMDEx38NM_004006.2:c.5368A>Gp.Ile1790Val | p.I1790VLRG_199t1:c.5368A>G, NM_000109.2:c.5344A>G, NM_000109.3:c.5344A>G, NM_004006.1:c.5368A>G, NM_004006.2:c.5368A>G, NM_004007.1:c.4999A>G, NM_004007.2:c.4999A>G, NM_004009.2:c.5356A>G, NM_004009.3:c.5356A>G, NM_004010.2:c.4999A>G, NM_004010.3:c.4999A>G, NM_004011.2:c.1345A>G, NM_004011.3:c.1345A>G, NM_004012.2:c.1336A>G, NM_004012.3:c.1336A>GVOUS05/31/2016
717DMDEx38NM_004006.2:c.5368_5377delATACAAAAATp.Ile1790Cysfs*13 | p.I1790CfsX13LRG_199t1:c.5368_5377delATACAAAAAT, NM_000109.2:c.5344_5353delATACAAAAAT, NM_000109.3:c.5344_5353delATACAAAAAT, NM_004006.1:c.5368_5377delATACAAAAAT, NM_004006.2:c.5368_5377delATACAAAAAT, NM_004007.1:c.4999_5008delATACAAAAAT, NM_004007.2:c.4999_5008delATACAAAAAT, NM_004009.2:c.5356_5365delATACAAAAAT, NM_004009.3:c.5356_5365delATACAAAAAT, NM_004010.2:c.4999_5008delATACAAAAAT, NM_004010.3:c.4999_5008delATACAAAAAT, NM_004011.2:c.1345_1354delATACAAAAAT, NM_004011.3:c.1345_1354delATACAAAAAT, NM_004012.2:c.1336_1345delATACAAAAAT, NM_004012.3:c.1336_1345delATACAAAAATPathogenic04/29/2019 
718DMDEx38NM_004006.2:c.5371C>Tp.Gln1791* | p.Q1791XLRG_199t1:c.5371C>T, NM_000109.2:c.5347C>T, NM_000109.3:c.5347C>T, NM_004006.1:c.5371C>T, NM_004006.2:c.5371C>T, NM_004007.1:c.5002C>T, NM_004007.2:c.5002C>T, NM_004009.2:c.5359C>T, NM_004009.3:c.5359C>T, NM_004010.2:c.5002C>T, NM_004010.3:c.5002C>T, NM_004011.2:c.1348C>T, NM_004011.3:c.1348C>T, NM_004012.2:c.1339C>T, NM_004012.3:c.1339C>TPathogenic07/27/2017 
719DMDEx38NM_004006.2:c.5390_5411delTGGAGGCTGAAATTCAGCAGGGp.Leu1797Argfs*2 | p.L1797RfsX2LRG_199t1:c.5390_5411delTGGAGGCTGAAATTCAGCAGGG, NM_000109.2:c.5366_5387delTGGAGGCTGAAATTCAGCAGGG, NM_000109.3:c.5366_5387delTGGAGGCTGAAATTCAGCAGGG, NM_004006.1:c.5390_5411delTGGAGGCTGAAATTCAGCAGGG, NM_004006.2:c.5390_5411delTGGAGGCTGAAATTCAGCAGGG, NM_004007.1:c.5021_5042delTGGAGGCTGAAATTCAGCAGGG, NM_004007.2:c.5021_5042delTGGAGGCTGAAATTCAGCAGGG, NM_004009.2:c.5378_5399delTGGAGGCTGAAATTCAGCAGGG, NM_004009.3:c.5378_5399delTGGAGGCTGAAATTCAGCAGGG, NM_004010.2:c.5021_5042delTGGAGGCTGAAATTCAGCAGGG, NM_004010.3:c.5021_5042delTGGAGGCTGAAATTCAGCAGGG, NM_004011.2:c.1367_1388delTGGAGGCTGAAATTCAGCAGGG, NM_004011.3:c.1367_1388delTGGAGGCTGAAATTCAGCAGGG, NM_004012.2:c.1358_1379delTGGAGGCTGAAATTCAGCAGGG, NM_004012.3:c.1358_1379delTGGAGGCTGAAATTCAGCAGGGPathogenic08/09/2017 
720DMDEx38NM_004006.2:c.5407C>Tp.Gln1803* | p.Q1803XLRG_199t1:c.5407C>T, NM_000109.2:c.5383C>T, NM_000109.3:c.5383C>T, NM_004006.1:c.5407C>T, NM_004006.2:c.5407C>T, NM_004007.1:c.5038C>T, NM_004007.2:c.5038C>T, NM_004009.2:c.5395C>T, NM_004009.3:c.5395C>T, NM_004010.2:c.5038C>T, NM_004010.3:c.5038C>T, NM_004011.2:c.1384C>T, NM_004011.3:c.1384C>T, NM_004012.2:c.1375C>T, NM_004012.3:c.1375C>TPathogenic02/13/2019 
721DMDEx39NM_004006.2:c.5455_5459dupGACAAp.Asn1820Lysfs*7 | p.N1820KfsX7LRG_199t1:c.5455_5459dupGACAA, NM_000109.2:c.5431_5435dupGACAA, NM_000109.3:c.5431_5435dupGACAA, NM_004006.1:c.5455_5459dupGACAA, NM_004006.2:c.5455_5459dupGACAA, NM_004007.1:c.5086_5090dupGACAA, NM_004007.2:c.5086_5090dupGACAA, NM_004009.2:c.5443_5447dupGACAA, NM_004009.3:c.5443_5447dupGACAA, NM_004010.2:c.5086_5090dupGACAA, NM_004010.3:c.5086_5090dupGACAA, NM_004011.2:c.1432_1436dupGACAA, NM_004011.3:c.1432_1436dupGACAA, NM_004012.2:c.1423_1427dupGACAA, NM_004012.3:c.1423_1427dupGACAAPathogenic10/19/2017 
722DMDEx39NM_004006.2:c.5464G>Ap.Gly1822Ser | p.G1822SLRG_199t1:c.5464G>A, NM_000109.2:c.5440G>A, NM_000109.3:c.5440G>A, NM_004006.1:c.5464G>A, NM_004006.2:c.5464G>A, NM_004007.1:c.5095G>A, NM_004007.2:c.5095G>A, NM_004009.2:c.5452G>A, NM_004009.3:c.5452G>A, NM_004010.2:c.5095G>A, NM_004010.3:c.5095G>A, NM_004011.2:c.1441G>A, NM_004011.3:c.1441G>A, NM_004012.2:c.1432G>A, NM_004012.3:c.1432G>AVOUS01/23/2017
723DMDEx39NM_004006.2:c.5476G>Cp.Glu1826Gln | p.E1826QLRG_199t1:c.5476G>C, NM_000109.2:c.5452G>C, NM_000109.3:c.5452G>C, NM_004006.1:c.5476G>C, NM_004006.2:c.5476G>C, NM_004007.1:c.5107G>C, NM_004007.2:c.5107G>C, NM_004009.2:c.5464G>C, NM_004009.3:c.5464G>C, NM_004010.2:c.5107G>C, NM_004010.3:c.5107G>C, NM_004011.2:c.1453G>C, NM_004011.3:c.1453G>C, NM_004012.2:c.1444G>C, NM_004012.3:c.1444G>CBenign04/20/2016 
724DMDEx39NM_004006.2:c.5481G>Ap.Leu1827= | p.L1827=NM_000109.2:c.5457G>A, NM_000109.3:c.5457G>A, NM_004006.1:c.5481G>A, NM_004006.2:c.5481G>A, NM_004007.1:c.5112G>A, NM_004007.2:c.5112G>A, NM_004009.2:c.5469G>A, NM_004009.3:c.5469G>A, NM_004010.2:c.5112G>A, NM_004010.3:c.5112G>A, NM_004011.2:c.1458G>A, NM_004011.3:c.1458G>A, NM_004012.2:c.1449G>A, NM_004012.3:c.1449G>AVOUS05/29/2015
725DMDEx39NM_004006.2:c.5485C>Gp.Gln1829Glu | p.Q1829ENM_000109.2:c.5461C>G, NM_000109.3:c.5461C>G, NM_004006.1:c.5485C>G, NM_004006.2:c.5485C>G, NM_004007.1:c.5116C>G, NM_004007.2:c.5116C>G, NM_004009.2:c.5473C>G, NM_004009.3:c.5473C>G, NM_004010.2:c.5116C>G, NM_004010.3:c.5116C>G, NM_004011.2:c.1462C>G, NM_004011.3:c.1462C>G, NM_004012.2:c.1453C>G, NM_004012.3:c.1453C>GLikely benign12/19/2016 
726DMDEx39NM_004006.2:c.5530C>Ap.Arg1844= | p.R1844=LRG_199t1:c.5530C>A, NM_000109.2:c.5506C>A, NM_000109.3:c.5506C>A, NM_004006.1:c.5530C>A, NM_004006.2:c.5530C>A, NM_004007.1:c.5161C>A, NM_004007.2:c.5161C>A, NM_004009.2:c.5518C>A, NM_004009.3:c.5518C>A, NM_004010.2:c.5161C>A, NM_004010.3:c.5161C>A, NM_004011.2:c.1507C>A, NM_004011.3:c.1507C>A, NM_004012.2:c.1498C>A, NM_004012.3:c.1498C>AVOUS01/30/2017
727DMDEx39NM_004006.2:c.5530C>Tp.Arg1844* | p.R1844XNM_000109.2:c.5506C>T, NM_000109.3:c.5506C>T, NM_004006.1:c.5530C>T, NM_004006.2:c.5530C>T, NM_004007.1:c.5161C>T, NM_004007.2:c.5161C>T, NM_004009.2:c.5518C>T, NM_004009.3:c.5518C>T, NM_004010.2:c.5161C>T, NM_004010.3:c.5161C>T, NM_004011.2:c.1507C>T, NM_004011.3:c.1507C>T, NM_004012.2:c.1498C>T, NM_004012.3:c.1498C>TPathogenic11/28/2016 
728DMDEx39NM_004006.2:c.5548A>Gp.Lys1850Glu | p.K1850ENM_000109.2:c.5524A>G, NM_000109.3:c.5524A>G, NM_004006.1:c.5548A>G, NM_004006.2:c.5548A>G, NM_004007.1:c.5179A>G, NM_004007.2:c.5179A>G, NM_004009.2:c.5536A>G, NM_004009.3:c.5536A>G, NM_004010.2:c.5179A>G, NM_004010.3:c.5179A>G, NM_004011.2:c.1525A>G, NM_004011.3:c.1525A>G, NM_004012.2:c.1516A>G, NM_004012.3:c.1516A>GVOUS08/03/2015
729DMDEx39NM_004006.2:c.5548_5552delAAACAp.Lys1850Alafs*8 | p.K1850AfsX8LRG_199t1:c.5548_5552delAAACA, NM_000109.2:c.5524_5528delAAACA, NM_000109.3:c.5524_5528delAAACA, NM_004006.1:c.5548_5552delAAACA, NM_004006.2:c.5548_5552delAAACA, NM_004007.1:c.5179_5183delAAACA, NM_004007.2:c.5179_5183delAAACA, NM_004009.2:c.5536_5540delAAACA, NM_004009.3:c.5536_5540delAAACA, NM_004010.2:c.5179_5183delAAACA, NM_004010.3:c.5179_5183delAAACA, NM_004011.2:c.1525_1529delAAACA, NM_004011.3:c.1525_1529delAAACA, NM_004012.2:c.1516_1520delAAACA, NM_004012.3:c.1516_1520delAAACAPathogenic04/11/2017 
730DMDEx39NM_004006.2:c.5554C>Tp.Gln1852* | p.Q1852XLRG_199t1:c.5554C>T, NM_000109.2:c.5530C>T, NM_000109.3:c.5530C>T, NM_004006.1:c.5554C>T, NM_004006.2:c.5554C>T, NM_004007.1:c.5185C>T, NM_004007.2:c.5185C>T, NM_004009.2:c.5542C>T, NM_004009.3:c.5542C>T, NM_004010.2:c.5185C>T, NM_004010.3:c.5185C>T, NM_004011.2:c.1531C>T, NM_004011.3:c.1531C>T, NM_004012.2:c.1522C>T, NM_004012.3:c.1522C>TPathogenic05/10/2018 
731DMDEx39NM_004006.2:c.5563C>Tp.Gln1855* | p.Q1855XLRG_199t1:c.5563C>T, NM_000109.2:c.5539C>T, NM_000109.3:c.5539C>T, NM_004006.1:c.5563C>T, NM_004006.2:c.5563C>T, NM_004007.1:c.5194C>T, NM_004007.2:c.5194C>T, NM_004009.2:c.5551C>T, NM_004009.3:c.5551C>T, NM_004010.2:c.5194C>T, NM_004010.3:c.5194C>T, NM_004011.2:c.1540C>T, NM_004011.3:c.1540C>T, NM_004012.2:c.1531C>T, NM_004012.3:c.1531C>TPathogenic10/12/2017 
732DMDEx39NM_004006.2:c.5570_5571dupAANM_000109.2:c.5545_5546insAA, NM_000109.3:c.5545_5546insAA, NM_004006.1:c.5569_5570insAA, NM_004006.2:c.5569_5570insAA, NM_004007.1:c.5200_5201insAA, NM_004007.2:c.5200_5201insAA, NM_004009.2:c.5557_5558insAA, NM_004009.3:c.5557_5558insAA, NM_004010.2:c.5200_5201insAA, NM_004010.3:c.5200_5201insAA, NM_004011.2:c.1546_1547insAA, NM_004011.3:c.1546_1547insAA, NM_004012.2:c.1537_1538insAA, NM_004012.3:c.1537_1538insAAPathogenic** 
733DMDEx39NM_004006.2:c.5586+9G>ANM_000109.2:c.5562+9G>A, NM_000109.3:c.5562+9G>A, NM_004006.1:c.5586+9G>A, NM_004006.2:c.5586+9G>A, NM_004007.1:c.5217+9G>A, NM_004007.2:c.5217+9G>A, NM_004009.2:c.5574+9G>A, NM_004009.3:c.5574+9G>A, NM_004010.2:c.5217+9G>A, NM_004010.3:c.5217+9G>A, NM_004011.2:c.1563+9G>A, NM_004011.3:c.1563+9G>A, NM_004012.2:c.1554+9G>A, NM_004012.3:c.1554+9G>ALikely benign01/06/2016 
734DMDEx39NM_004006.2:c.5586+18A>GNM_000109.2:c.5562+18A>G, NM_000109.3:c.5562+18A>G, NM_004006.1:c.5586+18A>G, NM_004006.2:c.5586+18A>G, NM_004007.1:c.5217+18A>G, NM_004007.2:c.5217+18A>G, NM_004009.2:c.5574+18A>G, NM_004009.3:c.5574+18A>G, NM_004010.2:c.5217+18A>G, NM_004010.3:c.5217+18A>G, NM_004011.2:c.1563+18A>G, NM_004011.3:c.1563+18A>G, NM_004012.2:c.1554+18A>G, NM_004012.3:c.1554+18A>GBenign09/22/2015 
735DMDEx39NM_004006.2:c.5586+30G>ABenign** 
736DMDEx40NM_004006.2:c.5587-10C>ANM_000109.2:c.5563-10C>A, NM_000109.3:c.5563-10C>A, NM_004006.1:c.5587-10C>A, NM_004006.2:c.5587-10C>A, NM_004007.1:c.5218-10C>A, NM_004007.2:c.5218-10C>A, NM_004009.2:c.5575-10C>A, NM_004009.3:c.5575-10C>A, NM_004010.2:c.5218-10C>A, NM_004010.3:c.5218-10C>A, NM_004011.2:c.1564-10C>A, NM_004011.3:c.1564-10C>A, NM_004012.2:c.1555-10C>A, NM_004012.3:c.1555-10C>AVOUS01/03/2016
737DMDEx40NM_004006.2:c.5595delGp.Arg1865Serfs*9 | p.R1865SfsX9LRG_199t1:c.5595delG, NM_000109.2:c.5571delG, NM_000109.3:c.5571delG, NM_004006.1:c.5595delG, NM_004006.2:c.5595delG, NM_004007.1:c.5226delG, NM_004007.2:c.5226delG, NM_004009.2:c.5583delG, NM_004009.3:c.5583delG, NM_004010.2:c.5226delG, NM_004010.3:c.5226delG, NM_004011.2:c.1572delG, NM_004011.3:c.1572delG, NM_004012.2:c.1563delG, NM_004012.3:c.1563delGPathogenic03/13/2017 
738DMDEx40NM_004006.2:c.5599C>Gp.Gln1867Glu | p.Q1867ELRG_199t1:c.5599C>G, NM_000109.2:c.5575C>G, NM_000109.3:c.5575C>G, NM_004006.1:c.5599C>G, NM_004006.2:c.5599C>G, NM_004007.1:c.5230C>G, NM_004007.2:c.5230C>G, NM_004009.2:c.5587C>G, NM_004009.3:c.5587C>G, NM_004010.2:c.5230C>G, NM_004010.3:c.5230C>G, NM_004011.2:c.1576C>G, NM_004011.3:c.1576C>G, NM_004012.2:c.1567C>G, NM_004012.3:c.1567C>GVOUS05/02/2017
739DMDEx40NM_004006.2:c.5602_5605delAGAALRG_199t1:c.5602_5605delAGAA, NM_000109.2:c.5578_5581delAGAA, NM_000109.3:c.5578_5581delAGAA, NM_004006.1:c.5602_5605delAGAA, NM_004006.2:c.5602_5605delAGAA, NM_004007.1:c.5233_5236delAGAA, NM_004007.2:c.5233_5236delAGAA, NM_004009.2:c.5590_5593delAGAA, NM_004009.3:c.5590_5593delAGAA, NM_004010.2:c.5233_5236delAGAA, NM_004010.3:c.5233_5236delAGAA, NM_004011.2:c.1579_1582delAGAA, NM_004011.3:c.1579_1582delAGAA, NM_004012.2:c.1570_1573delAGAA, NM_004012.3:c.1570_1573delAGAAPathogenic07/28/2016 
740DMDEx40NM_004006.2:c.5620G>Ap.Glu1874Lys | p.E1874KNM_000109.2:c.5596G>A, NM_000109.3:c.5596G>A, NM_004006.1:c.5620G>A, NM_004006.2:c.5620G>A, NM_004007.1:c.5251G>A, NM_004007.2:c.5251G>A, NM_004009.2:c.5608G>A, NM_004009.3:c.5608G>A, NM_004010.2:c.5251G>A, NM_004010.3:c.5251G>A, NM_004011.2:c.1597G>A, NM_004011.3:c.1597G>A, NM_004012.2:c.1588G>A, NM_004012.3:c.1588G>ALikely benign11/17/2014 
741DMDEx40NM_004006.2:c.5640T>Ap.Tyr1880* | p.Y1880XPathogenic09/27/2012 
742DMDEx40NM_004006.2:c.5654A>Tp.Gln1885Leu | p.Q1885LLRG_199t1:c.5654A>T, NM_000109.2:c.5630A>T, NM_000109.3:c.5630A>T, NM_004006.1:c.5654A>T, NM_004006.2:c.5654A>T, NM_004007.1:c.5285A>T, NM_004007.2:c.5285A>T, NM_004009.2:c.5642A>T, NM_004009.3:c.5642A>T, NM_004010.2:c.5285A>T, NM_004010.3:c.5285A>T, NM_004011.2:c.1631A>T, NM_004011.3:c.1631A>T, NM_004012.2:c.1622A>T, NM_004012.3:c.1622A>TVOUS09/20/2016
743DMDEx40NM_004006.2:c.5658T>Cp.Ala1886= | p.A1886=LRG_199t1:c.5658T>C, NM_000109.2:c.5634T>C, NM_000109.3:c.5634T>C, NM_004006.1:c.5658T>C, NM_004006.2:c.5658T>C, NM_004007.1:c.5289T>C, NM_004007.2:c.5289T>C, NM_004009.2:c.5646T>C, NM_004009.3:c.5646T>C, NM_004010.2:c.5289T>C, NM_004010.3:c.5289T>C, NM_004011.2:c.1635T>C, NM_004011.3:c.1635T>C, NM_004012.2:c.1626T>C, NM_004012.3:c.1626T>CVOUS04/09/2018
744DMDEx40NM_004006.2:c.5671A>Tp.Lys1891* | p.K1891XPathogenic** 
745DMDEx40NM_004006.2:c.5680delGp.Asp1894Metfs*7 | p.D1894MfsX7LRG_199t1:c.5680delG, NM_000109.2:c.5656delG, NM_000109.3:c.5656delG, NM_004006.1:c.5680delG, NM_004006.2:c.5680delG, NM_004007.1:c.5311delG, NM_004007.2:c.5311delG, NM_004009.2:c.5668delG, NM_004009.3:c.5668delG, NM_004010.2:c.5311delG, NM_004010.3:c.5311delG, NM_004011.2:c.1657delG, NM_004011.3:c.1657delG, NM_004012.2:c.1648delG, NM_004012.3:c.1648delGPathogenic03/08/2018 
746DMDEx40NM_004006.2:c.5684A>Gp.Asp1895Gly | p.D1895GLRG_199t1:c.5684A>G, NM_000109.2:c.5660A>G, NM_000109.3:c.5660A>G, NM_004006.1:c.5684A>G, NM_004006.2:c.5684A>G, NM_004007.1:c.5315A>G, NM_004007.2:c.5315A>G, NM_004009.2:c.5672A>G, NM_004009.3:c.5672A>G, NM_004010.2:c.5315A>G, NM_004010.3:c.5315A>G, NM_004011.2:c.1661A>G, NM_004011.3:c.1661A>G, NM_004012.2:c.1652A>G, NM_004012.3:c.1652A>GVOUS12/22/2018
747DMDEx40NM_004006.2:c.5693A>Cp.Lys1898Thr | p.K1898TNM_000109.2:c.5669A>C, NM_000109.3:c.5669A>C, NM_004006.1:c.5693A>C, NM_004006.2:c.5693A>C, NM_004007.1:c.5324A>C, NM_004007.2:c.5324A>C, NM_004009.2:c.5681A>C, NM_004009.3:c.5681A>C, NM_004010.2:c.5324A>C, NM_004010.3:c.5324A>C, NM_004011.2:c.1670A>C, NM_004011.3:c.1670A>C, NM_004012.2:c.1661A>C, NM_004012.3:c.1661A>CVOUS05/29/2015
748DMDEx40NM_004006.2:c.5697delANM_000109.2:c.5673delA, NM_000109.3:c.5673delA, NM_004006.1:c.5697delA, NM_004006.2:c.5697delA, NM_004007.1:c.5328delA, NM_004007.2:c.5328delA, NM_004009.2:c.5685delA, NM_004009.3:c.5685delA, NM_004010.2:c.5328delA, NM_004010.3:c.5328delA, NM_004011.2:c.1674delA, NM_004011.3:c.1674delA, NM_004012.2:c.1665delA, NM_004012.3:c.1665delAPathogenic06/09/2014 
749DMDEx40NM_004006.2:c.5697dupAp.Leu1900Ilefs*6 | p.L1900IfsX6LRG_199t1:c.5697dupA, NM_000109.2:c.5673dupA, NM_000109.3:c.5673dupA, NM_004006.1:c.5697dupA, NM_004006.2:c.5697dupA, NM_004007.1:c.5328dupA, NM_004007.2:c.5328dupA, NM_004009.2:c.5685dupA, NM_004009.3:c.5685dupA, NM_004010.2:c.5328dupA, NM_004010.3:c.5328dupA, NM_004011.2:c.1674dupA, NM_004011.3:c.1674dupA, NM_004012.2:c.1665dupA, NM_004012.3:c.1665dupAPathogenic05/08/2018 
750DMDEx40NM_004006.2:c.5701G>Ap.Ala1901Thr | p.A1901TNM_000109.2:c.5677G>A, NM_000109.3:c.5677G>A, NM_004006.1:c.5701G>A, NM_004006.2:c.5701G>A, NM_004007.1:c.5332G>A, NM_004007.2:c.5332G>A, NM_004009.2:c.5689G>A, NM_004009.3:c.5689G>A, NM_004010.2:c.5332G>A, NM_004010.3:c.5332G>A, NM_004011.2:c.1678G>A, NM_004011.3:c.1678G>A, NM_004012.2:c.1669G>A, NM_004012.3:c.1669G>ALikely benign03/23/2016 
751DMDEx40NM_004006.2:c.5706C>Ap.Ser1902Arg | p.S1902RLRG_199t1:c.5706C>A, NM_000109.2:c.5682C>A, NM_000109.3:c.5682C>A, NM_004006.1:c.5706C>A, NM_004006.2:c.5706C>A, NM_004007.1:c.5337C>A, NM_004007.2:c.5337C>A, NM_004009.2:c.5694C>A, NM_004009.3:c.5694C>A, NM_004010.2:c.5337C>A, NM_004010.3:c.5337C>A, NM_004011.2:c.1683C>A, NM_004011.3:c.1683C>A, NM_004012.2:c.1674C>A, NM_004012.3:c.1674C>AVOUS08/31/2016
752DMDEx40NM_004006.2:c.5713G>Tp.Glu1905* | p.E1905XLRG_199t1:c.5713G>T, NM_000109.2:c.5689G>T, NM_000109.3:c.5689G>T, NM_004006.1:c.5713G>T, NM_004006.2:c.5713G>T, NM_004007.1:c.5344G>T, NM_004007.2:c.5344G>T, NM_004009.2:c.5701G>T, NM_004009.3:c.5701G>T, NM_004010.2:c.5344G>T, NM_004010.3:c.5344G>T, NM_004011.2:c.1690G>T, NM_004011.3:c.1690G>T, NM_004012.2:c.1681G>T, NM_004012.3:c.1681G>TPathogenic01/17/2017 
753DMDEx40NM_004006.2:c.5723A>Tp.Asp1908Val | p.D1908VNM_000109.2:c.5699A>T, NM_000109.3:c.5699A>T, NM_004006.1:c.5723A>T, NM_004006.2:c.5723A>T, NM_004007.1:c.5354A>T, NM_004007.2:c.5354A>T, NM_004009.2:c.5711A>T, NM_004009.3:c.5711A>T, NM_004010.2:c.5354A>T, NM_004010.3:c.5354A>T, NM_004011.2:c.1700A>T, NM_004011.3:c.1700A>T, NM_004012.2:c.1691A>T, NM_004012.3:c.1691A>TLikely benign02/23/2015 
754DMDEx40NM_004006.2:c.5724T>Cp.Asp1908= | p.D1908=NM_000109.2:c.5700T>C, NM_000109.3:c.5700T>C, NM_004006.1:c.5724T>C, NM_004006.2:c.5724T>C, NM_004007.1:c.5355T>C, NM_004007.2:c.5355T>C, NM_004009.2:c.5712T>C, NM_004009.3:c.5712T>C, NM_004010.2:c.5355T>C, NM_004010.3:c.5355T>C, NM_004011.2:c.1701T>C, NM_004011.3:c.1701T>C, NM_004012.2:c.1692T>C, NM_004012.3:c.1692T>CBenign09/13/2013 
755DMDEx40NM_004006.2:c.5729_5733delGGAAAp.Arg1910Asnfs*5 | p.R1910NfsX5LRG_199t1:c.5729_5733delGGAAA, NM_000109.2:c.5705_5709delGGAAA, NM_000109.3:c.5705_5709delGGAAA, NM_004006.1:c.5729_5733delGGAAA, NM_004006.2:c.5729_5733delGGAAA, NM_004007.1:c.5360_5364delGGAAA, NM_004007.2:c.5360_5364delGGAAA, NM_004009.2:c.5717_5721delGGAAA, NM_004009.3:c.5717_5721delGGAAA, NM_004010.2:c.5360_5364delGGAAA, NM_004010.3:c.5360_5364delGGAAA, NM_004011.2:c.1706_1710delGGAAA, NM_004011.3:c.1706_1710delGGAAA, NM_004012.2:c.1697_1701delGGAAA, NM_004012.3:c.1697_1701delGGAAAPathogenic07/14/2017 
756DMDEx40NM_004006.2:c.5739+1G>TNM_000109.2:c.5715+1G>T, NM_000109.3:c.5715+1G>T, NM_004006.1:c.5739+1G>T, NM_004006.2:c.5739+1G>T, NM_004007.1:c.5370+1G>T, NM_004007.2:c.5370+1G>T, NM_004009.2:c.5727+1G>T, NM_004009.3:c.5727+1G>T, NM_004010.2:c.5370+1G>T, NM_004010.3:c.5370+1G>T, NM_004011.2:c.1716+1G>T, NM_004011.3:c.1716+1G>T, NM_004012.2:c.1707+1G>T, NM_004012.3:c.1707+1G>TPathogenic01/18/2017 
757DMDEx40NM_004006.2:c.5739+15G>TVOUS**
758DMDEx41NM_004006.2:c.5740-5A>GLRG_199t1:c.5740-5A>G, NM_000109.2:c.5716-5A>G, NM_000109.3:c.5716-5A>G, NM_004006.1:c.5740-5A>G, NM_004006.2:c.5740-5A>G, NM_004007.1:c.5371-5A>G, NM_004007.2:c.5371-5A>G, NM_004009.2:c.5728-5A>G, NM_004009.3:c.5728-5A>G, NM_004010.2:c.5371-5A>G, NM_004010.3:c.5371-5A>G, NM_004011.2:c.1717-5A>G, NM_004011.3:c.1717-5A>G, NM_004012.2:c.1708-5A>G, NM_004012.3:c.1708-5A>GVOUS05/04/2017
759DMDEx41NM_004006.2:c.5749C>Tp.Arg1917Trp | p.R1917WLRG_199t1:c.5749C>T, NM_000109.2:c.5725C>T, NM_000109.3:c.5725C>T, NM_004006.1:c.5749C>T, NM_004006.2:c.5749C>T, NM_004007.1:c.5380C>T, NM_004007.2:c.5380C>T, NM_004009.2:c.5737C>T, NM_004009.3:c.5737C>T, NM_004010.2:c.5380C>T, NM_004010.3:c.5380C>T, NM_004011.2:c.1726C>T, NM_004011.3:c.1726C>T, NM_004012.2:c.1717C>T, NM_004012.3:c.1717C>TVOUS01/03/2017
760DMDEx41NM_004006.2:c.5773G>Tp.Glu1925* | p.E1925XPathogenic** 
761DMDEx41NM_004006.2:c.5775G>Tp.Glu1925Asp | p.E1925DNM_000109.2:c.5751G>T, NM_000109.3:c.5751G>T, NM_004006.1:c.5775G>T, NM_004006.2:c.5775G>T, NM_004007.1:c.5406G>T, NM_004007.2:c.5406G>T, NM_004009.2:c.5763G>T, NM_004009.3:c.5763G>T, NM_004010.2:c.5406G>T, NM_004010.3:c.5406G>T, NM_004011.2:c.1752G>T, NM_004011.3:c.1752G>T, NM_004012.2:c.1743G>T, NM_004012.3:c.1743G>TVOUS02/23/2016
762DMDEx41NM_004006.2:c.5800G>Tp.Glu1934* | p.E1934XLRG_199t1:c.5800G>T, NM_000109.2:c.5776G>T, NM_000109.3:c.5776G>T, NM_004006.1:c.5800G>T, NM_004006.2:c.5800G>T, NM_004007.1:c.5431G>T, NM_004007.2:c.5431G>T, NM_004009.2:c.5788G>T, NM_004009.3:c.5788G>T, NM_004010.2:c.5431G>T, NM_004010.3:c.5431G>T, NM_004011.2:c.1777G>T, NM_004011.3:c.1777G>T, NM_004012.2:c.1768G>T, NM_004012.3:c.1768G>TPathogenic12/13/2016 
763DMDEx41NM_004006.2:c.5807T>Ap.Leu1936* | p.L1936XPathogenic** 
764DMDEx41NM_004006.2:c.5826A>Cp.Ala1942= | p.A1942=LRG_199t1:c.5826A>C, NM_000109.2:c.5802A>C, NM_000109.3:c.5802A>C, NM_004006.1:c.5826A>C, NM_004006.2:c.5826A>C, NM_004007.1:c.5457A>C, NM_004007.2:c.5457A>C, NM_004009.2:c.5814A>C, NM_004009.3:c.5814A>C, NM_004010.2:c.5457A>C, NM_004010.3:c.5457A>C, NM_004011.2:c.1803A>C, NM_004011.3:c.1803A>C, NM_004012.2:c.1794A>C, NM_004012.3:c.1794A>CVOUS10/27/2017
765DMDEx41NM_004006.2:c.5827A>Gp.Met1943Val | p.M1943VNM_000109.2:c.5803A>G, NM_000109.3:c.5803A>G, NM_004006.1:c.5827A>G, NM_004006.2:c.5827A>G, NM_004007.1:c.5458A>G, NM_004007.2:c.5458A>G, NM_004009.2:c.5815A>G, NM_004009.3:c.5815A>G, NM_004010.2:c.5458A>G, NM_004010.3:c.5458A>G, NM_004011.2:c.1804A>G, NM_004011.3:c.1804A>G, NM_004012.2:c.1795A>G, NM_004012.3:c.1795A>GVOUS12/16/2013
766DMDEx41NM_004006.2:c.5858G>Ap.Ser1953Asn | p.S1953NLRG_199t1:c.5858G>A, NM_000109.2:c.5834G>A, NM_000109.3:c.5834G>A, NM_004006.1:c.5858G>A, NM_004006.2:c.5858G>A, NM_004007.1:c.5489G>A, NM_004007.2:c.5489G>A, NM_004009.2:c.5846G>A, NM_004009.3:c.5846G>A, NM_004010.2:c.5489G>A, NM_004010.3:c.5489G>A, NM_004011.2:c.1835G>A, NM_004011.3:c.1835G>A, NM_004012.2:c.1826G>A, NM_004012.3:c.1826G>AVOUS09/29/2017
767DMDEx41NM_004006.2:c.5864G>Ap.Arg1955His | p.R1955HLRG_199t1:c.5864G>A, NM_000109.2:c.5840G>A, NM_000109.3:c.5840G>A, NM_004006.1:c.5864G>A, NM_004006.2:c.5864G>A, NM_004007.1:c.5495G>A, NM_004007.2:c.5495G>A, NM_004009.2:c.5852G>A, NM_004009.3:c.5852G>A, NM_004010.2:c.5495G>A, NM_004010.3:c.5495G>A, NM_004011.2:c.1841G>A, NM_004011.3:c.1841G>A, NM_004012.2:c.1832G>A, NM_004012.3:c.1832G>AVOUS12/07/2017
768DMDEx41NM_004006.2:c.5867G>Ap.Trp1956* | p.W1956XLRG_199t1:c.5867G>A, NM_000109.2:c.5843G>A, NM_000109.3:c.5843G>A, NM_004006.1:c.5867G>A, NM_004006.2:c.5867G>A, NM_004007.1:c.5498G>A, NM_004007.2:c.5498G>A, NM_004009.2:c.5855G>A, NM_004009.3:c.5855G>A, NM_004010.2:c.5498G>A, NM_004010.3:c.5498G>A, NM_004011.2:c.1844G>A, NM_004011.3:c.1844G>A, NM_004012.2:c.1835G>A, NM_004012.3:c.1835G>APathogenic08/24/2017 
769DMDEx41NM_004006.2:c.5868G>Ap.Trp1956* | p.W1956XNM_000109.2:c.5844G>A, NM_000109.3:c.5844G>A, NM_004006.1:c.5868G>A, NM_004006.2:c.5868G>A, NM_004007.1:c.5499G>A, NM_004007.2:c.5499G>A, NM_004009.2:c.5856G>A, NM_004009.3:c.5856G>A, NM_004010.2:c.5499G>A, NM_004010.3:c.5499G>A, NM_004011.2:c.1845G>A, NM_004011.3:c.1845G>A, NM_004012.2:c.1836G>A, NM_004012.3:c.1836G>APathogenic05/28/2015 
770DMDEx41NM_004006.2:c.5881_5882delAGLRG_199t1:c.5881_5882delAG, NM_000109.2:c.5857_5858delAG, NM_000109.3:c.5857_5858delAG, NM_004006.1:c.5881_5882delAG, NM_004006.2:c.5881_5882delAG, NM_004007.1:c.5512_5513delAG, NM_004007.2:c.5512_5513delAG, NM_004009.2:c.5869_5870delAG, NM_004009.3:c.5869_5870delAG, NM_004010.2:c.5512_5513delAG, NM_004010.3:c.5512_5513delAG, NM_004011.2:c.1858_1859delAG, NM_004011.3:c.1858_1859delAG, NM_004012.2:c.1849_1850delAG, NM_004012.3:c.1849_1850delAGPathogenic07/13/2016 
771DMDEx41NM_004006.2:c.5883C>Ap.Ser1961Arg | p.S1961RLRG_199t1:c.5883C>A, NM_000109.2:c.5859C>A, NM_000109.3:c.5859C>A, NM_004006.1:c.5883C>A, NM_004006.2:c.5883C>A, NM_004007.1:c.5514C>A, NM_004007.2:c.5514C>A, NM_004009.2:c.5871C>A, NM_004009.3:c.5871C>A, NM_004010.2:c.5514C>A, NM_004010.3:c.5514C>A, NM_004011.2:c.1860C>A, NM_004011.3:c.1860C>A, NM_004012.2:c.1851C>A, NM_004012.3:c.1851C>AVOUS07/16/2018
772DMDEx41NM_004006.2:c.5899C>Tp.Arg1967* | p.R1967XNM_000109.2:c.5875C>T, NM_000109.3:c.5875C>T, NM_004006.1:c.5899C>T, NM_004006.2:c.5899C>T, NM_004007.1:c.5530C>T, NM_004007.2:c.5530C>T, NM_004009.2:c.5887C>T, NM_004009.3:c.5887C>T, NM_004010.2:c.5530C>T, NM_004010.3:c.5530C>T, NM_004011.2:c.1876C>T, NM_004011.3:c.1876C>T, NM_004012.2:c.1867C>T, NM_004012.3:c.1867C>TPathogenic10/12/2017 
773DMDEx41NM_004006.2:c.5910delCLRG_199t1:c.5910delC, NM_000109.2:c.5886delC, NM_000109.3:c.5886delC, NM_004006.1:c.5910delC, NM_004006.2:c.5910delC, NM_004007.1:c.5541delC, NM_004007.2:c.5541delC, NM_004009.2:c.5898delC, NM_004009.3:c.5898delC, NM_004010.2:c.5541delC, NM_004010.3:c.5541delC, NM_004011.2:c.1887delC, NM_004011.3:c.1887delC, NM_004012.2:c.1878delC, NM_004012.3:c.1878delCPathogenic09/28/2016 
774DMDEx41NM_004006.2:c.5917C>Tp.Gln1973* | p.Q1973XLRG_199t1:c.5917C>T, NM_000109.2:c.5893C>T, NM_000109.3:c.5893C>T, NM_004006.1:c.5917C>T, NM_004006.2:c.5917C>T, NM_004007.1:c.5548C>T, NM_004007.2:c.5548C>T, NM_004009.2:c.5905C>T, NM_004009.3:c.5905C>T, NM_004010.2:c.5548C>T, NM_004010.3:c.5548C>T, NM_004011.2:c.1894C>T, NM_004011.3:c.1894C>T, NM_004012.2:c.1885C>T, NM_004012.3:c.1885C>TPathogenic06/21/2018 
775DMDEx41NM_004006.2:c.5922+3G>CLRG_199t1:c.5922+3G>C, NM_000109.2:c.5898+3G>C, NM_000109.3:c.5898+3G>C, NM_004006.1:c.5922+3G>C, NM_004006.2:c.5922+3G>C, NM_004007.1:c.5553+3G>C, NM_004007.2:c.5553+3G>C, NM_004009.2:c.5910+3G>C, NM_004009.3:c.5910+3G>C, NM_004010.2:c.5553+3G>C, NM_004010.3:c.5553+3G>C, NM_004011.2:c.1899+3G>C, NM_004011.3:c.1899+3G>C, NM_004012.2:c.1890+3G>C, NM_004012.3:c.1890+3G>CPathogenic** 
776DMDEx42NM_004006.2:c.5933G>Ap.Arg1978His | p.R1978HLRG_199t1:c.5933G>A, NM_000109.2:c.5909G>A, NM_000109.3:c.5909G>A, NM_004006.1:c.5933G>A, NM_004006.2:c.5933G>A, NM_004007.1:c.5564G>A, NM_004007.2:c.5564G>A, NM_004009.2:c.5921G>A, NM_004009.3:c.5921G>A, NM_004010.2:c.5564G>A, NM_004010.3:c.5564G>A, NM_004011.2:c.1910G>A, NM_004011.3:c.1910G>A, NM_004012.2:c.1901G>A, NM_004012.3:c.1901G>AVOUS08/10/2016
777DMDEx42NM_004006.2:c.5933G>Tp.Arg1978Leu | p.R1978LLRG_199t1:c.5933G>T, NM_000109.2:c.5909G>T, NM_000109.3:c.5909G>T, NM_004006.1:c.5933G>T, NM_004006.2:c.5933G>T, NM_004007.1:c.5564G>T, NM_004007.2:c.5564G>T, NM_004009.2:c.5921G>T, NM_004009.3:c.5921G>T, NM_004010.2:c.5564G>T, NM_004010.3:c.5564G>T, NM_004011.2:c.1910G>T, NM_004011.3:c.1910G>T, NM_004012.2:c.1901G>T, NM_004012.3:c.1901G>TVOUS10/21/2016
778DMDEx42NM_004006.2:c.5938G>Tp.Glu1980* | p.E1980XPathogenic08/15/2012 
779DMDEx42NM_004006.2:c.5942C>Gp.Thr1981Arg | p.T1981RLRG_199t1:c.5942C>G, NM_000109.2:c.5918C>G, NM_000109.3:c.5918C>G, NM_004006.1:c.5942C>G, NM_004006.2:c.5942C>G, NM_004007.1:c.5573C>G, NM_004007.2:c.5573C>G, NM_004009.2:c.5930C>G, NM_004009.3:c.5930C>G, NM_004010.2:c.5573C>G, NM_004010.3:c.5573C>G, NM_004011.2:c.1919C>G, NM_004011.3:c.1919C>G, NM_004012.2:c.1910C>G, NM_004012.3:c.1910C>GVOUS09/18/2016
780DMDEx42NM_004006.2:c.5972delTp.Leu1991Trpfs*11 | p.L1991WfsX11LRG_199t1:c.5972delT, NM_000109.2:c.5948delT, NM_000109.3:c.5948delT, NM_004006.1:c.5972delT, NM_004006.2:c.5972delT, NM_004007.1:c.5603delT, NM_004007.2:c.5603delT, NM_004009.2:c.5960delT, NM_004009.3:c.5960delT, NM_004010.2:c.5603delT, NM_004010.3:c.5603delT, NM_004011.2:c.1949delT, NM_004011.3:c.1949delT, NM_004012.2:c.1940delT, NM_004012.3:c.1940delTPathogenic09/08/2017<