Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1DHCR7Ex3NM_001360.2:c.1A>Gp.Met1? | p.M1?LRG_340t1:c.1A>G, NM_001163817.1:c.1A>G, NM_001360.2:c.1A>GLikely pathogenic01/01/2021 
2DHCR7Ex3NM_001360.2:c.15G>Ap.Ser5= | p.S5=LRG_340t1:c.15G>A, NM_001163817.1:c.15G>A, NM_001360.2:c.15G>AVOUS11/10/2017
3DHCR7Ex3NM_001360.2:c.20C>Ap.Pro7His | p.P7HLRG_340t1:c.20C>A, NM_001163817.1:c.20C>A, NM_001360.2:c.20C>AVOUS10/03/2019
4DHCR7Ex3NM_001360.2:c.28C>Gp.Pro10Ala | p.P10ALRG_340t1:c.28C>G, NM_001163817.1:c.28C>G, NM_001360.2:c.28C>GVOUS09/11/2020
5DHCR7Ex3NM_001360.2:c.58A>Gp.Asn20Asp | p.N20DLRG_340t1:c.58A>G, NM_001163817.1:c.58A>G, NM_001360.2:c.58A>GVOUS10/24/2018
6DHCR7Ex3NM_001360.2:c.69C>Tp.Thr23= | p.T23=LRG_340t1:c.69C>T, NM_001163817.1:c.69C>T, NM_001360.2:c.69C>TVOUS09/11/2020
7DHCR7Ex3NM_001360.2:c.70G>Tp.Ala24Ser | p.A24SLRG_340t1:c.70G>T, NM_001163817.1:c.70G>T, NM_001360.2:c.70G>TBenign03/18/2013 
8DHCR7Ex3NM_001360.2:c.70G>Ap.Ala24Thr | p.A24TLRG_340t1:c.70G>A, NM_001163817.1:c.70G>A, NM_001360.2:c.70G>AVOUS09/12/2017
9DHCR7Ex3NM_001360.2:c.84G>Tp.Gln28His | p.Q28HLRG_340t1:c.84G>T, NM_001163817.1:c.84G>T, NM_001360.2:c.84G>TVOUS08/29/2016
10DHCR7Ex3NM_001360.2:c.89G>Cp.Gly30Ala | p.G30ALRG_340t1:c.89G>C, NM_001163817.1:c.89G>C, NM_001360.2:c.89G>CVOUS11/27/2018
11DHCR7Ex3NM_001360.2:c.91C>Tp.Arg31Cys | p.R31CNM_001163817.1:c.91C>T, NM_001360.2:c.91C>TVOUS06/15/2015
12DHCR7Ex3NM_001360.2:c.92G>Ap.Arg31His | p.R31HLRG_340t1:c.92G>A, NM_001163817.1:c.92G>A, NM_001360.2:c.92G>AVOUS05/02/2017
13DHCR7Ex4NM_001360.2:c.99-10G>ABenign01/10/2020 
14DHCR7Ex4NM_001360.2:c.99-5C>TLRG_340t1:c.99-5C>T, NM_001163817.1:c.99-5C>T, NM_001360.2:c.99-5C>TVOUS01/27/2021
15DHCR7Ex4NM_001360.2:c.99-4G>ANM_001163817.1:c.99-4G>A, NM_001360.2:c.99-4G>ABenign04/16/2013 
16DHCR7Ex4NM_001360.2:c.109T>Gp.Trp37Gly | p.W37GLRG_340t1:c.109T>G, NM_001163817.1:c.109T>G, NM_001360.2:c.109T>GVOUS08/16/2019
17DHCR7Ex4NM_001360.2:c.122C>Tp.Ala41Val | p.A41VLRG_340t1:c.122C>T, NM_001163817.1:c.122C>T, NM_001360.2:c.122C>TVOUS03/29/2016
18DHCR7Ex4NM_001360.2:c.123G>Ap.Ala41= | p.A41=LRG_340t1:c.123G>A, NM_001163817.1:c.123G>A, NM_001360.2:c.123G>AVOUS06/28/2019
19DHCR7Ex4NM_001360.2:c.126C>Tp.Ser42= | p.S42=LRG_340t1:c.126C>T, NM_001163817.1:c.126C>T, NM_001360.2:c.126C>TBenign08/28/2019 
20DHCR7Ex4NM_001360.2:c.127G>Ap.Val43Ile | p.V43ILRG_340t1:c.127G>A, NM_001163817.1:c.127G>A, NM_001360.2:c.127G>AVOUS07/13/2020
21DHCR7Ex4NM_001360.2:c.131T>Cp.Ile44Thr | p.I44TLRG_340t1:c.131T>C, NM_001163817.1:c.131T>C, NM_001360.2:c.131T>CVOUS12/30/2020
22DHCR7Ex4NM_001360.2:c.139C>Tp.Leu47= | p.L47=LRG_340t1:c.139C>T, NM_001163817.1:c.139C>T, NM_001360.2:c.139C>TVOUS01/16/2020
23DHCR7Ex4NM_001360.2:c.151C>Tp.Pro51Ser | p.P51SPathogenic03/18/2013 
24DHCR7Ex4NM_001360.2:c.159C>Tp.Ile53= | p.I53=LRG_340t1:c.159C>T, NM_001163817.1:c.159C>T, NM_001360.2:c.159C>TVOUS02/26/2021
25DHCR7Ex4NM_001360.2:c.160G>Ap.Val54Ile | p.V54ILRG_340t1:c.160G>A, NM_001163817.1:c.160G>A, NM_001360.2:c.160G>AVOUS07/03/2019
26DHCR7Ex4NM_001360.2:c.189G>Ap.Gln63= | p.Q63=LRG_340t1:c.189G>A, NM_001163817.1:c.189G>A, NM_001360.2:c.189G>ABenign06/06/2018 
27DHCR7Ex4NM_001360.2:c.198C>Tp.Cys66= | p.C66=LRG_340t1:c.198C>T, NM_001163817.1:c.198C>T, NM_001360.2:c.198C>TVOUS08/16/2016
28DHCR7Ex4NM_001360.2:c.199G>Ap.Ala67Thr | p.A67TLRG_340t1:c.199G>A, NM_001163817.1:c.199G>A, NM_001360.2:c.199G>AVOUS03/11/2021
29DHCR7Ex4NM_001360.2:c.207T>Cp.Thr69= | p.T69=LRG_340t1:c.207T>C, NM_001163817.1:c.207T>C, NM_001360.2:c.207T>CBenign06/06/2018 
30DHCR7Ex4NM_001360.2:c.208G>Ap.Gly70Ser | p.G70SLRG_340t1:c.208G>A, NM_001163817.1:c.208G>A, NM_001360.2:c.208G>ALikely benign07/28/2016 
31DHCR7Ex4NM_001360.2:c.220G>Ap.Asp74Asn | p.D74NLRG_340t1:c.220G>A, NM_001163817.1:c.220G>A, NM_001360.2:c.220G>AVOUS05/07/2020
32DHCR7Ex4NM_001360.2:c.222C>Gp.Asp74Glu | p.D74ELRG_340t1:c.222C>G, NM_001163817.1:c.222C>G, NM_001360.2:c.222C>GVOUS07/03/2019
33DHCR7Ex4NM_001360.2:c.223A>Tp.Ile75Phe | p.I75FLRG_340t1:c.223A>T, NM_001163817.1:c.223A>T, NM_001360.2:c.223A>TVOUS02/06/2019
34DHCR7Ex4NM_001360.2:c.226G>Ap.Val76Ile | p.V76ILRG_340t1:c.226G>A, NM_001163817.1:c.226G>A, NM_001360.2:c.226G>ABenign05/14/2019 
35DHCR7Ex4NM_001360.2:c.230C>Tp.Thr77Ile | p.T77IVOUS02/12/2021
36DHCR7Ex4NM_001360.2:c.231C>Tp.Thr77= | p.T77=LRG_340t1:c.231C>T, NM_001163817.1:c.231C>T, NM_001360.2:c.231C>TBenign05/14/2020 
37DHCR7Ex4NM_001360.2:c.232G>Ap.Gly78Arg | p.G78RLRG_340t1:c.232G>A, NM_001163817.1:c.232G>A, NM_001360.2:c.232G>AVOUS05/07/2019
38DHCR7Ex4NM_001360.2:c.233G>Ap.Gly78Glu | p.G78ELRG_340t1:c.233G>A, NM_001163817.1:c.233G>A, NM_001360.2:c.233G>AVOUS03/22/2018
39DHCR7Ex4NM_001360.2:c.241C>Tp.Arg81Trp | p.R81WLRG_340t1:c.241C>T, NM_001163817.1:c.241C>T, NM_001360.2:c.241C>TVOUS07/02/2019
40DHCR7Ex4NM_001360.2:c.242G>Ap.Arg81Gln | p.R81QLRG_340t1:c.242G>A, NM_001163817.1:c.242G>A, NM_001360.2:c.242G>AVOUS03/14/2019
41DHCR7Ex4NM_001360.2:c.248C>Tp.Ser83Leu | p.S83LLRG_340t1:c.248C>T, NM_001163817.1:c.248C>T, NM_001360.2:c.248C>TVOUS12/14/2020
42DHCR7Ex4NM_001360.2:c.278C>Tp.Thr93Met | p.T93MLRG_340t1:c.278C>T, NM_001163817.1:c.278C>T, NM_001360.2:c.278C>TPathogenic02/12/2019 
43DHCR7Ex4NM_001360.2:c.288C>Tp.Ala96= | p.A96=LRG_340t1:c.288C>T, NM_001163817.1:c.288C>T, NM_001360.2:c.288C>TVOUS05/02/2017
44DHCR7Ex4NM_001360.2:c.289G>Ap.Ala97Thr | p.A97TLRG_340t1:c.289G>A, NM_001163817.1:c.289G>A, NM_001360.2:c.289G>AVOUS11/19/2019
45DHCR7Ex4NM_001360.2:c.292C>Tp.Gln98* | p.Q98XLRG_340t1:c.292C>T, NM_001163817.1:c.292C>T, NM_001360.2:c.292C>TPathogenic06/19/2018 
46DHCR7Ex4NM_001360.2:c.318C>Tp.Phe106= | p.F106=LRG_340t1:c.318C>T, NM_001163817.1:c.318C>T, NM_001360.2:c.318C>TVOUS09/25/2017
47DHCR7Ex4NM_001360.2:c.321+10C>TNM_001163817.1:c.321+10C>T, NM_001360.2:c.321+10C>TBenign05/10/2013 
48DHCR7Ex5NM_001360.2:c.322-7G>ALRG_340t1:c.322-7G>A, NM_001163817.1:c.322-7G>A, NM_001360.2:c.322-7G>AVOUS01/30/2019
49DHCR7Ex5NM_001360.2:c.356A>Gp.His119Arg | p.H119RLRG_340t1:c.356A>G, NM_001163817.1:c.356A>G, NM_001360.2:c.356A>GVOUS10/09/2018
50DHCR7Ex5NM_001360.2:c.369C>Tp.Pro123= | p.P123=LRG_340t1:c.369C>T, NM_001163817.1:c.369C>T, NM_001360.2:c.369C>TVOUS07/03/2019
51DHCR7Ex5NM_001360.2:c.375C>Tp.Tyr125= | p.Y125=LRG_340t1:c.375C>T, NM_001163817.1:c.375C>T, NM_001360.2:c.375C>TVOUS05/28/2020
52DHCR7Ex5NM_001360.2:c.376G>Ap.Val126Ile | p.V126ILRG_340t1:c.376G>A, NM_001163817.1:c.376G>A, NM_001360.2:c.376G>AVOUS10/20/2020
53DHCR7Ex5NM_001360.2:c.385_412+5delATCCAGGAGGGGGCCGTGACTCCTGCAGGTAGCLRG_340t1:c.385_412+5delATCCAGGAGGGGGCCGTGACTCCTGCAGGTAGC, NM_001163817.1:c.385_412+5delATCCAGGAGGGGGCCGTGACTCCTGCAGGTAGC, NM_001360.2:c.385_412+5delATCCAGGAGGGGGCCGTGACTCCTGCAGGTAGCPathogenic07/23/2018 
54DHCR7Ex5NM_001360.2:c.399C>Tp.Ala133= | p.A133=LRG_340t1:c.399C>T, NM_001163817.1:c.399C>T, NM_001360.2:c.399C>TLikely benign12/05/2016 
55DHCR7Ex5NM_001360.2:c.400G>Tp.Val134Leu | p.V134LLRG_340t1:c.400G>T, NM_001163817.1:c.400G>T, NM_001360.2:c.400G>TVOUS10/07/2020
56DHCR7Ex5NM_001360.2:c.411A>Gp.Ala137= | p.A137=LRG_340t1:c.411A>G, NM_001163817.1:c.411A>G, NM_001360.2:c.411A>GVOUS12/13/2018
57DHCR7Ex5NM_001360.2:c.412+5C>TVOUS12/11/2019
58DHCR7Ex6NM_001360.2:c.431A>Gp.Gln144Arg | p.Q144RLRG_340t1:c.431A>G, NM_001163817.1:c.431A>G, NM_001360.2:c.431A>GVOUS11/11/2019
59DHCR7Ex6NM_001360.2:c.438T>Cp.Asn146= | p.N146=LRG_340t1:c.438T>C, NM_001163817.1:c.438T>C, NM_001360.2:c.438T>CBenign06/06/2018 
60DHCR7Ex6NM_001360.2:c.440G>Ap.Gly147Asp | p.G147DLRG_340t1:c.440G>A, NM_001163817.1:c.440G>A, NM_001360.2:c.440G>ALikely pathogenic07/24/2019 
61DHCR7Ex6NM_001360.2:c.452G>Ap.Trp151* | p.W151XLRG_340t1:c.452G>A, NM_001163817.1:c.452G>A, NM_001360.2:c.452G>APathogenic04/02/2021 
62DHCR7Ex6NM_001360.2:c.461C>Gp.Thr154Arg | p.T154RLRG_340t1:c.461C>G, NM_001163817.1:c.461C>G, NM_001360.2:c.461C>GPathogenic04/25/2020 
63DHCR7Ex6NM_001360.2:c.470T>Cp.Leu157Pro | p.L157PLRG_340t1:c.470T>C, NM_001163817.1:c.470T>C, NM_001360.2:c.470T>CPathogenic08/24/2020 
64DHCR7Ex6NM_001360.2:c.483C>Tp.Asn161= | p.N161=LRG_340t1:c.483C>T, NM_001163817.1:c.483C>T, NM_001360.2:c.483C>TVOUS06/29/2020
65DHCR7Ex6NM_001360.2:c.485C>Tp.Ala162Val | p.A162VLRG_340t1:c.485C>T, NM_001163817.1:c.485C>T, NM_001360.2:c.485C>TVOUS05/31/2019
66DHCR7Ex6NM_001360.2:c.506C>Tp.Ser169Leu | p.S169LLRG_340t1:c.506C>T, NM_001163817.1:c.506C>T, NM_001360.2:c.506C>TPathogenic05/28/2020 
67DHCR7Ex6NM_001360.2:c.520T>Gp.Phe174Val | p.F174VLRG_340t1:c.520T>G, NM_001163817.1:c.520T>G, NM_001360.2:c.520T>GVOUS06/19/2020
68DHCR7Ex6NM_001360.2:c.522C>Tp.Phe174= | p.F174=LRG_340t1:c.522C>T, NM_001163817.1:c.522C>T, NM_001360.2:c.522C>TVOUS12/29/2020
69DHCR7Ex6NM_001360.2:c.543G>Cp.Leu181= | p.L181=LRG_340t1:c.543G>C, NM_001163817.1:c.543G>C, NM_001360.2:c.543G>CVOUS06/18/2020
70DHCR7Ex6NM_001360.2:c.552C>Gp.Ala184= | p.A184=LRG_340t1:c.552C>G, NM_001163817.1:c.552C>G, NM_001360.2:c.552C>GVOUS12/13/2018
71DHCR7Ex6NM_001360.2:c.571G>Ap.Val191Ile | p.V191ILRG_340t1:c.571G>A, NM_001163817.1:c.571G>A, NM_001360.2:c.571G>AVOUS12/21/2017
72DHCR7Ex6NM_001360.2:c.582C>Tp.Phe194= | p.F194=LRG_340t1:c.582C>T, NM_001163817.1:c.582C>T, NM_001360.2:c.582C>TVOUS01/12/2021
73DHCR7Ex6NM_001360.2:c.586A>Gp.Met196Val | p.M196VLRG_340t1:c.586A>G, NM_001163817.1:c.586A>G, NM_001360.2:c.586A>GVOUS09/11/2020
74DHCR7Ex6NM_001360.2:c.615C>Tp.Ser205= | p.S205=LRG_340t1:c.615C>T, NM_001163817.1:c.615C>T, NM_001360.2:c.615C>TVOUS12/08/2017
75DHCR7Ex6NM_001360.2:c.626+15G>ALRG_340t1:c.626+15G>A, NM_001163817.1:c.626+15G>A, NM_001360.2:c.626+15G>ABenign06/06/2018 
76DHCR7Ex7NM_001360.2:c.627-9A>GVOUS02/01/2021
77DHCR7Ex7NM_001360.2:c.658A>Gp.Met220Val | p.M220VLRG_340t1:c.658A>G, NM_001163817.1:c.658A>G, NM_001360.2:c.658A>GVOUS09/09/2019
78DHCR7Ex7NM_001360.2:c.658A>Tp.Met220Leu | p.M220LLRG_340t1:c.658A>T, NM_001163817.1:c.658A>T, NM_001360.2:c.658A>TVOUS05/18/2017
79DHCR7Ex7NM_001360.2:c.658A>Cp.Met220Leu | p.M220LLRG_340t1:c.658A>C, NM_001163817.1:c.658A>C, NM_001360.2:c.658A>CVOUS08/23/2016
80DHCR7Ex7NM_001360.2:c.670G>Ap.Glu224Lys | p.E224KLRG_340t1:c.670G>A, NM_001163817.1:c.670G>A, NM_001360.2:c.670G>AVOUS01/18/2017
81DHCR7Ex7NM_001360.2:c.676A>Gp.Asn226Asp | p.N226DLRG_340t1:c.676A>G, NM_001163817.1:c.676A>G, NM_001360.2:c.676A>GVOUS01/21/2021
82DHCR7Ex7NM_001360.2:c.682C>Tp.Arg228Trp | p.R228WLRG_340t1:c.682C>T, NM_001163817.1:c.682C>T, NM_001360.2:c.682C>TLikely pathogenic10/12/2020 
83DHCR7Ex7NM_001360.2:c.687C>Tp.Ile229= | p.I229=LRG_340t1:c.687C>T, NM_001163817.1:c.687C>T, NM_001360.2:c.687C>TVOUS12/02/2020
84DHCR7Ex7NM_001360.2:c.709C>Tp.Leu237= | p.L237=LRG_340t1:c.709C>T, NM_001163817.1:c.709C>T, NM_001360.2:c.709C>TVOUS05/22/2018
85DHCR7Ex7NM_001360.2:c.719A>Gp.Asn240Ser | p.N240SLRG_340t1:c.719A>G, NM_001163817.1:c.719A>G, NM_001360.2:c.719A>GVOUS01/01/2021
86DHCR7Ex7NM_001360.2:c.723G>Tp.Gly241= | p.G241=LRG_340t1:c.723G>T, NM_001163817.1:c.723G>T, NM_001360.2:c.723G>TVOUS11/15/2019
87DHCR7Ex7NM_001360.2:c.724C>Tp.Arg242Cys | p.R242CLRG_340t1:c.724C>T, NM_001163817.1:c.724C>T, NM_001360.2:c.724C>TPathogenic01/20/2021 
88DHCR7Ex7NM_001360.2:c.729C>Tp.Pro243= | p.P243=LRG_340t1:c.729C>T, NM_001163817.1:c.729C>T, NM_001360.2:c.729C>TVOUS08/15/2019
89DHCR7Ex7NM_001360.2:c.740C>Tp.Ala247Val | p.A247VLRG_340t1:c.740C>T, NM_001163817.1:c.740C>T, NM_001360.2:c.740C>TPathogenic12/22/2020 
90DHCR7Ex7NM_001360.2:c.742T>Cp.Trp248Arg | p.W248RLRG_340t1:c.742T>C, NM_001163817.1:c.742T>C, NM_001360.2:c.742T>CVOUS08/24/2016
91DHCR7Ex7NM_001360.2:c.765C>Tp.Phe255= | p.F255=LRG_340t1:c.765C>T, NM_001163817.1:c.765C>T, NM_001360.2:c.765C>TVOUS10/01/2019
92DHCR7Ex7NM_001360.2:c.768A>Gp.Ala256= | p.A256=LRG_340t1:c.768A>G, NM_001163817.1:c.768A>G, NM_001360.2:c.768A>GVOUS03/19/2020
93DHCR7Ex7NM_001360.2:c.771G>Ap.Ala257= | p.A257=LRG_340t1:c.771G>A, NM_001163817.1:c.771G>A, NM_001360.2:c.771G>AVOUS08/23/2017
94DHCR7Ex7NM_001360.2:c.778C>Gp.Arg260Gly | p.R260GNM_001163817.1:c.778C>G, NM_001360.2:c.778C>GVOUS07/07/2015
95DHCR7Ex7NM_001360.2:c.779G>Ap.Arg260Gln | p.R260QLRG_340t1:c.779G>A, NM_001163817.1:c.779G>A, NM_001360.2:c.779G>AVOUS12/04/2020
96DHCR7Ex7NM_001360.2:c.795T>Cp.His265= | p.H265=LRG_340t1:c.795T>C, NM_001163817.1:c.795T>C, NM_001360.2:c.795T>CVOUS11/22/2017
97DHCR7Ex7NM_001360.2:c.823G>Ap.Val275Ile | p.V275ILRG_340t1:c.823G>A, NM_001163817.1:c.823G>A, NM_001360.2:c.823G>AVOUS09/24/2018
98DHCR7Ex7NM_001360.2:c.831+7G>ALRG_340t1:c.831+7G>A, NM_001163817.1:c.831+7G>A, NM_001360.2:c.831+7G>AVOUS06/29/2018
99DHCR7Ex8NM_001360.2:c.840C>Tp.Tyr280= | p.Y280=LRG_340t1:c.840C>T, NM_001163817.1:c.840C>T, NM_001360.2:c.840C>TVOUS08/09/2016
100DHCR7Ex8NM_001360.2:c.841G>Ap.Val281Met | p.V281MLRG_340t1:c.841G>A, NM_001163817.1:c.841G>A, NM_001360.2:c.841G>APathogenic03/18/2021 
101DHCR7Ex8NM_001360.2:c.855C>Tp.Phe285= | p.F285=LRG_340t1:c.855C>T, NM_001163817.1:c.855C>T, NM_001360.2:c.855C>TVOUS10/22/2020
102DHCR7Ex8NM_001360.2:c.862G>Ap.Glu288Lys | p.E288KLRG_340t1:c.862G>A, NM_001163817.1:c.862G>A, NM_001360.2:c.862G>AVOUS03/07/2017
103DHCR7Ex8NM_001360.2:c.882C>Tp.Thr294= | p.T294=LRG_340t1:c.882C>T, NM_001163817.1:c.882C>T, NM_001360.2:c.882C>TVOUS02/22/2019
104DHCR7Ex8NM_001360.2:c.902A>Gp.His301Arg | p.H301RLRG_340t1:c.902A>G, NM_001163817.1:c.902A>G, NM_001360.2:c.902A>GPathogenic11/29/2017 
105DHCR7Ex8NM_001360.2:c.906C>Tp.Phe302= | p.F302=LRG_340t1:c.906C>T, NM_001163817.1:c.906C>T, NM_001360.2:c.906C>TVOUS05/06/2020
106DHCR7Ex8NM_001360.2:c.907G>Ap.Gly303Arg | p.G303RLRG_340t1:c.907G>A, NM_001163817.1:c.907G>A, NM_001360.2:c.907G>APathogenic03/10/2021 
107DHCR7Ex8NM_001360.2:c.925G>Tp.Gly309Cys | p.G309CVOUS12/19/2019
108DHCR7Ex8NM_001360.2:c.927C>Ap.Gly309= | p.G309=LRG_340t1:c.927C>A, NM_001163817.1:c.927C>A, NM_001360.2:c.927C>AVOUS10/03/2019
109DHCR7Ex8NM_001360.2:c.931T>Gp.Cys311Gly | p.C311GLRG_340t1:c.931T>G, NM_001163817.1:c.931T>G, NM_001360.2:c.931T>GVOUS08/10/2020
110DHCR7Ex8NM_001360.2:c.947A>Gp.Tyr316Cys | p.Y316CLRG_340t1:c.947A>G, NM_001163817.1:c.947A>G, NM_001360.2:c.947A>GVOUS09/15/2017
111DHCR7Ex8NM_001360.2:c.957G>Ap.Thr319= | p.T319=LRG_340t1:c.957G>A, NM_001163817.1:c.957G>A, NM_001360.2:c.957G>AVOUS08/08/2017
112DHCR7Ex8NM_001360.2:c.963+7A>GLRG_340t1:c.963+7A>G, NM_001163817.1:c.963+7A>G, NM_001360.2:c.963+7A>GVOUS05/03/2018
113DHCR7Ex9NM_001360.2:c.*6C>TVOUS06/26/2020
114DHCR7Ex9NM_001360.2:c.964-5C>TVOUS04/24/2020
115DHCR7Ex9NM_001360.2:c.964-1G>CLRG_340t1:c.964-1G>C, NM_001163817.1:c.964-1G>C, NM_001360.2:c.964-1G>CPathogenic12/28/2020 
116DHCR7Ex9NM_001360.2:c.964-1G>TPathogenic11/19/2019 
117DHCR7Ex9NM_001360.2:c.976G>Tp.Val326Leu | p.V326LLRG_340t1:c.976G>T, NM_001163817.1:c.976G>T, NM_001360.2:c.976G>TPathogenic09/17/2020 
118DHCR7Ex9NM_001360.2:c.987C>Tp.Pro329= | p.P329=LRG_340t1:c.987C>T, NM_001163817.1:c.987C>T, NM_001360.2:c.987C>TBenign04/18/2019 
119DHCR7Ex9NM_001360.2:c.988G>Ap.Val330Met | p.V330MLRG_340t1:c.988G>A, NM_001163817.1:c.988G>A, NM_001360.2:c.988G>AVOUS12/31/2020
120DHCR7Ex9NM_001360.2:c.1005G>Ap.Pro335= | p.P335=LRG_340t1:c.1005G>A, NM_001163817.1:c.1005G>A, NM_001360.2:c.1005G>AVOUS07/07/2017
121DHCR7Ex9NM_001360.2:c.1008C>Tp.His336= | p.H336=Benign02/14/2014 
122DHCR7Ex9NM_001360.2:c.1011C>Tp.Ala337= | p.A337=LRG_340t1:c.1011C>T, NM_001163817.1:c.1011C>T, NM_001360.2:c.1011C>TVOUS07/18/2018
123DHCR7Ex9NM_001360.2:c.1012G>Ap.Val338Met | p.V338MLRG_340t1:c.1012G>A, NM_001163817.1:c.1012G>A, NM_001360.2:c.1012G>ALikely benign02/19/2018 
124DHCR7Ex9NM_001360.2:c.1017C>Tp.Gly339= | p.G339=LRG_340t1:c.1017C>T, NM_001163817.1:c.1017C>T, NM_001360.2:c.1017C>TVOUS01/10/2020
125DHCR7Ex9NM_001360.2:c.1018G>Ap.Val340Ile | p.V340ILRG_340t1:c.1018G>A, NM_001163817.1:c.1018G>A, NM_001360.2:c.1018G>ALikely benign03/20/2020 
126DHCR7Ex9NM_001360.2:c.1054C>Tp.Arg352Trp | p.R352WLRG_340t1:c.1054C>T, NM_001163817.1:c.1054C>T, NM_001360.2:c.1054C>TPathogenic01/19/2017 
127DHCR7Ex9NM_001360.2:c.1055G>Ap.Arg352Gln | p.R352QLRG_340t1:c.1055G>A, NM_001163817.1:c.1055G>A, NM_001360.2:c.1055G>APathogenic07/31/2015 
128DHCR7Ex9NM_001360.2:c.1066delCp.His356Thrfs*57 | p.H356TfsX57LRG_340t1:c.1066delC, NM_001163817.1:c.1066delC, NM_001360.2:c.1066delCLikely pathogenic04/17/2019 
129DHCR7Ex9NM_001360.2:c.1076_1077dupACp.Leu360Thrfs*54 | p.L360TfsX54LRG_340t1:c.1076_1077dupAC, NM_001163817.1:c.1076_1077dupAC, NM_001360.2:c.1076_1077dupACPathogenic09/06/2019 
130DHCR7Ex9NM_001360.2:c.1087C>Tp.Arg363Cys | p.R363CLRG_340t1:c.1087C>T, NM_001163817.1:c.1087C>T, NM_001360.2:c.1087C>TVOUS07/06/2018
131DHCR7Ex9NM_001360.2:c.1091C>Tp.Thr364Met | p.T364MLRG_340t1:c.1091C>T, NM_001163817.1:c.1091C>T, NM_001360.2:c.1091C>TVOUS03/25/2020
132DHCR7Ex9NM_001360.2:c.1092G>Ap.Thr364= | p.T364=LRG_340t1:c.1092G>A, NM_001163817.1:c.1092G>A, NM_001360.2:c.1092G>ABenign02/07/2014 
133DHCR7Ex9NM_001360.2:c.1093G>Tp.Asp365Tyr | p.D365YLRG_340t1:c.1093G>T, NM_001163817.1:c.1093G>T, NM_001360.2:c.1093G>TVOUS07/17/2019
134DHCR7Ex9NM_001360.2:c.1099C>Tp.Arg367Cys | p.R367CLRG_340t1:c.1099C>T, NM_001163817.1:c.1099C>T, NM_001360.2:c.1099C>TVOUS06/18/2020
135DHCR7Ex9NM_001360.2:c.1138T>Cp.Cys380Arg | p.C380RLRG_340t1:c.1138T>C, NM_001163817.1:c.1138T>C, NM_001360.2:c.1138T>CLikely pathogenic03/30/2018 
136DHCR7Ex9NM_001360.2:c.1148C>Tp.Thr383Ile | p.T383ILRG_340t1:c.1148C>T, NM_001163817.1:c.1148C>T, NM_001360.2:c.1148C>TVOUS02/07/2020
137DHCR7Ex9NM_001360.2:c.1152C>Tp.Ser384= | p.S384=LRG_340t1:c.1152C>T, NM_001163817.1:c.1152C>T, NM_001360.2:c.1152C>TVOUS10/22/2019
138DHCR7Ex9NM_001360.2:c.1153G>Ap.Ala385Thr | p.A385TLRG_340t1:c.1153G>A, NM_001163817.1:c.1153G>A, NM_001360.2:c.1153G>AVOUS10/10/2019
139DHCR7Ex9NM_001360.2:c.1155C>Tp.Ala385= | p.A385=LRG_340t1:c.1155C>T, NM_001163817.1:c.1155C>T, NM_001360.2:c.1155C>TVOUS11/06/2017
140DHCR7Ex9NM_001360.2:c.1156G>Ap.Asp386Asn | p.D386NLRG_340t1:c.1156G>A, NM_001163817.1:c.1156G>A, NM_001360.2:c.1156G>AVOUS04/23/2020
141DHCR7Ex9NM_001360.2:c.1156_1158delGATinsAACp.Asp386Asn | p.D386NLRG_340t1:c.1156_1158delinsATC, NM_001163817.1:c.1156_1158delinsATC, NM_001360.2:c.1156_1158delinsATCVOUS04/27/2020
142DHCR7Ex9NM_001360.2:c.1158T>Cp.Asp386= | p.D386=LRG_340t1:c.1158T>C, NM_001163817.1:c.1158T>C, NM_001360.2:c.1158T>CBenign06/06/2018 
143DHCR7Ex9NM_001360.2:c.1159G>Ap.Gly387Arg | p.G387RLRG_340t1:c.1159G>A, NM_001163817.1:c.1159G>A, NM_001360.2:c.1159G>AVOUS01/14/2021
144DHCR7Ex9NM_001360.2:c.1168C>Tp.His390Tyr | p.H390YLRG_340t1:c.1168C>T, NM_001163817.1:c.1168C>T, NM_001360.2:c.1168C>TVOUS11/17/2020
145DHCR7Ex9NM_001360.2:c.1191G>Ap.Ser397= | p.S397=LRG_340t1:c.1191G>A, NM_001163817.1:c.1191G>A, NM_001360.2:c.1191G>AVOUS07/20/2020
146DHCR7Ex9NM_001360.2:c.1203C>Tp.Gly401= | p.G401=LRG_340t1:c.1203C>T, NM_001163817.1:c.1203C>T, NM_001360.2:c.1203C>TVOUS04/06/2018
147DHCR7Ex9NM_001360.2:c.1210C>Tp.Arg404Cys | p.R404CLRG_340t1:c.1210C>T, NM_001163817.1:c.1210C>T, NM_001360.2:c.1210C>TPathogenic04/09/2020 
148DHCR7Ex9NM_001360.2:c.1218C>Gp.Phe406Leu | p.F406LLRG_340t1:c.1218C>G, NM_001163817.1:c.1218C>G, NM_001360.2:c.1218C>GVOUS04/09/2019
149DHCR7Ex9NM_001360.2:c.1220A>Gp.Asn407Ser | p.N407SLRG_340t1:c.1220A>G, NM_001163817.1:c.1220A>G, NM_001360.2:c.1220A>GLikely pathogenic11/19/2020 
150DHCR7Ex9NM_001360.2:c.1222T>Cp.Tyr408His | p.Y408HLRG_340t1:c.1222T>C, NM_001163817.1:c.1222T>C, NM_001360.2:c.1222T>CLikely pathogenic06/04/2019 
151DHCR7Ex9NM_001360.2:c.1225G>Ap.Val409Ile | p.V409ILRG_340t1:c.1225G>A, NM_001163817.1:c.1225G>A, NM_001360.2:c.1225G>AVOUS02/20/2017
152DHCR7Ex9NM_001360.2:c.1228G>Ap.Gly410Ser | p.G410SLRG_340t1:c.1228G>A, NM_001163817.1:c.1228G>A, NM_001360.2:c.1228G>APathogenic06/27/2019 
153DHCR7Ex9NM_001360.2:c.1269C>Tp.Gly423= | p.G423=LRG_340t1:c.1269C>T, NM_001163817.1:c.1269C>T, NM_001360.2:c.1269C>TVOUS11/25/2020
154DHCR7Ex9NM_001360.2:c.1270_1272delGGCinsAGTp.Gly424Ser | p.G424SLRG_340t1:c.1270_1272delinsAGT, NM_001163817.1:c.1270_1272delinsAGT, NM_001360.2:c.1270_1272delinsAGTVOUS02/14/2019
155DHCR7Ex9NM_001360.2:c.1270G>Ap.Gly424Ser | p.G424SLRG_340t1:c.1270G>A, NM_001163817.1:c.1270G>A, NM_001360.2:c.1270G>AVOUS03/04/2015
156DHCR7Ex9NM_001360.2:c.1272C>Tp.Gly424= | p.G424=LRG_340t1:c.1272C>T, NM_001163817.1:c.1272C>T, NM_001360.2:c.1272C>TBenign06/06/2018 
157DHCR7Ex9NM_001360.2:c.1273G>Ap.Gly425Ser | p.G425SLRG_340t1:c.1273G>A, NM_001163817.1:c.1273G>A, NM_001360.2:c.1273G>AVOUS12/03/2019
158DHCR7Ex9NM_001360.2:c.1318C>Gp.Leu440Val | p.L440VLRG_340t1:c.1318C>G, NM_001163817.1:c.1318C>G, NM_001360.2:c.1318C>GVOUS07/14/2019
159DHCR7Ex9NM_001360.2:c.1337G>Ap.Arg446Gln | p.R446QLRG_340t1:c.1337G>A, NM_001163817.1:c.1337G>A, NM_001360.2:c.1337G>APathogenic06/30/2017 
160DHCR7Ex9NM_001360.2:c.1341C>Tp.Asp447= | p.D447=NM_001163817.1:c.1341C>T, NM_001360.2:c.1341C>TBenign04/16/2013 
161DHCR7Ex9NM_001360.2:c.1342G>Ap.Glu448Lys | p.E448KLRG_340t1:c.1342G>A, NM_001163817.1:c.1342G>A, NM_001360.2:c.1342G>APathogenic06/21/2019 
162DHCR7Ex9NM_001360.2:c.1342G>Cp.Glu448Gln | p.E448QLRG_340t1:c.1342G>C, NM_001163817.1:c.1342G>C, NM_001360.2:c.1342G>CVOUS07/30/2020
163DHCR7Ex9NM_001360.2:c.1348delCp.Arg450Alafs*31 | p.R450AfsX31LRG_340t1:c.1348delC, NM_001163817.1:c.1348delC, NM_001360.2:c.1348delCLikely pathogenic04/30/2020 
164DHCR7Ex9NM_001360.2:c.1349G>Ap.Arg450His | p.R450HLRG_340t1:c.1349G>A, NM_001163817.1:c.1349G>A, NM_001360.2:c.1349G>AVOUS01/08/2020
165DHCR7Ex9NM_001360.2:c.1357A>Gp.Ser453Gly | p.S453GLRG_340t1:c.1357A>G, NM_001163817.1:c.1357A>G, NM_001360.2:c.1357A>GVOUS12/27/2018
166DHCR7Ex9NM_001360.2:c.1362G>Ap.Lys454= | p.K454=LRG_340t1:c.1362G>A, NM_001163817.1:c.1362G>A, NM_001360.2:c.1362G>AVOUS10/26/2020
167DHCR7Ex9NM_001360.2:c.1365C>Tp.Tyr455= | p.Y455=LRG_340t1:c.1365C>T, NM_001163817.1:c.1365C>T, NM_001360.2:c.1365C>TVOUS03/06/2019
168DHCR7Ex9NM_001360.2:c.1366G>Ap.Gly456Ser | p.G456SLRG_340t1:c.1366G>A, NM_001163817.1:c.1366G>A, NM_001360.2:c.1366G>AVOUS01/15/2020
169DHCR7Ex9NM_001360.2:c.1368C>Tp.Gly456= | p.G456=LRG_340t1:c.1368C>T, NM_001163817.1:c.1368C>T, NM_001360.2:c.1368C>TVOUS08/18/2020
170DHCR7Ex9NM_001360.2:c.1370G>Ap.Arg457Gln | p.R457QNM_001163817.1:c.1370G>A, NM_001360.2:c.1370G>AVOUS01/12/2016
171DHCR7Ex9NM_001360.2:c.1381C>Tp.Arg461Cys | p.R461CLRG_340t1:c.1381C>T, NM_001163817.1:c.1381C>T, NM_001360.2:c.1381C>TVOUS01/20/2021
172DHCR7Ex9NM_001360.2:c.1384T>Cp.Tyr462His | p.Y462HLRG_340t1:c.1384T>C, NM_001163817.1:c.1384T>C, NM_001360.2:c.1384T>CPathogenic01/11/2019 
173DHCR7Ex9NM_001360.2:c.1406G>Ap.Arg469His | p.R469HLRG_340t1:c.1406G>A, NM_001163817.1:c.1406G>A, NM_001360.2:c.1406G>AVOUS04/12/2018
174DHCR7Ex9NM_001360.2:c.1410G>Ap.Leu470= | p.L470=LRG_340t1:c.1410G>A, NM_001163817.1:c.1410G>A, NM_001360.2:c.1410G>AVOUS11/02/2020

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.