Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CYP27A1Ex1NM_000784.3:c.2T>Cp.Met1? | p.M1?NM_000784.3:c.2T>CVOUS05/10/2019
2CYP27A1Ex1NM_000784.3:c.-6C>TNM_000784.3:c.-6C>TBenign01/05/2015 
3CYP27A1Ex1NM_000784.3:c.11_20dupTGGGCTGCGCp.Arg8Glyfs*176 | p.R8GfsX176NM_000784.3:c.11_20dupTGGGCTGCGC, NM_000784.3:c.20_21insTGGGCTGCGCPathogenic12/27/2016 
4CYP27A1Ex1NM_000784.3:c.36G>Tp.Ala12= | p.A12=NM_000784.3:c.36G>TVOUS01/21/2021
5CYP27A1Ex1NM_000784.3:c.52C>Tp.Arg18Cys | p.R18CNM_000784.3:c.52C>TVOUS12/21/2020
6CYP27A1Ex1NM_000784.3:c.63C>Gp.Cys21Trp | p.C21WNM_000784.3:c.63C>GVOUS11/02/2017
7CYP27A1Ex1NM_000784.3:c.83A>Cp.Lys28Thr | p.K28TNM_000784.3:c.83A>CVOUS04/22/2020
8CYP27A1Ex1NM_000784.3:c.110C>Tp.Ser37Leu | p.S37LNM_000784.3:c.110C>TVOUS09/07/2018
9CYP27A1Ex1NM_000784.3:c.113A>Tp.Asp38Val | p.D38VNM_000784.3:c.113A>TVOUS01/20/2020
10CYP27A1Ex1NM_000784.3:c.120C>Tp.Ala40= | p.A40=NM_000784.3:c.120C>TVOUS05/19/2020
11CYP27A1Ex1NM_000784.3:c.126A>Gp.Gly42= | p.G42=NM_000784.3:c.126A>GVOUS05/02/2017
12CYP27A1Ex1NM_000784.3:c.132C>Tp.Pro44= | p.P44=NM_000784.3:c.132C>TVOUS11/01/2017
13CYP27A1Ex1NM_000784.3:c.148G>Ap.Val50Ile | p.V50INM_000784.3:c.148G>AVOUS11/07/2018
14CYP27A1Ex1NM_000784.3:c.151C>Tp.Arg51Trp | p.R51WNM_000784.3:c.151C>TVOUS01/26/2021
15CYP27A1Ex1NM_000784.3:c.158G>Tp.Arg53Leu | p.R53LNM_000784.3:c.158G>TVOUS03/01/2021
16CYP27A1Ex1NM_000784.3:c.207_209delCTTp.Phe70del | p.F70delNM_000784.3:c.207_209delCTTVOUS12/11/2020
17CYP27A1Ex1NM_000784.3:c.215T>Ap.Leu72Gln | p.L72QNM_000784.3:c.215T>AVOUS02/15/2021
18CYP27A1Ex1NM_000784.3:c.241C>Ap.Leu81Met | p.L81MNM_000784.3:c.241C>AVOUS04/28/2016
19CYP27A1Ex1NM_000784.3:c.243G>Ap.Leu81= | p.L81=NM_000784.3:c.243G>ABenign01/05/2015 
20CYP27A1Ex1NM_000784.3:c.248A>Cp.Gln83Pro | p.Q83PNM_000784.3:c.248A>CVOUS05/08/2017
21CYP27A1Ex1NM_000784.3:c.-434-2T>CBenign07/22/2019 
22CYP27A1Ex2NM_000784.3:c.256-3C>TNM_000784.3:c.256-3C>TVOUS05/01/2018
23CYP27A1Ex2NM_000784.3:c.256-2A>GNM_000784.3:c.256-2A>GPathogenic07/24/2018 
24CYP27A1Ex2NM_000784.3:c.256-1G>TNM_000784.3:c.256-1G>TPathogenic08/29/2017 
25CYP27A1Ex2NM_000784.3:c.256G>Ap.Val86Met | p.V86MNM_000784.3:c.256G>ABenign11/08/2019 
26CYP27A1Ex2NM_000784.3:c.276C>Tp.Tyr92= | p.Y92=NM_000784.3:c.276C>TVOUS08/28/2019
27CYP27A1Ex2NM_000784.3:c.283A>Gp.Met95Val | p.M95VNM_000784.3:c.283A>GVOUS11/15/2019
28CYP27A1Ex2NM_000784.3:c.315C>Tp.His105= | p.H105=NM_000784.3:c.315C>TVOUS02/22/2017
29CYP27A1Ex2NM_000784.3:c.317T>Cp.Val106Ala | p.V106ANM_000784.3:c.317T>CVOUS10/26/2018
30CYP27A1Ex2NM_000784.3:c.355C>Tp.Arg119Trp | p.R119WNM_000784.3:c.355C>TVOUS03/18/2021
31CYP27A1Ex2NM_000784.3:c.355delCp.Arg119Glyfs*24 | p.R119GfsX24NM_000784.3:c.355delCPathogenic05/28/2020 
32CYP27A1Ex2NM_000784.3:c.371A>Tp.Tyr124Phe | p.Y124FNM_000784.3:c.371A>TVOUS12/27/2018
33CYP27A1Ex2NM_000784.3:c.373C>Gp.Pro125Ala | p.P125ANM_000784.3:c.373C>GVOUS04/09/2020
34CYP27A1Ex2NM_000784.3:c.379C>Tp.Arg127Trp | p.R127WNM_000784.3:c.379C>TPathogenic02/09/2021 
35CYP27A1Ex2NM_000784.3:c.380G>Ap.Arg127Gln | p.R127QNM_000784.3:c.380G>ALikely pathogenic12/08/2020 
36CYP27A1Ex2NM_000784.3:c.384C>Tp.Asn128= | p.N128=NM_000784.3:c.384C>TVOUS10/23/2020
37CYP27A1Ex2NM_000784.3:c.388A>Gp.Met130Val | p.M130VNM_000784.3:c.388A>GVOUS07/23/2019
38CYP27A1Ex2NM_000784.3:c.389T>Ap.Met130Lys | p.M130KNM_000784.3:c.389T>AVOUS12/07/2020
39CYP27A1Ex2NM_000784.3:c.409C>Tp.Arg137Trp | p.R137WNM_000784.3:c.409C>TPathogenic05/03/2019 
40CYP27A1Ex2NM_000784.3:c.410G>Ap.Arg137Gln | p.R137QNM_000784.3:c.410G>APathogenic01/20/2020 
41CYP27A1Ex2NM_000784.3:c.416A>Gp.Gln139Arg | p.Q139RNM_000784.3:c.416A>GVOUS07/17/2019
42CYP27A1Ex2NM_000784.3:c.420C>Ap.His140Gln | p.H140QNM_000784.3:c.420C>AVOUS05/23/2019
43CYP27A1Ex2NM_000784.3:c.420C>Tp.His140= | p.H140=NM_000784.3:c.420C>TVOUS02/20/2017
44CYP27A1Ex2NM_000784.3:c.425T>Cp.Leu142Pro | p.L142PNM_000784.3:c.425T>CVOUS01/11/2019
45CYP27A1Ex2NM_000784.3:c.434G>Ap.Gly145Glu | p.G145ENM_000784.3:c.434G>AVOUS11/12/2019
46CYP27A1Ex2NM_000784.3:c.435G>Ap.Gly145= | p.G145=NM_000784.3:c.435G>AVOUS01/14/2020
47CYP27A1Ex2NM_000784.3:c.443C>Gp.Thr148Ser | p.T148SNM_000784.3:c.443C>GVOUS01/23/2017
48CYP27A1Ex2NM_000784.3:c.446+1G>ANM_000784.3:c.446+1G>APathogenic05/10/2018 
49CYP27A1Ex2NM_000784.3:c.446+1G>TNM_000784.3:c.446+1G>TPathogenic03/26/2018 
50CYP27A1Ex3NM_000784.3:c.472C>Tp.Arg158Cys | p.R158CNM_000784.3:c.472C>TVOUS10/09/2018
51CYP27A1Ex3NM_000784.3:c.475C>Tp.Gln159* | p.Q159XNM_000784.3:c.475C>TPathogenic04/05/2018 
52CYP27A1Ex3NM_000784.3:c.490C>Tp.Arg164Trp | p.R164WNM_000784.3:c.490C>TVOUS08/23/2017
53CYP27A1Ex3NM_000784.3:c.491G>Cp.Arg164Pro | p.R164PNM_000784.3:c.491G>CVOUS10/02/2020
54CYP27A1Ex3NM_000784.3:c.491G>Ap.Arg164Gln | p.R164QNM_000784.3:c.491G>AVOUS02/01/2021
55CYP27A1Ex3NM_000784.3:c.501G>Ap.Lys167= | p.K167=NM_000784.3:c.501G>AVOUS05/06/2019
56CYP27A1Ex3NM_000784.3:c.504A>Tp.Pro168= | p.P168=NM_000784.3:c.504A>TLikely benign10/09/2018 
57CYP27A1Ex3NM_000784.3:c.515C>Tp.Ala172Val | p.A172VNM_000784.3:c.515C>TVOUS06/15/2017
58CYP27A1Ex3NM_000784.3:c.525G>Ap.Thr175= | p.T175=NM_000784.3:c.525G>AVOUS12/06/2020
59CYP27A1Ex3NM_000784.3:c.527A>Gp.Asp176Gly | p.D176GNM_000784.3:c.527A>GVOUS06/29/2018
60CYP27A1Ex3NM_000784.3:c.536A>Gp.Asn179Ser | p.N179SNM_000784.3:c.536A>GVOUS05/03/2016
61CYP27A1Ex3NM_000784.3:c.540G>Ap.Glu180= | p.E180=NM_000784.3:c.540G>AVOUS10/17/2019
62CYP27A1Ex3NM_000784.3:c.546T>Gp.Ile182Met | p.I182MNM_000784.3:c.546T>GVOUS10/03/2019
63CYP27A1Ex3NM_000784.3:c.547G>Ap.Asp183Asn | p.D183NNM_000784.3:c.547G>AVOUS01/15/2020
64CYP27A1Ex3NM_000784.3:c.562C>Tp.Arg188* | p.R188XNM_000784.3:c.562C>TPathogenic07/03/2019 
65CYP27A1Ex3NM_000784.3:c.578G>Ap.Arg193Gln | p.R193QNM_000784.3:c.578G>ABenign06/03/2016 
66CYP27A1Ex3NM_000784.3:c.609G>Ap.Ser203= | p.S203=NM_000784.3:c.609G>AVOUS08/18/2020
67CYP27A1Ex3NM_000784.3:c.613A>Gp.Met205Val | p.M205VNM_000784.3:c.613A>GVOUS04/09/2020
68CYP27A1Ex3NM_000784.3:c.624C>Tp.Leu208= | p.L208=NM_000784.3:c.624C>TVOUS10/07/2016
69CYP27A1Ex3NM_000784.3:c.646G>Cp.Ala216Pro | p.A216PNM_000784.3:c.646G>CPathogenic10/08/2019 
70CYP27A1Ex3NM_000784.3:c.646+4C>TNM_000784.3:c.646+4C>TVOUS03/10/2020
71CYP27A1Ex4NM_000784.3:c.649A>Cp.Ile217Leu | p.I217LNM_000784.3:c.649A>CVOUS12/02/2020
72CYP27A1Ex4NM_000784.3:c.654delCp.Tyr219Thrfs*20 | p.Y219TfsX20NM_000784.3:c.654delCPathogenic06/19/2019 
73CYP27A1Ex4NM_000784.3:c.666_678delCGAGAAACGCATTp.Phe222Leufs*13 | p.F222LfsX13NM_000784.3:c.666_678delCGAGAAACGCATTPathogenic01/30/2019 
74CYP27A1Ex4NM_000784.3:c.681C>Tp.Gly227= | p.G227=NM_000784.3:c.681C>TVOUS02/02/2021
75CYP27A1Ex4NM_000784.3:c.682T>Cp.Cys228Arg | p.C228RNM_000784.3:c.682T>CVOUS05/19/2020
76CYP27A1Ex4NM_000784.3:c.692G>Ap.Arg231Gln | p.R231QNM_000784.3:c.692G>AVOUS07/08/2020
77CYP27A1Ex4NM_000784.3:c.693A>Tp.Arg231= | p.R231=NM_000784.3:c.693A>TVOUS01/09/2017
78CYP27A1Ex4NM_000784.3:c.699C>Ap.Ile233= | p.I233=NM_000784.3:c.699C>AVOUS09/06/2018
79CYP27A1Ex4NM_000784.3:c.699C>Gp.Ile233Met | p.I233MNM_000784.3:c.699C>GVOUS02/27/2020
80CYP27A1Ex4NM_000784.3:c.701C>Tp.Pro234Leu | p.P234LNM_000784.3:c.701C>TVOUS03/04/2020
81CYP27A1Ex4NM_000784.3:c.702C>Tp.Pro234= | p.P234=NM_000784.3:c.702C>TVOUS02/04/2021
82CYP27A1Ex4NM_000784.3:c.703G>Ap.Glu235Lys | p.E235KNM_000784.3:c.703G>AVOUS11/19/2020
83CYP27A1Ex4NM_000784.3:c.711C>Tp.Thr237= | p.T237=NM_000784.3:c.711C>TVOUS01/24/2019
84CYP27A1Ex4NM_000784.3:c.712G>Ap.Val238Met | p.V238MNM_000784.3:c.712G>AVOUS12/15/2020
85CYP27A1Ex4NM_000784.3:c.721G>Ap.Val241Ile | p.V241INM_000784.3:c.721G>AVOUS11/02/2017
86CYP27A1Ex4NM_000784.3:c.733G>Cp.Gly245Arg | p.G245RNM_000784.3:c.733G>CVOUS10/26/2018
87CYP27A1Ex4NM_000784.3:c.735G>Tp.Gly245= | p.G245=NM_000784.3:c.735G>TVOUS03/03/2021
88CYP27A1Ex4NM_000784.3:c.753_754delACp.Tyr253Cysfs*34 | p.Y253CfsX34NM_000784.3:c.753_754delACPathogenic04/18/2019 
89CYP27A1Ex4NM_000784.3:c.776delAp.Lys259Serfs*27 | p.K259SfsX27NM_000784.3:c.776delAPathogenic10/10/2017 
90CYP27A1Ex4NM_000784.3:c.785G>Ap.Arg262His | p.R262HNM_000784.3:c.785G>AVOUS10/01/2019
91CYP27A1Ex4NM_000784.3:c.788C>Gp.Pro263Arg | p.P263RNM_000784.3:c.788C>GVOUS11/22/2017
92CYP27A1Ex4NM_000784.3:c.789C>Tp.Pro263= | p.P263=NM_000784.3:c.789C>TVOUS08/29/2019
93CYP27A1Ex4NM_000784.3:c.790G>Ap.Val264Met | p.V264MNM_000784.3:c.790G>AVOUS03/08/2017
94CYP27A1Ex4NM_000784.3:c.792G>Ap.Val264= | p.V264=NM_000784.3:c.792G>ABenign06/06/2019 
95CYP27A1Ex4NM_000784.3:c.802T>Cp.Trp268Arg | p.W268RNM_000784.3:c.802T>CVOUS12/27/2017
96CYP27A1Ex4NM_000784.3:c.808C>Tp.Arg270* | p.R270XNM_000784.3:c.808C>TPathogenic01/30/2020 
97CYP27A1Ex4NM_000784.3:c.808C>Gp.Arg270Gly | p.R270GNM_000784.3:c.808C>GVOUS03/06/2018
98CYP27A1Ex4NM_000784.3:c.809G>Ap.Arg270Gln | p.R270QNM_000784.3:c.809G>AVOUS06/15/2017
99CYP27A1Ex4NM_000784.3:c.844+4A>GNM_000784.3:c.844+4A>GVOUS04/18/2019
100CYP27A1Ex4NM_000784.3:c.844+5_844+6insATGTGGTGAGAGTCTGAGAGGACTTTCCTTTGGTGAGAGTCTGAGAGVOUS08/05/2020
101CYP27A1Ex5NM_000784.3:c.845-46_881delNM_000784.3:c.845-46_881delCATGACTTTTGGCTTTGTCCTTTCCTCTTCTCTGTTGCTTTCACAGGGAAGAAGCTGATTGATGAGAAGCTCGAAGATATGGAPathogenic01/02/2019 
102CYP27A1Ex5NM_000784.3:c.870C>Tp.Leu290= | p.L290=NM_000784.3:c.870C>TVOUS08/03/2020
103CYP27A1Ex5NM_000784.3:c.882G>Ap.Glu294= | p.E294=NM_000784.3:c.882G>AVOUS12/04/2019
104CYP27A1Ex5NM_000784.3:c.884C>Ap.Ala295Asp | p.A295DNM_000784.3:c.884C>AVOUS07/22/2019
105CYP27A1Ex5NM_000784.3:c.886C>Tp.Gln296* | p.Q296XNM_000784.3:c.886C>TPathogenic07/27/2020 
106CYP27A1Ex5NM_000784.3:c.891G>Tp.Leu297= | p.L297=NM_000784.3:c.891G>TVOUS04/16/2020
107CYP27A1Ex5NM_000784.3:c.917A>Gp.Gln306Arg | p.Q306RNM_000784.3:c.917A>GVOUS09/27/2019
108CYP27A1Ex5NM_000784.3:c.919G>Tp.Val307Leu | p.V307LNM_000784.3:c.919G>TVOUS08/21/2019
109CYP27A1Ex5NM_000784.3:c.944_948delTGGCCp.Leu315Glnfs*15 | p.L315QfsX15NM_000784.3:c.944_948delTGGCCPathogenic06/05/2018 
110CYP27A1Ex5NM_000784.3:c.958C>Tp.Leu320Phe | p.L320FNM_000784.3:c.958C>TVOUS10/08/2020
111CYP27A1Ex5NM_000784.3:c.967C>Tp.Arg323Trp | p.R323WNM_000784.3:c.967C>TVOUS02/05/2019
112CYP27A1Ex5NM_000784.3:c.972G>Ap.Glu324= | p.E324=NM_000784.3:c.972G>AVOUS08/07/2019
113CYP27A1Ex5NM_000784.3:c.974C>Tp.Ala325Val | p.A325VNM_000784.3:c.974C>TVOUS05/24/2018
114CYP27A1Ex5NM_000784.3:c.1012G>Ap.Asp338Asn | p.D338NNM_000784.3:c.1012G>AVOUS10/03/2019
115CYP27A1Ex5NM_000784.3:c.1013A>Tp.Asp338Val | p.D338VNM_000784.3:c.1013A>TVOUS06/05/2020
116CYP27A1Ex5NM_000784.3:c.1016C>Tp.Thr339Met | p.T339MNM_000784.3:c.1016C>TPathogenic12/19/2019 
117CYP27A1Ex5NM_000784.3:c.1017G>Ap.Thr339= | p.T339=NM_000784.3:c.1017G>AVOUS01/09/2018
118CYP27A1Ex5NM_000784.3:c.1017+5G>ANM_000784.3:c.1017+5G>AVOUS10/25/2017
119CYP27A1Ex6NM_000784.3:c.1018-8T>AVOUS02/23/2021
120CYP27A1Ex6NM_000784.3:c.1019C>Tp.Thr340Ile | p.T340INM_000784.3:c.1019C>TVOUS12/21/2015
121CYP27A1Ex6NM_000784.3:c.1025A>Gp.Asn342Ser | p.N342SNM_000784.3:c.1025A>GVOUS09/03/2020
122CYP27A1Ex6NM_000784.3:c.1028C>Tp.Thr343Met | p.T343MNM_000784.3:c.1028C>TVOUS06/07/2019
123CYP27A1Ex6NM_000784.3:c.1029G>Tp.Thr343= | p.T343=NM_000784.3:c.1029G>TVOUS12/22/2017
124CYP27A1Ex6NM_000784.3:c.1029G>Ap.Thr343= | p.T343=NM_000784.3:c.1029G>AVOUS04/16/2019
125CYP27A1Ex6NM_000784.3:c.1037G>Ap.Trp346* | p.W346XNM_000784.3:c.1037G>APathogenic03/19/2020 
126CYP27A1Ex6NM_000784.3:c.1055C>Tp.Ser352Leu | p.S352LNM_000784.3:c.1055C>TVOUS02/13/2020
127CYP27A1Ex6NM_000784.3:c.1083G>Tp.Leu361Phe | p.L361FNM_000784.3:c.1083G>TVOUS12/01/2016
128CYP27A1Ex6NM_000784.3:c.1085A>Gp.His362Arg | p.H362RNM_000784.3:c.1085A>GVOUS05/19/2016
129CYP27A1Ex6NM_000784.3:c.1086C>Tp.His362= | p.H362=NM_000784.3:c.1086C>TVOUS02/21/2020
130CYP27A1Ex6NM_000784.3:c.1089G>Ap.Glu363= | p.E363=NM_000784.3:c.1089G>AVOUS03/19/2021
131CYP27A1Ex6NM_000784.3:c.1101T>Gp.Gly367= | p.G367=NM_000784.3:c.1101T>GVOUS07/30/2018
132CYP27A1Ex6NM_000784.3:c.1102_1104delGTGinsTTAp.Val368Leu | p.V368LNM_000784.3:c.1102_1104delinsTTAVOUS03/03/2021
133CYP27A1Ex6NM_000784.3:c.1114G>Ap.Gly372Arg | p.G372RNM_000784.3:c.1114G>AVOUS10/08/2019
134CYP27A1Ex6NM_000784.3:c.1123C>Tp.Pro375Ser | p.P375SNM_000784.3:c.1123C>TVOUS05/16/2019
135CYP27A1Ex6NM_000784.3:c.1142C>Tp.Ala381Val | p.A381VNM_000784.3:c.1142C>TVOUS08/24/2020
136CYP27A1Ex6NM_000784.3:c.1148T>Ap.Met383Lys | p.M383KNM_000784.3:c.1148T>AVOUS05/18/2020
137CYP27A1Ex6NM_000784.3:c.1151C>Tp.Pro384Leu | p.P384LNM_000784.3:c.1151C>TBenign12/12/2014 
138CYP27A1Ex6NM_000784.3:c.1161A>Cp.Lys387Asn | p.K387NNM_000784.3:c.1161A>CVOUS12/27/2017
139CYP27A1Ex6NM_000784.3:c.1175A>Cp.Glu392Ala | p.E392ANM_000784.3:c.1175A>CVOUS02/23/2017
140CYP27A1Ex6NM_000784.3:c.1183C>Tp.Arg395Cys | p.R395CNM_000784.3:c.1183C>TPathogenic08/10/2020 
141CYP27A1Ex6NM_000784.3:c.1184G>Ap.Arg395His | p.R395HNM_000784.3:c.1184G>ALikely pathogenic06/14/2017 
142CYP27A1Ex6NM_000784.3:c.1184+1G>ANM_000784.3:c.1184+1G>APathogenic08/03/2020 
143CYP27A1Ex6NM_000784.3:c.1184+9G>TVOUS01/13/2021
144CYP27A1Ex7NM_000784.3:c.1185-1G>ANM_000784.3:c.1185-1G>APathogenic03/23/2017 
145CYP27A1Ex7NM_000784.3:c.1192C>Ap.Pro398Thr | p.P398TNM_000784.3:c.1192C>AVOUS08/15/2018
146CYP27A1Ex7NM_000784.3:c.1207A>Gp.Asn403Asp | p.N403DNM_000784.3:c.1207A>GVOUS02/17/2017
147CYP27A1Ex7NM_000784.3:c.1213C>Tp.Arg405Trp | p.R405WNM_000784.3:c.1213C>TPathogenic04/26/2018 
148CYP27A1Ex7NM_000784.3:c.1214G>Ap.Arg405Gln | p.R405QNM_000784.3:c.1214G>APathogenic03/05/2020 
149CYP27A1Ex7NM_000784.3:c.1231A>Tp.Ile411Phe | p.I411FNM_000784.3:c.1231A>TVOUS05/28/2020
150CYP27A1Ex7NM_000784.3:c.1256C>Tp.Pro419Leu | p.P419LNM_000784.3:c.1256C>TVOUS08/09/2019
151CYP27A1Ex7NM_000784.3:c.1263+1G>ANM_000784.3:c.1263+1G>APathogenic01/02/2019 
152CYP27A1Ex7NM_000784.3:c.1263+5G>TNM_000784.3:c.1263+5G>TPathogenic02/25/2019 
153CYP27A1Ex7NM_000784.3:c.1263+10delGNM_000784.3:c.1263+10delGVOUS05/19/2017
154CYP27A1Ex8NM_000784.3:c.1286A>Gp.Tyr429Cys | p.Y429CNM_000784.3:c.1286A>GVOUS12/16/2020
155CYP27A1Ex8NM_000784.3:c.1297C>Tp.Arg433Trp | p.R433WNM_000784.3:c.1297C>TVOUS04/01/2020
156CYP27A1Ex8NM_000784.3:c.1298G>Ap.Arg433Gln | p.R433QNM_000784.3:c.1298G>AVOUS06/09/2017
157CYP27A1Ex8NM_000784.3:c.1300G>Cp.Asp434His | p.D434HNM_000784.3:c.1300G>CVOUS06/14/2019
158CYP27A1Ex8NM_000784.3:c.1311C>Tp.Ala437= | p.A437=NM_000784.3:c.1311C>TVOUS08/26/2016
159CYP27A1Ex8NM_000784.3:c.1342C>Gp.Arg448Gly | p.R448GNM_000784.3:c.1342C>GVOUS12/05/2018
160CYP27A1Ex8NM_000784.3:c.1342C>Ap.Arg448Ser | p.R448SNM_000784.3:c.1342C>AVOUS11/08/2017
161CYP27A1Ex8NM_000784.3:c.1343G>Ap.Arg448His | p.R448HNM_000784.3:c.1343G>AVOUS08/21/2020
162CYP27A1Ex8NM_000784.3:c.1349T>Gp.Leu450Arg | p.L450RNM_000784.3:c.1349T>GVOUS09/24/2019
163CYP27A1Ex8NM_000784.3:c.1369A>Gp.Thr457Ala | p.T457ANM_000784.3:c.1369A>GVOUS03/22/2019
164CYP27A1Ex8NM_000784.3:c.1371C>Tp.Thr457= | p.T457=NM_000784.3:c.1371C>TVOUS12/13/2017
165CYP27A1Ex8NM_000784.3:c.1381C>Tp.Gln461* | p.Q461XNM_000784.3:c.1381C>TPathogenic06/20/2018 
166CYP27A1Ex8NM_000784.3:c.1390T>Cp.Phe464Leu | p.F464LNM_000784.3:c.1390T>CVOUS02/20/2020
167CYP27A1Ex8NM_000784.3:c.1407T>Cp.Phe469= | p.F469=NM_000784.3:c.1407T>CVOUS11/05/2018
168CYP27A1Ex8NM_000784.3:c.1415G>Cp.Gly472Ala | p.G472ANM_000784.3:c.1415G>CVOUS01/22/2020
169CYP27A1Ex8NM_000784.3:c.1419C>Tp.Val473= | p.V473=NM_000784.3:c.1419C>TVOUS02/24/2020
170CYP27A1Ex8NM_000784.3:c.1425C>Ap.Ala475= | p.A475=NM_000784.3:c.1425C>AVOUS12/10/2018
171CYP27A1Ex8NM_000784.3:c.1434C>Tp.Gly478= | p.G478=NM_000784.3:c.1434C>TVOUS10/19/2020
172CYP27A1Ex8NM_000784.3:c.1435C>Gp.Arg479Gly | p.R479GNM_000784.3:c.1435C>GVOUS05/08/2017
173CYP27A1Ex8NM_000784.3:c.1435C>Tp.Arg479Cys | p.R479CNM_000784.3:c.1435C>TPathogenic05/03/2018 
174CYP27A1Ex8NM_000784.3:c.1436G>Ap.Arg479His | p.R479HNM_000784.3:c.1436G>AVOUS03/05/2021
175CYP27A1Ex8NM_000784.3:c.1437C>Tp.Arg479= | p.R479=NM_000784.3:c.1437C>TVOUS10/16/2017
176CYP27A1Ex8NM_000784.3:c.1456A>Tp.Met486Leu | p.M486LNM_000784.3:c.1456A>TVOUS12/21/2020
177CYP27A1Ex8NM_000784.3:c.1470C>Tp.Leu490= | p.L490=NM_000784.3:c.1470C>TVOUS11/27/2018
178CYP27A1Ex8NM_000784.3:c.1471G>Ap.Ala491Thr | p.A491TNM_000784.3:c.1471G>AVOUS06/26/2018
179CYP27A1Ex8NM_000784.3:c.1471G>Tp.Ala491Ser | p.A491SNM_000784.3:c.1471G>TBenign08/26/2015 
180CYP27A1Ex9NM_000784.3:c.1477-10T>CVOUS12/24/2019
181CYP27A1Ex9NM_000784.3:c.1477-3C>TVOUS11/13/2019
182CYP27A1Ex9NM_000784.3:c.1494G>Cp.Lys498Asn | p.K498NNM_000784.3:c.1494G>CVOUS03/14/2018
183CYP27A1Ex9NM_000784.3:c.1503G>Ap.Leu501= | p.L501=NM_000784.3:c.1503G>AVOUS09/01/2017
184CYP27A1Ex9NM_000784.3:c.1505C>Ap.Ala502Asp | p.A502DNM_000784.3:c.1505C>ABenign06/05/2015 
185CYP27A1Ex9NM_000784.3:c.1508C>Tp.Pro503Leu | p.P503LNM_000784.3:c.1508C>TVOUS03/12/2018
186CYP27A1Ex9NM_000784.3:c.1509G>Ap.Pro503= | p.P503=NM_000784.3:c.1509G>AVOUS01/22/2019
187CYP27A1Ex9NM_000784.3:c.1512G>Ap.Glu504= | p.E504=NM_000784.3:c.1512G>AVOUS05/03/2017
188CYP27A1Ex9NM_000784.3:c.1514C>Ap.Thr505Lys | p.T505KNM_000784.3:c.1514C>AVOUS03/08/2019
189CYP27A1Ex9NM_000784.3:c.1515G>Ap.Thr505= | p.T505=NM_000784.3:c.1515G>AVOUS05/21/2020
190CYP27A1Ex9NM_000784.3:c.1531G>Ap.Val511Met | p.V511MNM_000784.3:c.1531G>AVOUS05/08/2020
191CYP27A1Ex9NM_000784.3:c.1537C>Tp.Arg513Cys | p.R513CNM_000784.3:c.1537C>TLikely pathogenic10/21/2020 
192CYP27A1Ex9NM_000784.3:c.1538G>Ap.Arg513His | p.R513HNM_000784.3:c.1538G>AVOUS03/19/2018
193CYP27A1Ex9NM_000784.3:c.1541T>Cp.Ile514Thr | p.I514TNM_000784.3:c.1541T>CVOUS03/23/2020
194CYP27A1Ex9NM_000784.3:c.1553C>Gp.Pro518Arg | p.P518RNM_000784.3:c.1553C>GVOUS06/09/2020
195CYP27A1Ex9NM_000784.3:c.1556A>Gp.Asn519Ser | p.N519SNM_000784.3:c.1556A>GVOUS08/09/2019
196CYP27A1Ex9NM_000784.3:c.1564G>Ap.Val522Met | p.V522MNM_000784.3:c.1564G>AVOUS02/04/2020
197CYP27A1Ex9NM_000784.3:c.1569C>Tp.Gly523= | p.G523=NM_000784.3:c.1569C>TVOUS03/14/2019
198CYP27A1Ex9NM_000784.3:c.1589A>Tp.Gln530Leu | p.Q530LNM_000784.3:c.1589A>TVOUS04/03/2018

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.