Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CUL7Ex2NM_014780.4:c.25G>Cp.Glu9Gln | p.E9QNM_001168370.1:c.181G>C, NM_014780.3:c.25G>C, NM_014780.4:c.25G>C, NM_015950.3:c.*1510G>C, XM_005249160.1:c.*1510G>C, XM_005249161.1:c.*1510G>C, XM_005249162.1:c.*1676G>C, XM_005249503.1:c.181G>CVOUS02/08/2021
2CUL7Ex2NM_014780.4:c.78C>Tp.Ile26= | p.I26=NM_001168370.1:c.234C>T, NM_014780.3:c.78C>T, NM_014780.4:c.78C>T, NM_015950.3:c.*1563C>T, XM_005249160.1:c.*1563C>T, XM_005249161.1:c.*1563C>T, XM_005249162.1:c.*1729C>T, XM_005249503.1:c.234C>TVOUS04/06/2021
3CUL7Ex2NM_014780.4:c.79C>Tp.Arg27Cys | p.R27CNM_001168370.1:c.235C>T, NM_014780.3:c.79C>T, NM_014780.4:c.79C>T, NM_015950.3:c.*1564C>T, XM_005249160.1:c.*1564C>T, XM_005249161.1:c.*1564C>T, XM_005249162.1:c.*1730C>T, XM_005249503.1:c.235C>TVOUS01/29/2015
4CUL7Ex2NM_014780.4:c.87C>Gp.Arg29= | p.R29=NM_001168370.1:c.243C>G, NM_014780.3:c.87C>G, NM_014780.4:c.87C>G, NM_015950.3:c.*1572C>G, XM_005249160.1:c.*1572C>G, XM_005249161.1:c.*1572C>G, XM_005249162.1:c.*1738C>G, XM_005249503.1:c.243C>GVOUS10/24/2018
5CUL7Ex2NM_014780.4:c.136C>Tp.Arg46Trp | p.R46WNM_001168370.1:c.292C>T, NM_014780.3:c.136C>T, NM_014780.4:c.136C>T, NM_015950.3:c.*1621C>T, XM_005249160.1:c.*1621C>T, XM_005249161.1:c.*1621C>T, XM_005249162.1:c.*1787C>T, XM_005249503.1:c.292C>TVOUS02/16/2015
6CUL7Ex2NM_014780.4:c.139C>Tp.Arg47Cys | p.R47CNM_001168370.1:c.295C>T, NM_014780.3:c.139C>T, NM_014780.4:c.139C>T, NM_015950.3:c.*1624C>T, XM_005249160.1:c.*1624C>T, XM_005249161.1:c.*1624C>T, XM_005249162.1:c.*1790C>T, XM_005249503.1:c.295C>TVOUS01/23/2017
7CUL7Ex2NM_014780.4:c.145G>Ap.Asp49Asn | p.D49NNM_001168370.1:c.301G>A, NM_014780.3:c.145G>A, NM_014780.4:c.145G>A, NM_015950.3:c.*1630G>A, XM_005249160.1:c.*1630G>A, XM_005249161.1:c.*1630G>A, XM_005249162.1:c.*1796G>A, XM_005249503.1:c.301G>AVOUS06/18/2020
8CUL7Ex2NM_014780.4:c.156C>Tp.Asp52= | p.D52=NM_001168370.1:c.312C>T, NM_014780.3:c.156C>T, NM_014780.4:c.156C>T, NM_015950.3:c.*1641C>T, XM_005249160.1:c.*1641C>T, XM_005249161.1:c.*1641C>T, XM_005249162.1:c.*1807C>T, XM_005249503.1:c.312C>TVOUS01/24/2017
9CUL7Ex2NM_014780.4:c.210delCp.Lys71Argfs*44 | p.K71RfsX44NM_001168370.1:c.366delC, NM_014780.3:c.210delC, NM_014780.4:c.210delC, NM_015950.3:c.*1695delC, XM_005249160.1:c.*1695delC, XM_005249161.1:c.*1695delC, XM_005249162.1:c.*1861delC, XM_005249503.1:c.366delCPathogenic04/16/2019 
10CUL7Ex2NM_014780.4:c.237C>Tp.His79= | p.H79=NM_001168370.1:c.393C>T, NM_014780.3:c.237C>T, NM_014780.4:c.237C>T, NM_015950.3:c.*1722C>T, XM_005249160.1:c.*1722C>T, XM_005249161.1:c.*1722C>T, XM_005249162.1:c.*1888C>T, XM_005249503.1:c.393C>TVOUS04/30/2019
11CUL7Ex2NM_014780.4:c.314C>Tp.Ser105Phe | p.S105FNM_001168370.1:c.470C>T, NM_014780.3:c.314C>T, NM_014780.4:c.314C>T, NM_015950.3:c.*1799C>T, XM_005249160.1:c.*1799C>T, XM_005249161.1:c.*1799C>T, XM_005249162.1:c.*1965C>T, XM_005249503.1:c.470C>TVOUS11/08/2016
12CUL7Ex2NM_014780.4:c.465A>Tp.Gly155= | p.G155=NM_001168370.1:c.621A>T, NM_014780.3:c.465A>T, NM_014780.4:c.465A>T, NM_015950.3:c.*1950A>T, XM_005249160.1:c.*1950A>T, XM_005249161.1:c.*1950A>T, XM_005249162.1:c.*2116A>T, XM_005249503.1:c.621A>TBenign12/11/2014 
13CUL7Ex2NM_014780.4:c.509T>Gp.Leu170Trp | p.L170WNM_001168370.1:c.665T>G, NM_014780.3:c.509T>G, NM_014780.4:c.509T>G, NM_015950.3:c.*1994T>G, XM_005249160.1:c.*1994T>G, XM_005249161.1:c.*1994T>G, XM_005249162.1:c.*2160T>G, XM_005249503.1:c.665T>GVOUS05/15/2018
14CUL7Ex2NM_014780.4:c.533G>Tp.Arg178Leu | p.R178LNM_001168370.1:c.689G>T, NM_014780.3:c.533G>T, NM_014780.4:c.533G>T, NM_015950.3:c.*2018G>T, XM_005249160.1:c.*2018G>T, XM_005249161.1:c.*2018G>T, XM_005249162.1:c.*2184G>T, XM_005249503.1:c.689G>TLikely benign04/03/2015 
15CUL7Ex3NM_014780.4:c.594G>Ap.Gln198= | p.Q198=NM_001168370.1:c.846G>A, NM_014780.3:c.594G>A, NM_014780.4:c.594G>A, NM_015950.3:c.*2524G>A, XM_005249160.1:c.*2524G>A, XM_005249161.1:c.*2524G>A, XM_005249162.1:c.*2690G>A, XM_005249503.1:c.750G>AVOUS09/28/2015
16CUL7Ex3NM_014780.4:c.618A>Gp.Gln206= | p.Q206=NM_001168370.1:c.870A>G, NM_014780.3:c.618A>G, NM_014780.4:c.618A>G, NM_015950.3:c.*2548A>G, XM_005249160.1:c.*2548A>G, XM_005249161.1:c.*2548A>G, XM_005249162.1:c.*2714A>G, XM_005249503.1:c.774A>GVOUS05/09/2018
17CUL7Ex3NM_014780.4:c.711C>Tp.Phe237= | p.F237=NM_001168370.1:c.963C>T, NM_014780.3:c.711C>T, NM_014780.4:c.711C>T, NM_015950.3:c.*2641C>T, XM_005249160.1:c.*2641C>T, XM_005249161.1:c.*2641C>T, XM_005249162.1:c.*2807C>T, XM_005249503.1:c.867C>TVOUS06/12/2019
18CUL7Ex4NM_014780.4:c.785C>Tp.Ser262Leu | p.S262LNM_001168370.1:c.1037C>T, NM_014780.3:c.785C>T, NM_014780.4:c.785C>T, NM_015950.3:c.*2858C>T, XM_005249160.1:c.*2858C>T, XM_005249161.1:c.*2858C>T, XM_005249162.1:c.*3024C>T, XM_005249503.1:c.941C>TVOUS09/02/2016
19CUL7Ex4NM_014780.4:c.861G>Ap.Gly287= | p.G287=NM_001168370.1:c.1113G>A, NM_014780.3:c.861G>A, NM_014780.4:c.861G>A, NM_015950.3:c.*2934G>A, XM_005249160.1:c.*2934G>A, XM_005249161.1:c.*2934G>A, XM_005249162.1:c.*3100G>A, XM_005249503.1:c.1017G>ALikely benign08/25/2016 
20CUL7Ex4NM_014780.4:c.898_919delATGGGCACCCTGATCTCGGAGCNM_001168370.1:c.1150_1171delATGGGCACCCTGATCTCGGAGC, NM_014780.3:c.898_919delATGGGCACCCTGATCTCGGAGC, NM_014780.4:c.898_919delATGGGCACCCTGATCTCGGAGC, NM_015950.3:c.*2971_*2992delATGGGCACCCTGATCTCGGAGC, XM_005249160.1:c.*2971_*2992delATGGGCACCCTGATCTCGGAGC, XM_005249161.1:c.*2971_*2992delATGGGCACCCTGATCTCGGAGC, XM_005249162.1:c.*3137_*3158delATGGGCACCCTGATCTCGGAGC, XM_005249503.1:c.1054_1075delATGGGCACCCTGATCTCGGAGCPathogenic03/13/2015 
21CUL7Ex4NM_014780.4:c.934C>Tp.Arg312Cys | p.R312CNM_001168370.1:c.1186C>T, NM_014780.3:c.934C>T, NM_014780.4:c.934C>T, NM_015950.3:c.*3007C>T, XM_005249160.1:c.*3007C>T, XM_005249161.1:c.*3007C>T, XM_005249162.1:c.*3173C>T, XM_005249503.1:c.1090C>TVOUS10/07/2016
22CUL7Ex4NM_014780.4:c.935G>Ap.Arg312His | p.R312HNM_001168370.1:c.1187G>A, NM_014780.3:c.935G>A, NM_014780.4:c.935G>A, NM_015950.3:c.*3008G>A, XM_005249160.1:c.*3008G>A, XM_005249161.1:c.*3008G>A, XM_005249162.1:c.*3174G>A, XM_005249503.1:c.1091G>AVOUS04/16/2015
23CUL7Ex4NM_014780.4:c.981C>Tp.Pro327= | p.P327=NM_001168370.1:c.1233C>T, NM_014780.3:c.981C>T, NM_014780.4:c.981C>T, NM_015950.3:c.*3054C>T, XM_005249160.1:c.*3054C>T, XM_005249161.1:c.*3054C>T, XM_005249162.1:c.*3220C>T, XM_005249503.1:c.1137C>TVOUS09/26/2019
24CUL7Ex4NM_014780.4:c.1005G>Ap.Leu335= | p.L335=NM_001168370.1:c.1257G>A, NM_014780.3:c.1005G>A, NM_014780.4:c.1005G>A, NM_015950.3:c.*3078G>A, XM_005249160.1:c.*3078G>A, XM_005249161.1:c.*3078G>A, XM_005249162.1:c.*3244G>A, XM_005249503.1:c.1161G>AVOUS01/30/2015
25CUL7Ex4NM_014780.4:c.1030G>Ap.Ala344Thr | p.A344TNM_001168370.1:c.1282G>A, NM_014780.3:c.1030G>A, NM_014780.4:c.1030G>A, NM_015950.3:c.*3103G>A, XM_005249160.1:c.*3103G>A, XM_005249161.1:c.*3103G>A, XM_005249162.1:c.*3269G>A, XM_005249503.1:c.1186G>ABenign02/16/2015 
26CUL7Ex4NM_014780.4:c.1047C>Tp.Pro349= | p.P349=NM_001168370.1:c.1299C>T, NM_014780.3:c.1047C>T, NM_014780.4:c.1047C>T, NM_015950.3:c.*3120C>T, XM_005249160.1:c.*3120C>T, XM_005249161.1:c.*3120C>T, XM_005249162.1:c.*3286C>T, XM_005249503.1:c.1203C>TVOUS02/12/2016
27CUL7Ex4NM_014780.4:c.1067G>Ap.Arg356His | p.R356HNM_001168370.1:c.1319G>A, NM_014780.3:c.1067G>A, NM_014780.4:c.1067G>A, NM_015950.3:c.*3140G>A, XM_005249160.1:c.*3140G>A, XM_005249161.1:c.*3140G>A, XM_005249162.1:c.*3306G>A, XM_005249503.1:c.1223G>AVOUS06/19/2017
28CUL7Ex4NM_014780.4:c.1073G>Ap.Arg358His | p.R358HNM_001168370.1:c.1325G>A, NM_014780.3:c.1073G>A, NM_014780.4:c.1073G>A, NM_015950.3:c.*3146G>A, XM_005249160.1:c.*3146G>A, XM_005249161.1:c.*3146G>A, XM_005249162.1:c.*3312G>A, XM_005249503.1:c.1229G>AVOUS06/10/2015
29CUL7Ex6NM_014780.4:c.1542G>Tp.Gln514His | p.Q514HNM_001168370.1:c.1794G>T, NM_014780.3:c.1542G>T, NM_014780.4:c.1542G>T, NM_015950.3:c.*4284G>T, XM_005249160.1:c.*4284G>T, XM_005249161.1:c.*4284G>T, XM_005249162.1:c.*4450G>T, XM_005249503.1:c.1698G>TBenign02/16/2015 
30CUL7Ex7NM_014780.4:c.1570-8G>ANM_001168370.1:c.1822-8G>A, NM_014780.3:c.1570-8G>A, NM_014780.4:c.1570-8G>A, NM_015950.3:c.*4604G>A, XM_005249160.1:c.*4604G>A, XM_005249161.1:c.*4604G>A, XM_005249162.1:c.*4770G>A, XM_005249503.1:c.1726-8G>AVOUS11/17/2015
31CUL7Ex7NM_014780.4:c.1648C>Tp.Arg550* | p.R550XNM_001168370.1:c.1900C>T, NM_014780.3:c.1648C>T, NM_014780.4:c.1648C>T, NM_015950.3:c.*4690C>T, XM_005249160.1:c.*4690C>T, XM_005249161.1:c.*4690C>T, XM_005249162.1:c.*4856C>T, XM_005249503.1:c.1804C>TPathogenic10/07/2016 
32CUL7Ex7NM_014780.4:c.1686C>Tp.Cys562= | p.C562=NM_001168370.1:c.1938C>T, NM_014780.3:c.1686C>T, NM_014780.4:c.1686C>T, NM_015950.3:c.*4728C>T, XM_005249160.1:c.*4728C>T, XM_005249161.1:c.*4728C>T, XM_005249162.1:c.*4894C>T, XM_005249503.1:c.1842C>TVOUS01/17/2017
33CUL7Ex7NM_014780.4:c.1782G>Ap.Ala594= | p.A594=NM_001168370.1:c.2034G>A, NM_014780.3:c.1782G>A, NM_014780.4:c.1782G>A, NM_015950.3:c.*4824G>A, XM_005249160.1:c.*4824G>A, XM_005249161.1:c.*4824G>A, XM_005249162.1:c.*4990G>A, XM_005249503.1:c.1938G>AVOUS07/07/2017
34CUL7Ex8NM_014780.4:c.1859C>Tp.Pro620Leu | p.P620LNM_001168370.1:c.2111C>T, NM_014780.3:c.1859C>T, NM_014780.4:c.1859C>T, XM_005249503.1:c.2015C>TVOUS06/19/2017
35CUL7Ex8NM_014780.4:c.2028G>Ap.Pro676= | p.P676=NM_001168370.1:c.2280G>A, NM_014780.3:c.2028G>A, NM_014780.4:c.2028G>A, XM_005249503.1:c.2184G>AVOUS02/14/2019
36CUL7Ex9NM_014780.4:c.2112G>Ap.Trp704* | p.W704XNM_001168370.1:c.2364G>A, NM_014780.3:c.2112G>A, NM_014780.4:c.2112G>A, XM_005249503.1:c.2268G>APathogenic12/07/2016 
37CUL7Ex9NM_014780.4:c.2115C>Tp.His705= | p.H705=NM_001168370.1:c.2367C>T, NM_014780.3:c.2115C>T, NM_014780.4:c.2115C>T, XM_005249503.1:c.2271C>TVOUS12/15/2017
38CUL7Ex9NM_014780.4:c.2163T>Cp.Asp721= | p.D721=NM_001168370.1:c.2415T>C, NM_014780.3:c.2163T>C, NM_014780.4:c.2163T>C, XM_005249503.1:c.2319T>CVOUS06/15/2017
39CUL7Ex9NM_014780.4:c.2164C>Tp.Arg722* | p.R722XNM_001168370.1:c.2416C>T, NM_014780.3:c.2164C>T, NM_014780.4:c.2164C>T, XM_005249503.1:c.2320C>TPathogenic09/09/2015 
40CUL7Ex10NM_014780.4:c.2229C>Gp.Ala743= | p.A743=NM_001168370.1:c.2481C>G, NM_014780.3:c.2229C>G, NM_014780.4:c.2229C>G, XM_005249503.1:c.2385C>GVOUS08/20/2015
41CUL7Ex10NM_014780.4:c.2318G>Ap.Arg773Gln | p.R773QNM_001168370.1:c.2570G>A, NM_014780.3:c.2318G>A, NM_014780.4:c.2318G>A, XM_005249503.1:c.2474G>AVOUS10/26/2015
42CUL7Ex10NM_014780.4:c.2384G>Ap.Gly795Glu | p.G795ENM_001168370.1:c.2636G>A, NM_014780.3:c.2384G>A, NM_014780.4:c.2384G>A, XM_005249503.1:c.2540G>AVOUS01/03/2017
43CUL7Ex11NM_014780.4:c.2438_2439delAAinsGGp.Gln813Arg | p.Q813RNM_001168370.1:c.2690_2691delinsGG, NM_014780.3:c.2438_2439delinsGG, NM_014780.4:c.2438_2439delinsGG, XM_005249503.1:c.2594_2595delinsGGBenign08/05/2019 
44CUL7Ex11NM_014780.4:c.2472C>Tp.Leu824= | p.L824=NM_001168370.1:c.2724C>T, NM_014780.3:c.2472C>T, NM_014780.4:c.2472C>T, XM_005249503.1:c.2628C>TVOUS04/03/2016
45CUL7Ex12NM_014780.4:c.2559delCNM_001168370.1:c.2811delC, NM_014780.3:c.2559delC, NM_014780.4:c.2559delC, XM_005249503.1:c.2715delCPathogenic12/07/2016 
46CUL7Ex12NM_014780.4:c.2563A>Gp.Lys855Glu | p.K855ENM_001168370.1:c.2815A>G, NM_014780.3:c.2563A>G, NM_014780.4:c.2563A>G, XM_005249503.1:c.2719A>GVOUS10/04/2017
47CUL7Ex12NM_014780.4:c.2586G>Tp.Lys862Asn | p.K862NNM_001168370.1:c.2838G>T, NM_014780.3:c.2586G>T, NM_014780.4:c.2586G>T, XM_005249503.1:c.2742G>TVOUS08/04/2016
48CUL7Ex12NM_014780.4:c.2603A>Gp.Asn868Ser | p.N868SNM_001168370.1:c.2855A>G, NM_014780.3:c.2603A>G, NM_014780.4:c.2603A>G, XM_005249503.1:c.2759A>GLikely benign06/12/2019 
49CUL7Ex12NM_014780.4:c.2614G>Ap.Gly872Ser | p.G872SNM_001168370.1:c.2866G>A, NM_014780.3:c.2614G>A, NM_014780.4:c.2614G>A, XM_005249503.1:c.2770G>AVOUS01/12/2018
50CUL7Ex12NM_014780.4:c.2644C>Tp.Arg882Trp | p.R882WNM_001168370.1:c.2896C>T, NM_014780.3:c.2644C>T, NM_014780.4:c.2644C>T, XM_005249503.1:c.2800C>TVOUS01/12/2016
51CUL7Ex12NM_014780.4:c.2645G>Ap.Arg882Gln | p.R882QNM_001168370.1:c.2897G>A, NM_014780.3:c.2645G>A, NM_014780.4:c.2645G>A, XM_005249503.1:c.2801G>AVOUS08/18/2016
52CUL7Ex12NM_014780.4:c.2647G>Ap.Gly883Ser | p.G883SNM_001168370.1:c.2899G>A, NM_014780.3:c.2647G>A, NM_014780.4:c.2647G>A, XM_005249503.1:c.2803G>AVOUS08/21/2017
53CUL7Ex13NM_014780.4:c.2682T>Cp.Ala894= | p.A894=NM_001168370.1:c.2934T>C, NM_014780.3:c.2682T>C, NM_014780.4:c.2682T>C, XM_005249503.1:c.2838T>CVOUS08/24/2017
54CUL7Ex13NM_014780.4:c.2688G>Ap.Glu896= | p.E896=NM_001168370.1:c.2940G>A, NM_014780.3:c.2688G>A, NM_014780.4:c.2688G>A, XM_005249503.1:c.2844G>AVOUS07/06/2015
55CUL7Ex13NM_014780.4:c.2710C>Tp.Arg904* | p.R904XNM_001168370.1:c.2962C>T, NM_014780.3:c.2710C>T, NM_014780.4:c.2710C>T, XM_005249503.1:c.2866C>TPathogenic12/07/2017 
56CUL7Ex13NM_014780.4:c.2753C>Tp.Thr918Met | p.T918MNM_001168370.1:c.3005C>T, NM_014780.3:c.2753C>T, NM_014780.4:c.2753C>T, XM_005249503.1:c.2909C>TVOUS10/03/2016
57CUL7Ex13NM_014780.4:c.2754G>Ap.Thr918= | p.T918=NM_001168370.1:c.3006G>A, NM_014780.3:c.2754G>A, NM_014780.4:c.2754G>A, XM_005249503.1:c.2910G>AVOUS12/15/2017
58CUL7Ex14NM_014780.4:c.2767-17_2767-13dupTCTCTNM_001168370.1:c.3019-13_3019-12insTCTCT, NM_014780.3:c.2767-13_2767-12insTCTCT, NM_014780.4:c.2767-13_2767-12insTCTCT, XM_005249503.1:c.2923-13_2923-12insTCTCTVOUS07/10/2015
59CUL7Ex14NM_014780.4:c.2787delCNM_001168370.1:c.3039delC, NM_014780.3:c.2787delC, NM_014780.4:c.2787delC, XM_005249503.1:c.2943delCPathogenic06/15/2016 
60CUL7Ex14NM_014780.4:c.2802C>Ap.Leu934= | p.L934=NM_001168370.1:c.3054C>A, NM_014780.3:c.2802C>A, NM_014780.4:c.2802C>A, XM_005249503.1:c.2958C>AVOUS02/02/2017
61CUL7Ex14NM_014780.4:c.2848A>Tp.Lys950* | p.K950XNM_001168370.1:c.3100A>T, NM_014780.3:c.2848A>T, NM_014780.4:c.2848A>T, XM_005249503.1:c.3004A>TPathogenic08/09/2016 
62CUL7Ex15NM_014780.4:c.2885G>Tp.Arg962Leu | p.R962LNM_001168370.1:c.3137G>T, NM_014780.3:c.2885G>T, NM_014780.4:c.2885G>T, XM_005249503.1:c.3041G>TVOUS06/03/2016
63CUL7Ex15NM_014780.4:c.2885G>Ap.Arg962Gln | p.R962QNM_001168370.1:c.3137G>A, NM_014780.3:c.2885G>A, NM_014780.4:c.2885G>A, XM_005249503.1:c.3041G>AVOUS02/16/2015
64CUL7Ex15NM_014780.4:c.2901A>Gp.Leu967= | p.L967=NM_001168370.1:c.3153A>G, NM_014780.3:c.2901A>G, NM_014780.4:c.2901A>G, XM_005249503.1:c.3057A>GVOUS02/20/2017
65CUL7Ex16NM_014780.4:c.3041T>Gp.Leu1014Arg | p.L1014RNM_001168370.1:c.3293T>G, NM_014780.3:c.3041T>G, NM_014780.4:c.3041T>G, XM_005249503.1:c.3197T>GLikely pathogenic05/07/2015 
66CUL7Ex16NM_014780.4:c.3097G>Ap.Glu1033Lys | p.E1033KNM_001168370.1:c.3349G>A, NM_014780.3:c.3097G>A, NM_014780.4:c.3097G>A, XM_005249503.1:c.3253G>AVOUS07/03/2018
67CUL7Ex17NM_014780.4:c.3253C>Tp.Arg1085Cys | p.R1085CNM_001168370.1:c.3505C>T, NM_014780.3:c.3253C>T, NM_014780.4:c.3253C>T, XM_005249503.1:c.3409C>TVOUS06/12/2020
68CUL7Ex17NM_014780.4:c.3273G>Ap.Ser1091= | p.S1091=NM_001168370.1:c.3525G>A, NM_014780.3:c.3273G>A, NM_014780.4:c.3273G>A, XM_005249503.1:c.3429G>AVOUS09/08/2015
69CUL7Ex18NM_014780.4:c.3401G>Ap.Gly1134Asp | p.G1134DNM_001168370.1:c.3653G>A, NM_014780.3:c.3401G>A, NM_014780.4:c.3401G>A, XM_005249503.1:c.3557G>AVOUS08/04/2020
70CUL7Ex18NM_014780.4:c.3432G>Ap.Thr1144= | p.T1144=NM_001168370.1:c.3684G>A, NM_014780.3:c.3432G>A, NM_014780.4:c.3432G>A, XM_005249503.1:c.3588G>AVOUS09/18/2018
71CUL7Ex19NM_014780.4:c.3490C>Tp.Arg1164Trp | p.R1164WNM_001168370.1:c.3742C>T, NM_014780.3:c.3490C>T, NM_014780.4:c.3490C>T, XM_005249503.1:c.3646C>TBenign04/21/2015 
72CUL7Ex19NM_014780.4:c.3548G>Tp.Ser1183Ile | p.S1183INM_001168370.1:c.3800G>T, NM_014780.3:c.3548G>T, NM_014780.4:c.3548G>T, XM_005249503.1:c.3704G>TVOUS03/15/2021
73CUL7Ex19NM_014780.4:c.3610G>Ap.Ala1204Thr | p.A1204TNM_001168370.1:c.3862G>A, NM_014780.3:c.3610G>A, NM_014780.4:c.3610G>A, XM_005249503.1:c.3766G>AVOUS02/06/2017
74CUL7Ex20NM_014780.4:c.3695G>Ap.Arg1232Gln | p.R1232QNM_001168370.1:c.3947G>A, NM_014780.3:c.3695G>A, NM_014780.4:c.3695G>A, XM_005249503.1:c.3851G>ABenign07/17/2015 
75CUL7Ex20NM_014780.4:c.3747G>Ap.Leu1249= | p.L1249=NM_001168370.1:c.3999G>A, NM_014780.3:c.3747G>A, NM_014780.4:c.3747G>A, XM_005249503.1:c.3903G>AVOUS08/19/2015
76CUL7Ex20NM_014780.4:c.3769G>Ap.Gly1257Ser | p.G1257SNM_001168370.1:c.4021G>A, NM_014780.3:c.3769G>A, NM_014780.4:c.3769G>A, XM_005249503.1:c.3925G>AVOUS07/28/2017
77CUL7Ex21NM_014780.4:c.3834C>Tp.Gly1278= | p.G1278=NM_001168370.1:c.4086C>T, NM_014780.3:c.3834C>T, NM_014780.4:c.3834C>T, XM_005249503.1:c.3990C>TVOUS11/17/2015
78CUL7Ex21NM_014780.4:c.3861C>Tp.Ala1287= | p.A1287=NM_001168370.1:c.4113C>T, NM_014780.3:c.3861C>T, NM_014780.4:c.3861C>T, XM_005249503.1:c.4017C>TVOUS07/07/2016
79CUL7Ex21NM_014780.4:c.3876C>Tp.Ile1292= | p.I1292=NM_001168370.1:c.4128C>T, NM_014780.3:c.3876C>T, NM_014780.4:c.3876C>T, XM_005249503.1:c.4032C>TLikely benign10/13/2016 
80CUL7Ex21NM_014780.4:c.4003G>Cp.Asp1335His | p.D1335HNM_001168370.1:c.4255G>C, NM_014780.3:c.4003G>C, NM_014780.4:c.4003G>C, XM_005249503.1:c.4159G>CVOUS02/02/2017
81CUL7Ex22NM_014780.4:c.4068A>Gp.Glu1356= | p.E1356=NM_001168370.1:c.4320A>G, NM_014780.3:c.4068A>G, NM_014780.4:c.4068A>G, XM_005249503.1:c.4224A>GVOUS04/15/2016
82CUL7Ex22NM_014780.4:c.4146T>Cp.Tyr1382= | p.Y1382=NM_001168370.1:c.4398T>C, NM_014780.3:c.4146T>C, NM_014780.4:c.4146T>C, XM_005249503.1:c.4302T>CVOUS06/23/2015
83CUL7Ex22NM_014780.4:c.4258G>Ap.Gly1420Ser | p.G1420SNM_001168370.1:c.4510G>A, NM_014780.3:c.4258G>A, NM_014780.4:c.4258G>A, XM_005249503.1:c.4414G>AVOUS04/22/2019
84CUL7Ex23NM_014780.4:c.4318C>Tp.Arg1440* | p.R1440XNM_001168370.1:c.4570C>T, NM_014780.3:c.4318C>T, NM_014780.4:c.4318C>T, XM_005249503.1:c.4474C>T, XR_108651.1:n.-4559C>TPathogenic06/15/2016 
85CUL7Ex23NM_014780.4:c.4419G>Ap.Leu1473= | p.L1473=NM_001168370.1:c.4671G>A, NM_014780.3:c.4419G>A, NM_014780.4:c.4419G>A, XM_005249503.1:c.4575G>A, XR_108651.1:n.-4458G>AVOUS08/31/2017
86CUL7Ex23NM_014780.4:c.4431C>Tp.Asn1477= | p.N1477=NM_001168370.1:c.4683C>T, NM_014780.3:c.4431C>T, NM_014780.4:c.4431C>T, XM_005249503.1:c.4587C>T, XR_108651.1:n.-4446C>TVOUS09/04/2020
87CUL7Ex23NM_014780.4:c.4440+3G>AVOUS01/21/2020
88CUL7Ex24NM_014780.4:c.4467G>Ap.Ala1489= | p.A1489=NM_001168370.1:c.4719G>A, NM_014780.3:c.4467G>A, NM_014780.4:c.4467G>A, XM_005249503.1:c.4623G>A, XR_108651.1:n.-4261G>AVOUS12/16/2019
89CUL7Ex24NM_014780.4:c.4482C>Tp.Ser1494= | p.S1494=NM_001168370.1:c.4734C>T, NM_014780.3:c.4482C>T, NM_014780.4:c.4482C>T, XM_005249503.1:c.4638C>T, XR_108651.1:n.-4246C>TVOUS04/07/2016
90CUL7Ex25NM_014780.4:c.4625G>Ap.Arg1542Gln | p.R1542QNM_001168370.1:c.4877G>A, NM_014780.3:c.4625G>A, NM_014780.4:c.4625G>A, XM_005249503.1:c.4781G>A, XR_108651.1:n.-4010G>AVOUS06/11/2018
91CUL7Ex25NM_014780.4:c.4659G>Ap.Glu1553= | p.E1553=NM_001168370.1:c.4911G>A, NM_014780.3:c.4659G>A, NM_014780.4:c.4659G>A, XM_005249503.1:c.4815G>A, XR_108651.1:n.-3976G>AVOUS10/24/2018
92CUL7Ex25NM_014780.4:c.4693A>Tp.Asn1565Tyr | p.N1565YNM_001168370.1:c.4945A>T, NM_014780.3:c.4693A>T, NM_014780.4:c.4693A>T, XM_005249503.1:c.4849A>T, XR_108651.1:n.-3942A>TVOUS09/18/2020
93CUL7Ex25NM_014780.4:c.4713C>Tp.Ile1571= | p.I1571=NM_001168370.1:c.4965C>T, NM_014780.3:c.4713C>T, NM_014780.4:c.4713C>T, XM_005249503.1:c.4869C>T, XR_108651.1:n.-3922C>TVOUS01/17/2015
94CUL7Ex25NM_014780.4:c.4717C>Tp.Arg1573* | p.R1573XNM_001168370.1:c.4969C>T, NM_014780.3:c.4717C>T, NM_014780.4:c.4717C>T, XM_005249503.1:c.4873C>T, XR_108651.1:n.-3918C>TPathogenic12/22/2014 
95CUL7Ex25NM_014780.4:c.4762C>Ap.Leu1588Ile | p.L1588INM_001168370.1:c.5014C>A, NM_014780.3:c.4762C>A, NM_014780.4:c.4762C>A, XM_005249503.1:c.4918C>A, XR_108651.1:n.-3873C>ABenign06/04/2014 
96CUL7Ex25NM_014780.4:c.4773+1G>ALikely pathogenic05/30/2019 
97CUL7Ex26NM_014780.4:c.4898C>Tp.Thr1633Met | p.T1633MNM_001168370.1:c.5150C>T, NM_014780.3:c.4898C>T, NM_014780.4:c.4898C>T, XM_005249503.1:c.5054C>T, XR_108651.1:n.-3482C>TBenign11/06/2015 
98CUL7Ex26NM_014780.4:c.4914C>Tp.Asp1638= | p.D1638=NM_001168370.1:c.5166C>T, NM_014780.3:c.4914C>T, NM_014780.4:c.4914C>T, XM_005249503.1:c.5070C>T, XR_108651.1:n.-3466C>TLikely benign06/15/2017 
99CUL7Ex26NM_014780.4:c.4936T>Cp.Tyr1646His | p.Y1646HNM_001168370.1:c.5188T>C, NM_014780.3:c.4936T>C, NM_014780.4:c.4936T>C, XM_005249503.1:c.5092T>C, XR_108651.1:n.-3444T>CVOUS08/25/2017
100CUL7Ex26NM_014780.4:c.5041C>Gp.Arg1681Gly | p.R1681GNM_001168370.1:c.5293C>G, NM_014780.3:c.5041C>G, NM_014780.4:c.5041C>G, XM_005249503.1:c.5197C>G, XR_108651.1:n.-3339C>GVOUS04/23/2019
101CUL7Ex26NM_014780.4:c.5080T>Gp.Phe1694Val | p.F1694VNM_001168370.1:c.5332T>G, NM_014780.3:c.5080T>G, NM_014780.4:c.5080T>G, XM_005249503.1:c.5236T>G, XR_108651.1:n.-3300T>GVOUS03/28/2016
102CUL7Ex26NM_014780.4:c.5088C>Tp.Thr1696= | p.T1696=NM_001168370.1:c.5340C>T, NM_014780.3:c.5088C>T, NM_014780.4:c.5088C>T, XM_005249503.1:c.5244C>T, XR_108651.1:n.-3292C>TBenign08/28/2015 

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.