Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1COL6A3Ex2NM_004369.3:c.11A>Tp.His4Leu | p.H4LNM_004369.3:c.11A>T, NM_057164.3:c.11A>T, NM_057164.4:c.11A>T, NM_057165.3:c.11A>T, NM_057165.4:c.11A>T, NM_057166.3:c.11A>T, NM_057166.4:c.11A>T, NM_057167.3:c.11A>T, XM_005246065.1:c.11A>T, XM_005246066.1:c.11A>T, XM_005246067.1:c.11A>T, XM_005246068.1:c.11A>TVOUS08/17/2015
2COL6A3Ex2NM_004369.3:c.29T>Cp.Val10Ala | p.V10ALRG_473t1:c.29T>C, NM_004369.3:c.29T>C, NM_057164.3:c.29T>C, NM_057164.4:c.29T>C, NM_057165.3:c.29T>C, NM_057165.4:c.29T>C, NM_057166.3:c.29T>C, NM_057166.4:c.29T>C, NM_057167.3:c.29T>C, XM_005246065.1:c.29T>C, XM_005246066.1:c.29T>C, XM_005246067.1:c.29T>C, XM_005246068.1:c.29T>CVOUS04/26/2018
3COL6A3Ex2NM_004369.3:c.34G>Tp.Val12Phe | p.V12FLRG_473t1:c.34G>T, NM_004369.3:c.34G>T, NM_057164.3:c.34G>T, NM_057164.4:c.34G>T, NM_057165.3:c.34G>T, NM_057165.4:c.34G>T, NM_057166.3:c.34G>T, NM_057166.4:c.34G>T, NM_057167.3:c.34G>T, XM_005246065.1:c.34G>T, XM_005246066.1:c.34G>T, XM_005246067.1:c.34G>T, XM_005246068.1:c.34G>TVOUS07/18/2016
4COL6A3Ex2NM_004369.3:c.34G>Ap.Val12Ile | p.V12ILRG_473t1:c.34G>A, NM_004369.3:c.34G>A, NM_057164.3:c.34G>A, NM_057164.4:c.34G>A, NM_057165.3:c.34G>A, NM_057165.4:c.34G>A, NM_057166.3:c.34G>A, NM_057166.4:c.34G>A, NM_057167.3:c.34G>A, XM_005246065.1:c.34G>A, XM_005246066.1:c.34G>A, XM_005246067.1:c.34G>A, XM_005246068.1:c.34G>ALikely benign10/13/2017 
5COL6A3Ex2NM_004369.3:c.74C>Ap.Ala25Asp | p.A25DVOUS11/05/2012
6COL6A3Ex2NM_004369.3:c.76C>Tp.Gln26* | p.Q26XLRG_473t1:c.76C>T, NM_004369.3:c.76C>T, NM_057164.3:c.76C>T, NM_057164.4:c.76C>T, NM_057165.3:c.76C>T, NM_057165.4:c.76C>T, NM_057166.3:c.76C>T, NM_057166.4:c.76C>T, NM_057167.3:c.76C>T, XM_005246065.1:c.76C>T, XM_005246066.1:c.76C>T, XM_005246067.1:c.76C>T, XM_005246068.1:c.76C>TPathogenic10/03/2018 
7COL6A3Ex3NM_004369.3:c.107C>Tp.Ala36Val | p.A36VNM_004369.3:c.107C>T, NM_057164.3:c.107C>T, NM_057164.4:c.91+1538C>T, NM_057165.3:c.107C>T, NM_057165.4:c.91+1538C>T, NM_057166.3:c.107C>T, NM_057166.4:c.91+1538C>T, NM_057167.3:c.91+1538C>T, XM_005246065.1:c.107C>T, XM_005246066.1:c.91+1538C>T, XM_005246067.1:c.91+1538C>T, XM_005246068.1:c.91+1538C>TVOUS01/14/2016
8COL6A3Ex3NM_004369.3:c.108G>Tp.Ala36= | p.A36=LRG_473t1:c.108G>T, NM_004369.3:c.108G>T, NM_057164.3:c.108G>T, NM_057164.4:c.91+1539G>T, NM_057165.3:c.108G>T, NM_057165.4:c.91+1539G>T, NM_057166.3:c.108G>T, NM_057166.4:c.91+1539G>T, NM_057167.3:c.91+1539G>T, XM_005246065.1:c.108G>T, XM_005246066.1:c.91+1539G>T, XM_005246067.1:c.91+1539G>T, XM_005246068.1:c.91+1539G>TVOUS11/21/2018
9COL6A3Ex3NM_004369.3:c.121_123delATANM_004369.3:c.121_123delATA, NM_057164.3:c.121_123delATA, NM_057164.4:c.91+1552_91+1554delATA, NM_057165.3:c.121_123delATA, NM_057165.4:c.91+1552_91+1554delATA, NM_057166.3:c.121_123delATA, NM_057166.4:c.91+1552_91+1554delATA, NM_057167.3:c.91+1552_91+1554delATA, XM_005246065.1:c.121_123delATA, XM_005246066.1:c.91+1552_91+1554delATA, XM_005246067.1:c.91+1552_91+1554delATA, XM_005246068.1:c.91+1552_91+1554delATAVOUS07/30/2015
10COL6A3Ex3NM_004369.3:c.124T>Gp.Phe42Val | p.F42VLRG_473t1:c.124T>G, NM_004369.3:c.124T>G, NM_057164.3:c.124T>G, NM_057164.4:c.91+1555T>G, NM_057165.3:c.124T>G, NM_057165.4:c.91+1555T>G, NM_057166.3:c.124T>G, NM_057166.4:c.91+1555T>G, NM_057167.3:c.91+1555T>G, XM_005246065.1:c.124T>G, XM_005246066.1:c.91+1555T>G, XM_005246067.1:c.91+1555T>G, XM_005246068.1:c.91+1555T>GVOUS01/25/2018
11COL6A3Ex3NM_004369.3:c.175C>Tp.Arg59* | p.R59XLRG_473t1:c.175C>T, NM_004369.3:c.175C>T, NM_057164.3:c.175C>T, NM_057164.4:c.91+1606C>T, NM_057165.3:c.175C>T, NM_057165.4:c.91+1606C>T, NM_057166.3:c.175C>T, NM_057166.4:c.91+1606C>T, NM_057167.3:c.91+1606C>T, XM_005246065.1:c.175C>T, XM_005246066.1:c.91+1606C>T, XM_005246067.1:c.91+1606C>T, XM_005246068.1:c.91+1606C>TPathogenic11/05/2012 
12COL6A3Ex3NM_004369.3:c.188A>Gp.Tyr63Cys | p.Y63CNM_004369.3:c.188A>G, NM_057164.3:c.188A>G, NM_057164.4:c.91+1619A>G, NM_057165.3:c.188A>G, NM_057165.4:c.91+1619A>G, NM_057166.3:c.188A>G, NM_057166.4:c.91+1619A>G, NM_057167.3:c.91+1619A>G, XM_005246065.1:c.188A>G, XM_005246066.1:c.91+1619A>G, XM_005246067.1:c.91+1619A>G, XM_005246068.1:c.91+1619A>GVOUS01/06/2016
13COL6A3Ex3NM_004369.3:c.252C>Tp.Asn84= | p.N84=LRG_473t1:c.252C>T, NM_004369.3:c.252C>T, NM_057164.3:c.252C>T, NM_057164.4:c.91+1683C>T, NM_057165.3:c.252C>T, NM_057165.4:c.91+1683C>T, NM_057166.3:c.252C>T, NM_057166.4:c.91+1683C>T, NM_057167.3:c.91+1683C>T, XM_005246065.1:c.252C>T, XM_005246066.1:c.91+1683C>T, XM_005246067.1:c.91+1683C>T, XM_005246068.1:c.91+1683C>TVOUS06/19/2016
14COL6A3Ex3NM_004369.3:c.273C>Tp.Phe91= | p.F91=NM_004369.3:c.273C>T, NM_057164.3:c.273C>T, NM_057164.4:c.91+1704C>T, NM_057165.3:c.273C>T, NM_057165.4:c.91+1704C>T, NM_057166.3:c.273C>T, NM_057166.4:c.91+1704C>T, NM_057167.3:c.91+1704C>T, XM_005246065.1:c.273C>T, XM_005246066.1:c.91+1704C>T, XM_005246067.1:c.91+1704C>T, XM_005246068.1:c.91+1704C>TVOUS11/02/2015
15COL6A3Ex3NM_004369.3:c.284C>Tp.Thr95Met | p.T95MLRG_473t1:c.284C>T, NM_004369.3:c.284C>T, NM_057164.3:c.284C>T, NM_057164.4:c.91+1715C>T, NM_057165.3:c.284C>T, NM_057165.4:c.91+1715C>T, NM_057166.3:c.284C>T, NM_057166.4:c.91+1715C>T, NM_057167.3:c.91+1715C>T, XM_005246065.1:c.284C>T, XM_005246066.1:c.91+1715C>T, XM_005246067.1:c.91+1715C>T, XM_005246068.1:c.91+1715C>TVOUS09/25/2016
16COL6A3Ex3NM_004369.3:c.285G>Ap.Thr95= | p.T95=LRG_473t1:c.285G>A, NM_004369.3:c.285G>A, NM_057164.3:c.285G>A, NM_057164.4:c.91+1716G>A, NM_057165.3:c.285G>A, NM_057165.4:c.91+1716G>A, NM_057166.3:c.285G>A, NM_057166.4:c.91+1716G>A, NM_057167.3:c.91+1716G>A, XM_005246065.1:c.285G>A, XM_005246066.1:c.91+1716G>A, XM_005246067.1:c.91+1716G>A, XM_005246068.1:c.91+1716G>AVOUS01/20/2017
17COL6A3Ex3NM_004369.3:c.290G>Ap.Arg97His | p.R97HLRG_473t1:c.290G>A, NM_004369.3:c.290G>A, NM_057164.3:c.290G>A, NM_057164.4:c.91+1721G>A, NM_057165.3:c.290G>A, NM_057165.4:c.91+1721G>A, NM_057166.3:c.290G>A, NM_057166.4:c.91+1721G>A, NM_057167.3:c.91+1721G>A, XM_005246065.1:c.290G>A, XM_005246066.1:c.91+1721G>A, XM_005246067.1:c.91+1721G>A, XM_005246068.1:c.91+1721G>AVOUS07/23/2015
18COL6A3Ex3NM_004369.3:c.292A>Tp.Thr98Ser | p.T98SLRG_473t1:c.292A>T, NM_004369.3:c.292A>TLikely benign12/29/2016 
19COL6A3Ex3NM_004369.3:c.374T>Cp.Ile125Thr | p.I125TLRG_473t1:c.374T>C, NM_004369.3:c.374T>C, NM_057164.3:c.374T>C, NM_057164.4:c.91+1805T>C, NM_057165.3:c.374T>C, NM_057165.4:c.91+1805T>C, NM_057166.3:c.374T>C, NM_057166.4:c.91+1805T>C, NM_057167.3:c.91+1805T>C, XM_005246065.1:c.374T>C, XM_005246066.1:c.91+1805T>C, XM_005246067.1:c.91+1805T>C, XM_005246068.1:c.91+1805T>CVOUS08/09/2016
20COL6A3Ex3NM_004369.3:c.409C>Tp.Arg137Trp | p.R137WLRG_473t1:c.409C>T, NM_004369.3:c.409C>T, NM_057164.3:c.409C>T, NM_057164.4:c.91+1840C>T, NM_057165.3:c.409C>T, NM_057165.4:c.91+1840C>T, NM_057166.3:c.409C>T, NM_057166.4:c.91+1840C>T, NM_057167.3:c.91+1840C>T, XM_005246065.1:c.409C>T, XM_005246066.1:c.91+1840C>T, XM_005246067.1:c.91+1840C>T, XM_005246068.1:c.91+1840C>TVOUS12/18/2018
21COL6A3Ex3NM_004369.3:c.410G>Ap.Arg137Gln | p.R137QNM_004369.3:c.410G>A, NM_057164.3:c.410G>A, NM_057164.4:c.91+1841G>A, NM_057165.3:c.410G>A, NM_057165.4:c.91+1841G>A, NM_057166.3:c.410G>A, NM_057166.4:c.91+1841G>A, NM_057167.3:c.91+1841G>A, XM_005246065.1:c.410G>A, XM_005246066.1:c.91+1841G>A, XM_005246067.1:c.91+1841G>A, XM_005246068.1:c.91+1841G>AVOUS11/10/2014
22COL6A3Ex3NM_004369.3:c.414C>Tp.Ala138= | p.A138=LRG_473t1:c.414C>T, NM_004369.3:c.414C>T, NM_057164.3:c.414C>T, NM_057164.4:c.91+1845C>T, NM_057165.3:c.414C>T, NM_057165.4:c.91+1845C>T, NM_057166.3:c.414C>T, NM_057166.4:c.91+1845C>T, NM_057167.3:c.91+1845C>T, XM_005246065.1:c.414C>T, XM_005246066.1:c.91+1845C>T, XM_005246067.1:c.91+1845C>T, XM_005246068.1:c.91+1845C>TVOUS02/01/2017
23COL6A3Ex3NM_004369.3:c.415G>Ap.Gly139Ser | p.G139SLRG_473t1:c.415G>A, NM_004369.3:c.415G>A, NM_057164.3:c.415G>A, NM_057164.4:c.91+1846G>A, NM_057165.3:c.415G>A, NM_057165.4:c.91+1846G>A, NM_057166.3:c.415G>A, NM_057166.4:c.91+1846G>A, NM_057167.3:c.91+1846G>A, XM_005246065.1:c.415G>A, XM_005246066.1:c.91+1846G>A, XM_005246067.1:c.91+1846G>A, XM_005246068.1:c.91+1846G>AVOUS08/04/2016
24COL6A3Ex3NM_004369.3:c.421G>Ap.Gly141Arg | p.G141RLRG_473t1:c.421G>A, NM_004369.3:c.421G>A, NM_057164.3:c.421G>A, NM_057164.4:c.91+1852G>A, NM_057165.3:c.421G>A, NM_057165.4:c.91+1852G>A, NM_057166.3:c.421G>A, NM_057166.4:c.91+1852G>A, NM_057167.3:c.91+1852G>A, XM_005246065.1:c.421G>A, XM_005246066.1:c.91+1852G>A, XM_005246067.1:c.91+1852G>A, XM_005246068.1:c.91+1852G>AVOUS11/05/2012
25COL6A3Ex3NM_004369.3:c.426C>Tp.Val142= | p.V142=LRG_473t1:c.426C>T, NM_004369.3:c.426C>T, NM_057164.3:c.426C>T, NM_057164.4:c.91+1857C>T, NM_057165.3:c.426C>T, NM_057165.4:c.91+1857C>T, NM_057166.3:c.426C>T, NM_057166.4:c.91+1857C>T, NM_057167.3:c.91+1857C>T, XM_005246065.1:c.426C>T, XM_005246066.1:c.91+1857C>T, XM_005246067.1:c.91+1857C>T, XM_005246068.1:c.91+1857C>TVOUS08/13/2018
26COL6A3Ex3NM_004369.3:c.438C>Tp.Ile146= | p.I146=LRG_473t1:c.438C>T, NM_004369.3:c.438C>T, NM_057164.3:c.438C>T, NM_057164.4:c.91+1869C>T, NM_057165.3:c.438C>T, NM_057165.4:c.91+1869C>T, NM_057166.3:c.438C>T, NM_057166.4:c.91+1869C>T, NM_057167.3:c.91+1869C>T, XM_005246065.1:c.438C>T, XM_005246066.1:c.91+1869C>T, XM_005246067.1:c.91+1869C>T, XM_005246068.1:c.91+1869C>TVOUS06/08/2016
27COL6A3Ex3NM_004369.3:c.461C>Tp.Ser154Leu | p.S154LLRG_473t1:c.461C>T, NM_004369.3:c.461C>T, NM_057164.3:c.461C>T, NM_057164.4:c.91+1892C>T, NM_057165.3:c.461C>T, NM_057165.4:c.91+1892C>T, NM_057166.3:c.461C>T, NM_057166.4:c.91+1892C>T, NM_057167.3:c.91+1892C>T, XM_005246065.1:c.461C>T, XM_005246066.1:c.91+1892C>T, XM_005246067.1:c.91+1892C>T, XM_005246068.1:c.91+1892C>TVOUS10/05/2016
28COL6A3Ex3NM_004369.3:c.466G>Tp.Asp156Tyr | p.D156YLRG_473t1:c.466G>T, NM_004369.3:c.466G>T, NM_057164.3:c.466G>T, NM_057164.4:c.91+1897G>T, NM_057165.3:c.466G>T, NM_057165.4:c.91+1897G>T, NM_057166.3:c.466G>T, NM_057166.4:c.91+1897G>T, NM_057167.3:c.91+1897G>T, XM_005246065.1:c.466G>T, XM_005246066.1:c.91+1897G>T, XM_005246067.1:c.91+1897G>T, XM_005246068.1:c.91+1897G>TVOUS08/02/2018
29COL6A3Ex3NM_004369.3:c.467A>Cp.Asp156Ala | p.D156ALRG_473t1:c.467A>C, NM_004369.3:c.467A>C, NM_057164.3:c.467A>C, NM_057164.4:c.91+1898A>C, NM_057165.3:c.467A>C, NM_057165.4:c.91+1898A>C, NM_057166.3:c.467A>C, NM_057166.4:c.91+1898A>C, NM_057167.3:c.91+1898A>C, XM_005246065.1:c.467A>C, XM_005246066.1:c.91+1898A>C, XM_005246067.1:c.91+1898A>C, XM_005246068.1:c.91+1898A>CVOUS05/02/2017
30COL6A3Ex3NM_004369.3:c.489G>Ap.Ala163= | p.A163=LRG_473t1:c.489G>A, NM_004369.3:c.489G>A, NM_057164.3:c.489G>A, NM_057164.4:c.91+1920G>A, NM_057165.3:c.489G>A, NM_057165.4:c.91+1920G>A, NM_057166.3:c.489G>A, NM_057166.4:c.91+1920G>A, NM_057167.3:c.91+1920G>A, XM_005246065.1:c.489G>A, XM_005246066.1:c.91+1920G>A, XM_005246067.1:c.91+1920G>A, XM_005246068.1:c.91+1920G>AVOUS10/04/2018
31COL6A3Ex3NM_004369.3:c.543T>Cp.Asp181= | p.D181=LRG_473t1:c.543T>C, NM_004369.3:c.543T>C, NM_057164.3:c.543T>C, NM_057164.4:c.91+1974T>C, NM_057165.3:c.543T>C, NM_057165.4:c.91+1974T>C, NM_057166.3:c.543T>C, NM_057166.4:c.91+1974T>C, NM_057167.3:c.91+1974T>C, XM_005246065.1:c.543T>C, XM_005246066.1:c.91+1974T>C, XM_005246067.1:c.91+1974T>C, XM_005246068.1:c.91+1974T>CVOUS10/27/2017
32COL6A3Ex3NM_004369.3:c.550G>Ap.Ala184Thr | p.A184TLRG_473t1:c.550G>A, NM_004369.3:c.550G>A, NM_057164.3:c.550G>A, NM_057164.4:c.91+1981G>A, NM_057165.3:c.550G>A, NM_057165.4:c.91+1981G>A, NM_057166.3:c.550G>A, NM_057166.4:c.91+1981G>A, NM_057167.3:c.91+1981G>A, XM_005246065.1:c.550G>A, XM_005246066.1:c.91+1981G>A, XM_005246067.1:c.91+1981G>A, XM_005246068.1:c.91+1981G>AVOUS05/31/2018
33COL6A3Ex3NM_004369.3:c.552G>Ap.Ala184= | p.A184=LRG_473t1:c.552G>A, NM_004369.3:c.552G>A, NM_057164.3:c.552G>A, NM_057164.4:c.91+1983G>A, NM_057165.3:c.552G>A, NM_057165.4:c.91+1983G>A, NM_057166.3:c.552G>A, NM_057166.4:c.91+1983G>A, NM_057167.3:c.91+1983G>A, XM_005246065.1:c.552G>A, XM_005246066.1:c.91+1983G>A, XM_005246067.1:c.91+1983G>A, XM_005246068.1:c.91+1983G>AVOUS03/20/2017
34COL6A3Ex3NM_004369.3:c.575C>Tp.Pro192Leu | p.P192LLRG_473t1:c.575C>T, NM_004369.3:c.575C>T, NM_057164.3:c.575C>T, NM_057164.4:c.91+2006C>T, NM_057165.3:c.575C>T, NM_057165.4:c.91+2006C>T, NM_057166.3:c.575C>T, NM_057166.4:c.91+2006C>T, NM_057167.3:c.91+2006C>T, XM_005246065.1:c.575C>T, XM_005246066.1:c.91+2006C>T, XM_005246067.1:c.91+2006C>T, XM_005246068.1:c.91+2006C>TVOUS02/25/2016
35COL6A3Ex3NM_004369.3:c.576G>Tp.Pro192= | p.P192=LRG_473t1:c.576G>T, NM_004369.3:c.576G>T, NM_057164.3:c.576G>T, NM_057164.4:c.91+2007G>T, NM_057165.3:c.576G>T, NM_057165.4:c.91+2007G>T, NM_057166.3:c.576G>T, NM_057166.4:c.91+2007G>T, NM_057167.3:c.91+2007G>T, XM_005246065.1:c.576G>T, XM_005246066.1:c.91+2007G>T, XM_005246067.1:c.91+2007G>T, XM_005246068.1:c.91+2007G>TVOUS04/30/2018
36COL6A3Ex3NM_004369.3:c.592T>Gp.Phe198Val | p.F198VLRG_473t1:c.592T>G, NM_004369.3:c.592T>G, NM_057164.3:c.592T>G, NM_057164.4:c.91+2023T>G, NM_057165.3:c.592T>G, NM_057165.4:c.91+2023T>G, NM_057166.3:c.592T>G, NM_057166.4:c.91+2023T>G, NM_057167.3:c.91+2023T>G, XM_005246065.1:c.592T>G, XM_005246066.1:c.91+2023T>G, XM_005246067.1:c.91+2023T>G, XM_005246068.1:c.91+2023T>GVOUS08/10/2016
37COL6A3Ex3NM_004369.3:c.686C>Tp.Thr229Met | p.T229MLRG_473t1:c.686C>T, NM_004369.3:c.686C>T, NM_057164.3:c.686C>T, NM_057164.4:c.91+2117C>T, NM_057165.3:c.686C>T, NM_057165.4:c.91+2117C>T, NM_057166.3:c.686C>T, NM_057166.4:c.91+2117C>T, NM_057167.3:c.91+2117C>TVOUS05/18/2018
38COL6A3Ex3NM_004369.3:c.704T>Cp.Ile235Thr | p.I235TLRG_473t1:c.704T>C, NM_004369.3:c.704T>C, NM_057164.3:c.704T>C, NM_057164.4:c.91+2135T>C, NM_057165.3:c.704T>C, NM_057165.4:c.91+2135T>C, NM_057166.3:c.704T>C, NM_057166.4:c.91+2135T>C, NM_057167.3:c.91+2135T>C, XM_005246065.1:c.704T>C, XM_005246066.1:c.91+2135T>C, XM_005246067.1:c.91+2135T>C, XM_005246068.1:c.91+2135T>CVOUS01/04/2016
39COL6A3Ex3NM_004369.3:c.707C>Tp.Thr236Ile | p.T236ILRG_473t1:c.707C>T, NM_004369.3:c.707C>T, NM_057164.3:c.707C>T, NM_057164.4:c.91+2138C>T, NM_057165.3:c.707C>T, NM_057165.4:c.91+2138C>T, NM_057166.3:c.707C>T, NM_057166.4:c.91+2138C>T, NM_057167.3:c.91+2138C>T, XM_005246065.1:c.707C>T, XM_005246066.1:c.91+2138C>T, XM_005246067.1:c.91+2138C>T, XM_005246068.1:c.91+2138C>TVOUS02/24/2017
40COL6A3Ex3NM_004369.3:c.709+8C>TLRG_473t1:c.709+8C>T, NM_004369.3:c.709+8C>T, NM_057164.3:c.709+8C>T, NM_057164.4:c.91+2148C>T, NM_057165.3:c.709+8C>T, NM_057165.4:c.91+2148C>T, NM_057166.3:c.709+8C>T, NM_057166.4:c.91+2148C>T, NM_057167.3:c.91+2148C>T, XM_005246065.1:c.709+8C>T, XM_005246066.1:c.91+2148C>T, XM_005246067.1:c.91+2148C>T, XM_005246068.1:c.91+2148C>TVOUS06/15/2018
41COL6A3Ex4NM_004369.3:c.730A>Gp.Ile244Val | p.I244VNM_004369.3:c.730A>G, NM_057164.3:c.730A>G, NM_057164.4:c.92-6665A>G, NM_057165.3:c.730A>G, NM_057165.4:c.112A>G, NM_057166.3:c.709+6423A>G, NM_057166.4:c.92-6665A>G, NM_057167.3:c.112A>GBenign11/05/2012 
42COL6A3Ex4NM_004369.3:c.758C>Ap.Thr253Asn | p.T253NNM_004369.3:c.758C>A, NM_057164.3:c.758C>A, NM_057164.4:c.92-6637C>A, NM_057165.3:c.758C>A, NM_057165.4:c.140C>A, NM_057166.3:c.709+6451C>A, NM_057166.4:c.92-6637C>A, NM_057167.3:c.140C>A, XM_005246065.1:c.758C>A, XM_005246066.1:c.92-6637C>A, XM_005246067.1:c.92-6637C>A, XM_005246068.1:c.92-6637C>AVOUS09/09/2015
43COL6A3Ex4NM_004369.3:c.759C>Tp.Thr253= | p.T253=LRG_473t1:c.759C>T, NM_004369.3:c.759C>T, NM_057164.3:c.759C>T, NM_057164.4:c.92-6636C>T, NM_057165.3:c.759C>T, NM_057165.4:c.141C>T, NM_057166.3:c.709+6452C>T, NM_057166.4:c.92-6636C>T, NM_057167.3:c.141C>T, XM_005246065.1:c.759C>T, XM_005246066.1:c.92-6636C>T, XM_005246067.1:c.92-6636C>T, XM_005246068.1:c.92-6636C>TVOUS05/07/2019
44COL6A3Ex4NM_004369.3:c.761delGLRG_473t1:c.761delG, NM_004369.3:c.761delG, NM_057164.3:c.761delG, NM_057164.4:c.92-6634delG, NM_057165.3:c.761delG, NM_057165.4:c.143delG, NM_057166.3:c.709+6454delG, NM_057166.4:c.92-6634delG, NM_057167.3:c.143delG, XM_005246065.1:c.761delG, XM_005246066.1:c.92-6634delG, XM_005246067.1:c.92-6634delG, XM_005246068.1:c.92-6634delGPathogenic03/16/2016 
45COL6A3Ex4NM_004369.3:c.768C>Tp.Val256= | p.V256=Benign10/16/2012 
46COL6A3Ex4NM_004369.3:c.774C>Tp.Phe258= | p.F258=NM_004369.3:c.774C>T, NM_057164.3:c.774C>T, NM_057164.4:c.92-6621C>T, NM_057165.3:c.774C>T, NM_057165.4:c.156C>T, NM_057166.3:c.709+6467C>T, NM_057166.4:c.92-6621C>T, NM_057167.3:c.156C>T, XM_005246065.1:c.774C>T, XM_005246066.1:c.92-6621C>T, XM_005246067.1:c.92-6621C>T, XM_005246068.1:c.92-6621C>TVOUS01/18/2016
47COL6A3Ex4NM_004369.3:c.775G>Ap.Ala259Thr | p.A259TNM_004369.3:c.775G>A, NM_057164.3:c.775G>A, NM_057164.4:c.92-6620G>A, NM_057165.3:c.775G>A, NM_057165.4:c.157G>A, NM_057166.3:c.709+6468G>A, NM_057166.4:c.92-6620G>A, NM_057167.3:c.157G>A, XM_005246065.1:c.775G>A, XM_005246066.1:c.92-6620G>A, XM_005246067.1:c.92-6620G>A, XM_005246068.1:c.92-6620G>ABenign05/13/2014 
48COL6A3Ex4NM_004369.3:c.776C>Tp.Ala259Val | p.A259VLRG_473t1:c.776C>T, NM_004369.3:c.776C>T, NM_057164.3:c.776C>T, NM_057164.4:c.92-6619C>T, NM_057165.3:c.776C>T, NM_057165.4:c.158C>T, NM_057166.3:c.709+6469C>T, NM_057166.4:c.92-6619C>T, NM_057167.3:c.158C>T, XM_005246065.1:c.776C>T, XM_005246066.1:c.92-6619C>T, XM_005246067.1:c.92-6619C>T, XM_005246068.1:c.92-6619C>TVOUS06/07/2018
49COL6A3Ex4NM_004369.3:c.786C>Tp.Leu262= | p.L262=LRG_473t1:c.786C>T, NM_004369.3:c.786C>T, NM_057164.3:c.786C>T, NM_057164.4:c.92-6609C>T, NM_057165.3:c.786C>T, NM_057165.4:c.168C>T, NM_057166.3:c.709+6479C>T, NM_057166.4:c.92-6609C>T, NM_057167.3:c.168C>T, XM_005246065.1:c.786C>T, XM_005246066.1:c.92-6609C>T, XM_005246067.1:c.92-6609C>T, XM_005246068.1:c.92-6609C>TVOUS08/09/2016
50COL6A3Ex4NM_004369.3:c.802C>Tp.Leu268Phe | p.L268FLRG_473t1:c.802C>T, NM_004369.3:c.802C>T, NM_057164.3:c.802C>T, NM_057164.4:c.92-6593C>T, NM_057165.3:c.802C>T, NM_057165.4:c.184C>T, NM_057166.3:c.709+6495C>T, NM_057166.4:c.92-6593C>T, NM_057167.3:c.184C>T, XM_005246065.1:c.802C>T, XM_005246066.1:c.92-6593C>T, XM_005246067.1:c.92-6593C>T, XM_005246068.1:c.92-6593C>TVOUS02/28/2017
51COL6A3Ex4NM_004369.3:c.804C>Gp.Leu268= | p.L268=NM_004369.3:c.804C>G, NM_057164.3:c.804C>G, NM_057164.4:c.92-6591C>G, NM_057165.3:c.804C>G, NM_057165.4:c.186C>G, NM_057166.3:c.709+6497C>G, NM_057166.4:c.92-6591C>G, NM_057167.3:c.186C>G, XM_005246065.1:c.804C>G, XM_005246066.1:c.92-6591C>G, XM_005246067.1:c.92-6591C>G, XM_005246068.1:c.92-6591C>GVOUS01/22/2016
52COL6A3Ex4NM_004369.3:c.839G>Tp.Arg280Leu | p.R280LLRG_473t1:c.839G>T, NM_004369.3:c.839G>T, NM_057164.3:c.839G>T, NM_057164.4:c.92-6556G>T, NM_057165.3:c.839G>T, NM_057165.4:c.221G>T, NM_057166.3:c.709+6532G>T, NM_057166.4:c.92-6556G>T, NM_057167.3:c.221G>T, XM_005246065.1:c.839G>T, XM_005246066.1:c.92-6556G>T, XM_005246067.1:c.92-6556G>T, XM_005246068.1:c.92-6556G>TVOUS05/02/2017
53COL6A3Ex4NM_004369.3:c.843G>Tp.Val281= | p.V281=LRG_473t1:c.843G>T, NM_004369.3:c.843G>T, NM_057164.3:c.843G>T, NM_057164.4:c.92-6552G>T, NM_057165.3:c.843G>T, NM_057165.4:c.225G>T, NM_057166.3:c.709+6536G>T, NM_057166.4:c.92-6552G>T, NM_057167.3:c.225G>T, XM_005246065.1:c.843G>T, XM_005246066.1:c.92-6552G>T, XM_005246067.1:c.92-6552G>T, XM_005246068.1:c.92-6552G>TVOUS01/17/2019
54COL6A3Ex4NM_004369.3:c.861C>Tp.Ser287= | p.S287=LRG_473t1:c.861C>T, NM_004369.3:c.861C>T, NM_057164.3:c.861C>T, NM_057164.4:c.92-6534C>T, NM_057165.3:c.861C>T, NM_057165.4:c.243C>T, NM_057166.3:c.710-6534C>T, NM_057166.4:c.92-6534C>T, NM_057167.3:c.243C>T, XM_005246065.1:c.861C>T, XM_005246066.1:c.92-6534C>T, XM_005246067.1:c.92-6534C>T, XM_005246068.1:c.92-6534C>TVOUS07/26/2016
55COL6A3Ex4NM_004369.3:c.862G>Ap.Asp288Asn | p.D288NNM_004369.3:c.862G>A, NM_057164.3:c.862G>A, NM_057164.4:c.92-6533G>A, NM_057165.3:c.862G>A, NM_057165.4:c.244G>A, NM_057166.3:c.710-6533G>A, NM_057166.4:c.92-6533G>A, NM_057167.3:c.244G>AVOUS04/12/2013
56COL6A3Ex4NM_004369.3:c.882C>Tp.Phe294= | p.F294=NM_004369.3:c.882C>T, NM_057164.3:c.882C>T, NM_057164.4:c.92-6513C>T, NM_057165.3:c.882C>T, NM_057165.4:c.264C>T, NM_057166.3:c.710-6513C>T, NM_057166.4:c.92-6513C>T, NM_057167.3:c.264C>TBenign11/05/2012 
57COL6A3Ex4NM_004369.3:c.893C>Tp.Thr298Ile | p.T298ILRG_473t1:c.893C>T, NM_004369.3:c.893C>T, NM_057164.3:c.893C>T, NM_057164.4:c.92-6502C>T, NM_057165.3:c.893C>T, NM_057165.4:c.275C>T, NM_057166.3:c.710-6502C>T, NM_057166.4:c.92-6502C>T, NM_057167.3:c.275C>T, XM_005246065.1:c.893C>T, XM_005246066.1:c.92-6502C>T, XM_005246067.1:c.92-6502C>T, XM_005246068.1:c.92-6502C>TVOUS06/19/2016
58COL6A3Ex4NM_004369.3:c.898_900delTCCp.Ser300del | p.S300delLRG_473t1:c.898_900delTCC, NM_004369.3:c.898_900delTCC, NM_057164.3:c.898_900delTCC, NM_057164.4:c.92-6497_92-6495delTCC, NM_057165.3:c.898_900delTCC, NM_057165.4:c.280_282delTCC, NM_057166.3:c.710-6497_710-6495delTCC, NM_057166.4:c.92-6497_92-6495delTCC, NM_057167.3:c.280_282delTCC, XM_005246065.1:c.898_900delTCC, XM_005246066.1:c.92-6497_92-6495delTCC, XM_005246067.1:c.92-6497_92-6495delTCC, XM_005246068.1:c.92-6497_92-6495delTCCVOUS01/12/2018
59COL6A3Ex4NM_004369.3:c.936C>Tp.Leu312= | p.L312=LRG_473t1:c.936C>T, NM_004369.3:c.936C>T, NM_057164.3:c.936C>T, NM_057164.4:c.92-6459C>T, NM_057165.3:c.936C>T, NM_057165.4:c.318C>T, NM_057166.3:c.710-6459C>T, NM_057166.4:c.92-6459C>T, NM_057167.3:c.318C>T, XM_005246065.1:c.936C>T, XM_005246066.1:c.92-6459C>T, XM_005246067.1:c.92-6459C>T, XM_005246068.1:c.92-6459C>TVOUS04/12/2021
60COL6A3Ex4NM_004369.3:c.958G>Ap.Ala320Thr | p.A320TLRG_473t1:c.958G>A, NM_004369.3:c.958G>A, NM_057164.3:c.958G>A, NM_057164.4:c.92-6437G>A, NM_057165.3:c.958G>A, NM_057165.4:c.340G>A, NM_057166.3:c.710-6437G>A, NM_057166.4:c.92-6437G>A, NM_057167.3:c.340G>A, XM_005246065.1:c.958G>A, XM_005246066.1:c.92-6437G>A, XM_005246067.1:c.92-6437G>A, XM_005246068.1:c.92-6437G>ALikely benign02/24/2017 
61COL6A3Ex4NM_004369.3:c.969C>Gp.Gly323= | p.G323=LRG_473t1:c.969C>G, NM_004369.3:c.969C>G, NM_057164.3:c.969C>G, NM_057164.4:c.92-6426C>G, NM_057165.3:c.969C>G, NM_057165.4:c.351C>G, NM_057166.3:c.710-6426C>G, NM_057166.4:c.92-6426C>G, NM_057167.3:c.351C>G, XM_005246065.1:c.969C>G, XM_005246066.1:c.92-6426C>G, XM_005246067.1:c.92-6426C>G, XM_005246068.1:c.92-6426C>GVOUS02/13/2019
62COL6A3Ex4NM_004369.3:c.1006C>Tp.Arg336Trp | p.R336WLRG_473t1:c.1006C>T, NM_004369.3:c.1006C>T, NM_057164.3:c.1006C>T, NM_057164.4:c.92-6389C>T, NM_057165.3:c.1006C>T, NM_057165.4:c.388C>T, NM_057166.3:c.710-6389C>T, NM_057166.4:c.92-6389C>T, NM_057167.3:c.388C>T, XM_005246065.1:c.1006C>T, XM_005246066.1:c.92-6389C>T, XM_005246067.1:c.92-6389C>T, XM_005246068.1:c.92-6389C>TVOUS10/25/2016
63COL6A3Ex4NM_004369.3:c.1007G>Ap.Arg336Gln | p.R336QLRG_473t1:c.1007G>A, NM_004369.3:c.1007G>A, NM_057164.3:c.1007G>A, NM_057164.4:c.92-6388G>A, NM_057165.3:c.1007G>A, NM_057165.4:c.389G>A, NM_057166.3:c.710-6388G>A, NM_057166.4:c.92-6388G>A, NM_057167.3:c.389G>A, XM_005246065.1:c.1007G>A, XM_005246066.1:c.92-6388G>A, XM_005246067.1:c.92-6388G>A, XM_005246068.1:c.92-6388G>AVOUS03/10/2017
64COL6A3Ex4NM_004369.3:c.1022G>Ap.Arg341His | p.R341HLRG_473t1:c.1022G>A, NM_004369.3:c.1022G>A, NM_057164.3:c.1022G>A, NM_057164.4:c.92-6373G>A, NM_057165.3:c.1022G>A, NM_057165.4:c.404G>A, NM_057166.3:c.710-6373G>A, NM_057166.4:c.92-6373G>A, NM_057167.3:c.404G>A, XM_005246065.1:c.1022G>A, XM_005246066.1:c.92-6373G>A, XM_005246067.1:c.92-6373G>A, XM_005246068.1:c.92-6373G>AVOUS10/08/2019
65COL6A3Ex4NM_004369.3:c.1022G>Tp.Arg341Leu | p.R341LLRG_473t1:c.1022G>T, NM_004369.3:c.1022G>T, NM_057164.3:c.1022G>T, NM_057164.4:c.92-6373G>T, NM_057165.3:c.1022G>T, NM_057165.4:c.404G>T, NM_057166.3:c.710-6373G>T, NM_057166.4:c.92-6373G>T, NM_057167.3:c.404G>T, XM_005246065.1:c.1022G>T, XM_005246066.1:c.92-6373G>T, XM_005246067.1:c.92-6373G>T, XM_005246068.1:c.92-6373G>TVOUS01/12/2017
66COL6A3Ex4NM_004369.3:c.1024G>Ap.Val342Met | p.V342MLRG_473t1:c.1024G>A, NM_004369.3:c.1024G>A, NM_057164.3:c.1024G>A, NM_057164.4:c.92-6371G>A, NM_057165.3:c.1024G>A, NM_057165.4:c.406G>A, NM_057166.3:c.710-6371G>A, NM_057166.4:c.92-6371G>A, NM_057167.3:c.406G>ALikely benign06/15/2016 
67COL6A3Ex4NM_004369.3:c.1035G>Ap.Gly345= | p.G345=LRG_473t1:c.1035G>A, NM_004369.3:c.1035G>A, NM_057164.3:c.1035G>A, NM_057164.4:c.92-6360G>A, NM_057165.3:c.1035G>A, NM_057165.4:c.417G>A, NM_057166.3:c.710-6360G>A, NM_057166.4:c.92-6360G>A, NM_057167.3:c.417G>A, XM_005246065.1:c.1035G>A, XM_005246066.1:c.92-6360G>A, XM_005246067.1:c.92-6360G>A, XM_005246068.1:c.92-6360G>AVOUS09/14/2016
68COL6A3Ex4NM_004369.3:c.1045G>Tp.Val349Leu | p.V349LLRG_473t1:c.1045G>T, NM_004369.3:c.1045G>T, NM_057164.3:c.1045G>T, NM_057164.4:c.92-6350G>T, NM_057165.3:c.1045G>T, NM_057165.4:c.427G>T, NM_057166.3:c.710-6350G>T, NM_057166.4:c.92-6350G>T, NM_057167.3:c.427G>T, XM_005246065.1:c.1045G>T, XM_005246066.1:c.92-6350G>T, XM_005246067.1:c.92-6350G>T, XM_005246068.1:c.92-6350G>TVOUS01/04/2017
69COL6A3Ex4NM_004369.3:c.1056C>Tp.Leu352= | p.L352=LRG_473t1:c.1056C>T, NM_004369.3:c.1056C>T, NM_057164.3:c.1056C>T, NM_057164.4:c.92-6339C>T, NM_057165.3:c.1056C>T, NM_057165.4:c.438C>T, NM_057166.3:c.710-6339C>T, NM_057166.4:c.92-6339C>T, NM_057167.3:c.438C>T, XM_005246065.1:c.1056C>T, XM_005246066.1:c.92-6339C>T, XM_005246067.1:c.92-6339C>T, XM_005246068.1:c.92-6339C>TVOUS11/15/2019
70COL6A3Ex4NM_004369.3:c.1065C>Tp.Ala355= | p.A355=LRG_473t1:c.1065C>T, NM_004369.3:c.1065C>T, NM_057164.3:c.1065C>T, NM_057164.4:c.92-6330C>T, NM_057165.3:c.1065C>T, NM_057165.4:c.447C>T, NM_057166.3:c.710-6330C>T, NM_057166.4:c.92-6330C>T, NM_057167.3:c.447C>T, XM_005246065.1:c.1065C>T, XM_005246066.1:c.92-6330C>T, XM_005246067.1:c.92-6330C>T, XM_005246068.1:c.92-6330C>TVOUS06/14/2016
71COL6A3Ex4NM_004369.3:c.1066G>Ap.Gly356Arg | p.G356RLRG_473t1:c.1066G>A, NM_004369.3:c.1066G>A, NM_057164.3:c.1066G>A, NM_057164.4:c.92-6329G>A, NM_057165.3:c.1066G>A, NM_057165.4:c.448G>A, NM_057166.3:c.710-6329G>A, NM_057166.4:c.92-6329G>A, NM_057167.3:c.448G>A, XM_005246065.1:c.1066G>A, XM_005246066.1:c.92-6329G>A, XM_005246067.1:c.92-6329G>A, XM_005246068.1:c.92-6329G>AVOUS11/02/2017
72COL6A3Ex4NM_004369.3:c.1077T>Cp.Ser359= | p.S359=LRG_473t1:c.1077T>C, NM_004369.3:c.1077T>C, NM_057164.3:c.1077T>C, NM_057164.4:c.92-6318T>C, NM_057165.3:c.1077T>C, NM_057165.4:c.459T>C, NM_057166.3:c.710-6318T>C, NM_057166.4:c.92-6318T>C, NM_057167.3:c.459T>C, XM_005246065.1:c.1077T>C, XM_005246066.1:c.92-6318T>C, XM_005246067.1:c.92-6318T>C, XM_005246068.1:c.92-6318T>CVOUS07/14/2016
73COL6A3Ex4NM_004369.3:c.1080C>Tp.Asp360= | p.D360=LRG_473t1:c.1080C>T, NM_004369.3:c.1080C>T, NM_057164.3:c.1080C>T, NM_057164.4:c.92-6315C>T, NM_057165.3:c.1080C>T, NM_057165.4:c.462C>T, NM_057166.3:c.710-6315C>T, NM_057166.4:c.92-6315C>T, NM_057167.3:c.462C>T, XM_005246065.1:c.1080C>T, XM_005246066.1:c.92-6315C>T, XM_005246067.1:c.92-6315C>T, XM_005246068.1:c.92-6315C>TVOUS10/21/2016
74COL6A3Ex4NM_004369.3:c.1087C>Tp.Arg363Cys | p.R363CNM_004369.3:c.1087C>T, NM_057164.3:c.1087C>T, NM_057164.4:c.92-6308C>T, NM_057165.3:c.1087C>T, NM_057165.4:c.469C>T, NM_057166.3:c.710-6308C>T, NM_057166.4:c.92-6308C>T, NM_057167.3:c.469C>T, XM_005246065.1:c.1087C>T, XM_005246066.1:c.92-6308C>T, XM_005246067.1:c.92-6308C>T, XM_005246068.1:c.92-6308C>TVOUS09/04/2015
75COL6A3Ex4NM_004369.3:c.1088G>Ap.Arg363His | p.R363HLRG_473t1:c.1088G>A, NM_004369.3:c.1088G>A, NM_057164.3:c.1088G>A, NM_057164.4:c.92-6307G>A, NM_057165.3:c.1088G>A, NM_057165.4:c.470G>A, NM_057166.3:c.710-6307G>A, NM_057166.4:c.92-6307G>A, NM_057167.3:c.470G>A, XM_005246065.1:c.1088G>A, XM_005246066.1:c.92-6307G>A, XM_005246067.1:c.92-6307G>A, XM_005246068.1:c.92-6307G>AVOUS03/29/2016
76COL6A3Ex4NM_004369.3:c.1092C>Tp.Tyr364= | p.Y364=LRG_473t1:c.1092C>T, NM_004369.3:c.1092C>T, NM_057164.3:c.1092C>T, NM_057164.4:c.92-6303C>T, NM_057165.3:c.1092C>T, NM_057165.4:c.474C>T, NM_057166.3:c.710-6303C>T, NM_057166.4:c.92-6303C>T, NM_057167.3:c.474C>T, XM_005246065.1:c.1092C>T, XM_005246066.1:c.92-6303C>T, XM_005246067.1:c.92-6303C>T, XM_005246068.1:c.92-6303C>TVOUS11/12/2018
77COL6A3Ex4NM_004369.3:c.1095G>Cp.Gly365= | p.G365=LRG_473t1:c.1095G>C, NM_004369.3:c.1095G>C, NM_057164.3:c.1095G>C, NM_057164.4:c.92-6300G>C, NM_057165.3:c.1095G>C, NM_057165.4:c.477G>C, NM_057166.3:c.710-6300G>C, NM_057166.4:c.92-6300G>C, NM_057167.3:c.477G>C, XM_005246065.1:c.1095G>C, XM_005246066.1:c.92-6300G>C, XM_005246067.1:c.92-6300G>C, XM_005246068.1:c.92-6300G>CVOUS09/23/2016
78COL6A3Ex4NM_004369.3:c.1120G>Ap.Val374Met | p.V374MNM_004369.3:c.1120G>A, NM_057164.3:c.1120G>A, NM_057164.4:c.92-6275G>A, NM_057165.3:c.1120G>A, NM_057165.4:c.502G>A, NM_057166.3:c.710-6275G>A, NM_057166.4:c.92-6275G>A, NM_057167.3:c.502G>A, XM_005246065.1:c.1120G>A, XM_005246066.1:c.92-6275G>A, XM_005246067.1:c.92-6275G>A, XM_005246068.1:c.92-6275G>AVOUS07/20/2015
79COL6A3Ex4NM_004369.3:c.1131C>Tp.Phe377= | p.F377=LRG_473t1:c.1131C>T, NM_004369.3:c.1131C>T, NM_057164.3:c.1131C>T, NM_057164.4:c.92-6264C>T, NM_057165.3:c.1131C>T, NM_057165.4:c.513C>T, NM_057166.3:c.710-6264C>T, NM_057166.4:c.92-6264C>T, NM_057167.3:c.513C>T, XM_005246065.1:c.1131C>T, XM_005246066.1:c.92-6264C>T, XM_005246067.1:c.92-6264C>T, XM_005246068.1:c.92-6264C>TVOUS05/04/2017
80COL6A3Ex4NM_004369.3:c.1146G>Ap.Gln382= | p.Q382=LRG_473t1:c.1146G>A, NM_004369.3:c.1146G>A, NM_057164.3:c.1146G>A, NM_057164.4:c.92-6249G>A, NM_057165.3:c.1146G>A, NM_057165.4:c.528G>A, NM_057166.3:c.710-6249G>A, NM_057166.4:c.92-6249G>A, NM_057167.3:c.528G>A, XM_005246065.1:c.1146G>A, XM_005246066.1:c.92-6249G>A, XM_005246067.1:c.92-6249G>A, XM_005246068.1:c.92-6249G>AVOUS11/10/2016
81COL6A3Ex4NM_004369.3:c.1147G>Ap.Ala383Thr | p.A383TNM_004369.3:c.1147G>A, NM_057164.3:c.1147G>A, NM_057164.4:c.92-6248G>A, NM_057165.3:c.1147G>A, NM_057165.4:c.529G>A, NM_057166.3:c.710-6248G>A, NM_057166.4:c.92-6248G>A, NM_057167.3:c.529G>A, XM_005246065.1:c.1147G>A, XM_005246066.1:c.92-6248G>A, XM_005246067.1:c.92-6248G>A, XM_005246068.1:c.92-6248G>AVOUS01/05/2015
82COL6A3Ex4NM_004369.3:c.1150G>Ap.Ala384Thr | p.A384TLRG_473t1:c.1150G>A, NM_004369.3:c.1150G>A, NM_057164.3:c.1150G>A, NM_057164.4:c.92-6245G>A, NM_057165.3:c.1150G>A, NM_057165.4:c.532G>A, NM_057166.3:c.710-6245G>A, NM_057166.4:c.92-6245G>A, NM_057167.3:c.532G>A, XM_005246065.1:c.1150G>A, XM_005246066.1:c.92-6245G>A, XM_005246067.1:c.92-6245G>A, XM_005246068.1:c.92-6245G>AVOUS11/10/2016
83COL6A3Ex4NM_004369.3:c.1182C>Tp.Thr394= | p.T394=NM_004369.3:c.1182C>T, NM_057164.3:c.1182C>T, NM_057164.4:c.92-6213C>T, NM_057165.3:c.1182C>T, NM_057165.4:c.564C>T, NM_057166.3:c.710-6213C>T, NM_057166.4:c.92-6213C>T, NM_057167.3:c.564C>TBenign11/05/2012 
84COL6A3Ex4NM_004369.3:c.1208C>Tp.Pro403Leu | p.P403LLRG_473t1:c.1208C>T, NM_004369.3:c.1208C>T, NM_057164.3:c.1208C>T, NM_057164.4:c.92-6187C>T, NM_057165.3:c.1208C>T, NM_057165.4:c.590C>T, NM_057166.3:c.710-6187C>T, NM_057166.4:c.92-6187C>T, NM_057167.3:c.590C>T, XM_005246065.1:c.1208C>T, XM_005246066.1:c.92-6187C>T, XM_005246067.1:c.92-6187C>T, XM_005246068.1:c.92-6187C>TVOUS06/02/2016
85COL6A3Ex4NM_004369.3:c.1214T>Cp.Phe405Ser | p.F405SLRG_473t1:c.1214T>C, NM_004369.3:c.1214T>C, NM_057164.3:c.1214T>C, NM_057164.4:c.92-6181T>C, NM_057165.3:c.1214T>C, NM_057165.4:c.596T>C, NM_057166.3:c.710-6181T>C, NM_057166.4:c.92-6181T>C, NM_057167.3:c.596T>C, XM_005246065.1:c.1214T>C, XM_005246066.1:c.92-6181T>C, XM_005246067.1:c.92-6181T>C, XM_005246068.1:c.92-6181T>CVOUS09/28/2016
86COL6A3Ex4NM_004369.3:c.1216C>Tp.Arg406Cys | p.R406CNM_004369.3:c.1216C>T, NM_057164.3:c.1216C>T, NM_057164.4:c.92-6179C>T, NM_057165.3:c.1216C>T, NM_057165.4:c.598C>T, NM_057166.3:c.710-6179C>T, NM_057166.4:c.92-6179C>T, NM_057167.3:c.598C>T, XM_005246065.1:c.1216C>T, XM_005246066.1:c.92-6179C>T, XM_005246067.1:c.92-6179C>T, XM_005246068.1:c.92-6179C>TVOUS09/11/2015
87COL6A3Ex4NM_004369.3:c.1217G>Ap.Arg406His | p.R406HLRG_473t1:c.1217G>A, NM_004369.3:c.1217G>A, NM_057164.3:c.1217G>A, NM_057164.4:c.92-6178G>A, NM_057165.3:c.1217G>A, NM_057165.4:c.599G>A, NM_057166.3:c.710-6178G>A, NM_057166.4:c.92-6178G>A, NM_057167.3:c.599G>A, XM_005246065.1:c.1217G>A, XM_005246066.1:c.92-6178G>A, XM_005246067.1:c.92-6178G>A, XM_005246068.1:c.92-6178G>AVOUS11/06/2016
88COL6A3Ex4NM_004369.3:c.1228G>Ap.Asp410Asn | p.D410NNM_004369.3:c.1228G>A, NM_057164.3:c.1228G>A, NM_057164.4:c.92-6167G>A, NM_057165.3:c.1228G>A, NM_057165.4:c.610G>A, NM_057166.3:c.710-6167G>A, NM_057166.4:c.92-6167G>A, NM_057167.3:c.610G>A, XM_005246065.1:c.1228G>A, XM_005246066.1:c.92-6167G>A, XM_005246067.1:c.92-6167G>A, XM_005246068.1:c.92-6167G>ABenign10/14/2015 
89COL6A3Ex4NM_004369.3:c.1231C>Gp.Leu411Val | p.L411VBenign11/05/2012 
90COL6A3Ex4NM_004369.3:c.1248G>Ap.Leu416= | p.L416=LRG_473t1:c.1248G>A, NM_004369.3:c.1248G>A, NM_057164.3:c.1248G>A, NM_057164.4:c.92-6147G>A, NM_057165.3:c.1248G>A, NM_057165.4:c.630G>A, NM_057166.3:c.710-6147G>A, NM_057166.4:c.92-6147G>A, NM_057167.3:c.630G>A, XM_005246065.1:c.1248G>A, XM_005246066.1:c.92-6147G>A, XM_005246067.1:c.92-6147G>A, XM_005246068.1:c.92-6147G>ABenign03/27/2018 
91COL6A3Ex4NM_004369.3:c.1263C>Tp.Gly421= | p.G421=NM_004369.3:c.1263C>T, NM_057164.3:c.1263C>T, NM_057164.4:c.92-6132C>T, NM_057165.3:c.1263C>T, NM_057165.4:c.645C>T, NM_057166.3:c.710-6132C>T, NM_057166.4:c.92-6132C>T, NM_057167.3:c.645C>T, XM_005246065.1:c.1263C>T, XM_005246066.1:c.92-6132C>T, XM_005246067.1:c.92-6132C>T, XM_005246068.1:c.92-6132C>TVOUS10/06/2015
92COL6A3Ex4NM_004369.3:c.1264G>Ap.Val422Met | p.V422MBenign11/05/2012 
93COL6A3Ex4NM_004369.3:c.1292C>Tp.Pro431Leu | p.P431LLRG_473t1:c.1292C>T, NM_004369.3:c.1292C>T, NM_057164.3:c.1292C>T, NM_057164.4:c.92-6103C>T, NM_057165.3:c.1292C>T, NM_057165.4:c.674C>T, NM_057166.3:c.710-6103C>T, NM_057166.4:c.92-6103C>T, NM_057167.3:c.674C>T, XM_005246065.1:c.1292C>T, XM_005246066.1:c.92-6103C>T, XM_005246067.1:c.92-6103C>T, XM_005246068.1:c.92-6103C>TVOUS12/01/2016
94COL6A3Ex4NM_004369.3:c.1293G>Ap.Pro431= | p.P431=LRG_473t1:c.1293G>A, NM_004369.3:c.1293G>A, NM_057164.3:c.1293G>A, NM_057164.4:c.92-6102G>A, NM_057165.3:c.1293G>A, NM_057165.4:c.675G>A, NM_057166.3:c.710-6102G>A, NM_057166.4:c.92-6102G>A, NM_057167.3:c.675G>A, XM_005246065.1:c.1293G>A, XM_005246066.1:c.92-6102G>A, XM_005246067.1:c.92-6102G>A, XM_005246068.1:c.92-6102G>AVOUS12/28/2016
95COL6A3Ex5NM_004369.3:c.1313-17A>GBenign11/05/2012 
96COL6A3Ex5NM_004369.3:c.1322T>Cp.Val441Ala | p.V441ANM_004369.3:c.1322T>C, NM_057164.3:c.1322T>C, NM_057164.4:c.101T>C, NM_057165.3:c.1322T>C, NM_057165.4:c.704T>C, NM_057166.3:c.719T>C, NM_057166.4:c.101T>C, NM_057167.3:c.704T>C, XM_005246065.1:c.1322T>C, XM_005246066.1:c.101T>C, XM_005246067.1:c.101T>C, XM_005246068.1:c.101T>CVOUS08/13/2015
97COL6A3Ex5NM_004369.3:c.1327A>Gp.Lys443Glu | p.K443ELRG_473t1:c.1327A>G, NM_004369.3:c.1327A>G, NM_057164.3:c.1327A>G, NM_057164.4:c.106A>G, NM_057165.3:c.1327A>G, NM_057165.4:c.709A>G, NM_057166.3:c.724A>G, NM_057166.4:c.106A>G, NM_057167.3:c.709A>G, XM_005246065.1:c.1327A>G, XM_005246066.1:c.106A>G, XM_005246067.1:c.106A>G, XM_005246068.1:c.106A>GVOUS04/20/2016
98COL6A3Ex5NM_004369.3:c.1350G>Ap.Val450= | p.V450=NM_004369.3:c.1350G>A, NM_057164.3:c.1350G>A, NM_057164.4:c.129G>A, NM_057165.3:c.1350G>A, NM_057165.4:c.732G>A, NM_057166.3:c.747G>A, NM_057166.4:c.129G>A, NM_057167.3:c.732G>A, XM_005246065.1:c.1350G>A, XM_005246066.1:c.129G>A, XM_005246067.1:c.129G>A, XM_005246068.1:c.129G>AVOUS12/04/2015
99COL6A3Ex5NM_004369.3:c.1370G>Tp.Gly457Val | p.G457VLRG_473t1:c.1370G>T, NM_004369.3:c.1370G>T, NM_057164.3:c.1370G>T, NM_057164.4:c.149G>T, NM_057165.3:c.1370G>T, NM_057165.4:c.752G>T, NM_057166.3:c.767G>T, NM_057166.4:c.149G>T, NM_057167.3:c.752G>T, XM_005246065.1:c.1370G>T, XM_005246066.1:c.149G>T, XM_005246067.1:c.149G>T, XM_005246068.1:c.149G>TVOUS06/06/2016
100COL6A3Ex5NM_004369.3:c.1385A>Gp.Asn462Ser | p.N462SLRG_473t1:c.1385A>G, NM_004369.3:c.1385A>G, NM_057164.3:c.1385A>G, NM_057164.4:c.164A>G, NM_057165.3:c.1385A>G, NM_057165.4:c.767A>G, NM_057166.3:c.782A>G, NM_057166.4:c.164A>G, NM_057167.3:c.767A>G, XM_005246065.1:c.1385A>G, XM_005246066.1:c.164A>G, XM_005246067.1:c.164A>G, XM_005246068.1:c.164A>GVOUS02/01/2016
101COL6A3Ex5NM_004369.3:c.1389C>Tp.Ala463= | p.A463=LRG_473t1:c.1389C>T, NM_004369.3:c.1389C>T, NM_057164.3:c.1389C>T, NM_057164.4:c.168C>T, NM_057165.3:c.1389C>T, NM_057165.4:c.771C>T, NM_057166.3:c.786C>T, NM_057166.4:c.168C>T, NM_057167.3:c.771C>T, XM_005246065.1:c.1389C>T, XM_005246066.1:c.168C>T, XM_005246067.1:c.168C>T, XM_005246068.1:c.168C>TBenign11/05/2012 
102COL6A3Ex5NM_004369.3:c.1394G>Ap.Arg465Gln | p.R465QNM_004369.3:c.1394G>A, NM_057164.3:c.1394G>A, NM_057164.4:c.173G>A, NM_057165.3:c.1394G>A, NM_057165.4:c.776G>A, NM_057166.3:c.791G>A, NM_057166.4:c.173G>A, NM_057167.3:c.776G>A, XM_005246065.1:c.1394G>A, XM_005246066.1:c.173G>A, XM_005246067.1:c.173G>A, XM_005246068.1:c.173G>AVOUS01/26/2016
103COL6A3Ex5NM_004369.3:c.1432G>Ap.Gly478Arg | p.G478RLRG_473t1:c.1432G>A, NM_004369.3:c.1432G>A, NM_057164.3:c.1432G>A, NM_057164.4:c.211G>A, NM_057165.3:c.1432G>A, NM_057165.4:c.814G>A, NM_057166.3:c.829G>A, NM_057166.4:c.211G>A, NM_057167.3:c.814G>A, XM_005246065.1:c.1432G>A, XM_005246066.1:c.211G>A, XM_005246067.1:c.211G>A, XM_005246068.1:c.211G>AVOUS06/19/2016
104COL6A3Ex5NM_004369.3:c.1471G>Cp.Asp491His | p.D491HBenign11/05/2012 
105COL6A3Ex5NM_004369.3:c.1475C>Gp.Thr492Ser | p.T492SBenign11/05/2012 
106COL6A3Ex5NM_004369.3:c.1478T>Cp.Val493Ala | p.V493ANM_004369.3:c.1478T>C, NM_057164.3:c.1478T>C, NM_057164.4:c.257T>C, NM_057165.3:c.1478T>C, NM_057165.4:c.860T>C, NM_057166.3:c.875T>C, NM_057166.4:c.257T>C, NM_057167.3:c.860T>C, XM_005246065.1:c.1478T>C, XM_005246066.1:c.257T>C, XM_005246067.1:c.257T>C, XM_005246068.1:c.257T>CLikely benign07/21/2014 
107COL6A3Ex5NM_004369.3:c.1502C>Tp.Thr501Ile | p.T501ILRG_473t1:c.1502C>T, NM_004369.3:c.1502C>T, NM_057164.3:c.1502C>T, NM_057164.4:c.281C>T, NM_057165.3:c.1502C>T, NM_057165.4:c.884C>T, NM_057166.3:c.899C>T, NM_057166.4:c.281C>T, NM_057167.3:c.884C>T, XM_005246065.1:c.1502C>T, XM_005246066.1:c.281C>T, XM_005246067.1:c.281C>T, XM_005246068.1:c.281C>TVOUS12/03/2018
108COL6A3Ex5NM_004369.3:c.1513A>Gp.Lys505Glu | p.K505ELRG_473t1:c.1513A>G, NM_004369.3:c.1513A>G, NM_057164.3:c.1513A>G, NM_057164.4:c.292A>G, NM_057165.3:c.1513A>G, NM_057165.4:c.895A>G, NM_057166.3:c.910A>G, NM_057166.4:c.292A>G, NM_057167.3:c.895A>G, XM_005246065.1:c.1513A>G, XM_005246066.1:c.292A>G, XM_005246067.1:c.292A>G, XM_005246068.1:c.292A>GVOUS08/15/2016
109COL6A3Ex5NM_004369.3:c.1514A>Tp.Lys505Ile | p.K505ILRG_473t1:c.1514A>T, NM_004369.3:c.1514A>T, NM_057164.3:c.1514A>T, NM_057164.4:c.293A>T, NM_057165.3:c.1514A>T, NM_057165.4:c.896A>T, NM_057166.3:c.911A>T, NM_057166.4:c.293A>T, NM_057167.3:c.896A>T, XM_005246065.1:c.1514A>T, XM_005246066.1:c.293A>T, XM_005246067.1:c.293A>T, XM_005246068.1:c.293A>TVOUS05/03/2017
110COL6A3Ex5NM_004369.3:c.1538G>Ap.Arg513Gln | p.R513QLRG_473t1:c.1538G>A, NM_004369.3:c.1538G>A, NM_057164.3:c.1538G>A, NM_057164.4:c.317G>A, NM_057165.3:c.1538G>A, NM_057165.4:c.920G>A, NM_057166.3:c.935G>A, NM_057166.4:c.317G>A, NM_057167.3:c.920G>A, XM_005246065.1:c.1538G>A, XM_005246066.1:c.317G>A, XM_005246067.1:c.317G>A, XM_005246068.1:c.317G>AVOUS10/02/2017
111COL6A3Ex5NM_004369.3:c.1557C>Tp.Asp519= | p.D519=LRG_473t1:c.1557C>T, NM_004369.3:c.1557C>T, NM_057164.3:c.1557C>T, NM_057164.4:c.336C>T, NM_057165.3:c.1557C>T, NM_057165.4:c.939C>T, NM_057166.3:c.954C>T, NM_057166.4:c.336C>T, NM_057167.3:c.939C>T, XM_005246065.1:c.1557C>T, XM_005246066.1:c.336C>T, XM_005246067.1:c.336C>T, XM_005246068.1:c.336C>TVOUS12/07/2017
112COL6A3Ex5NM_004369.3:c.1558G>Ap.Gly520Ser | p.G520SLRG_473t1:c.1558G>A, NM_004369.3:c.1558G>A, NM_057164.3:c.1558G>A, NM_057164.4:c.337G>A, NM_057165.3:c.1558G>A, NM_057165.4:c.940G>A, NM_057166.3:c.955G>A, NM_057166.4:c.337G>A, NM_057167.3:c.940G>A, XM_005246065.1:c.1558G>A, XM_005246066.1:c.337G>A, XM_005246067.1:c.337G>A, XM_005246068.1:c.337G>AVOUS05/06/2016
113COL6A3Ex5NM_004369.3:c.1560C>Tp.Gly520= | p.G520=LRG_473t1:c.1560C>T, NM_004369.3:c.1560C>T, NM_057164.3:c.1560C>T, NM_057164.4:c.339C>T, NM_057165.3:c.1560C>T, NM_057165.4:c.942C>T, NM_057166.3:c.957C>T, NM_057166.4:c.339C>T, NM_057167.3:c.942C>T, XM_005246065.1:c.1560C>T, XM_005246066.1:c.339C>T, XM_005246067.1:c.339C>T, XM_005246068.1:c.339C>TVOUS06/17/2019
114COL6A3Ex5NM_004369.3:c.1562C>Tp.Ser521Leu | p.S521LLRG_473t1:c.1562C>T, NM_004369.3:c.1562C>T, NM_057164.3:c.1562C>T, NM_057164.4:c.341C>T, NM_057165.3:c.1562C>T, NM_057165.4:c.944C>T, NM_057166.3:c.959C>T, NM_057166.4:c.341C>T, NM_057167.3:c.944C>T, XM_005246065.1:c.1562C>T, XM_005246066.1:c.341C>T, XM_005246067.1:c.341C>T, XM_005246068.1:c.341C>TVOUS12/07/2018
115COL6A3Ex5NM_004369.3:c.1572C>Tp.Tyr524= | p.Y524=LRG_473t1:c.1572C>T, NM_004369.3:c.1572C>T, NM_057164.3:c.1572C>T, NM_057164.4:c.351C>T, NM_057165.3:c.1572C>T, NM_057165.4:c.954C>T, NM_057166.3:c.969C>T, NM_057166.4:c.351C>T, NM_057167.3:c.954C>T, XM_005246065.1:c.1572C>T, XM_005246066.1:c.351C>T, XM_005246067.1:c.351C>T, XM_005246068.1:c.351C>TVOUS12/06/2016
116COL6A3Ex5NM_004369.3:c.1587A>Gp.Leu529= | p.L529=LRG_473t1:c.1587A>G, NM_004369.3:c.1587A>G, NM_057164.3:c.1587A>G, NM_057164.4:c.366A>G, NM_057165.3:c.1587A>G, NM_057165.4:c.969A>G, NM_057166.3:c.984A>G, NM_057166.4:c.366A>G, NM_057167.3:c.969A>G, XM_005246065.1:c.1587A>G, XM_005246066.1:c.366A>G, XM_005246067.1:c.366A>G, XM_005246068.1:c.366A>GBenign08/23/2016 
117COL6A3Ex5NM_004369.3:c.1598G>Cp.Arg533Pro | p.R533PNM_004369.3:c.1598G>C, NM_057164.3:c.1598G>C, NM_057164.4:c.377G>C, NM_057165.3:c.1598G>C, NM_057165.4:c.980G>C, NM_057166.3:c.995G>C, NM_057166.4:c.377G>C, NM_057167.3:c.980G>C, XM_005246065.1:c.1598G>C, XM_005246066.1:c.377G>C, XM_005246067.1:c.377G>C, XM_005246068.1:c.377G>CVOUS11/10/2015
118COL6A3Ex5NM_004369.3:c.1605C>Tp.Asn535= | p.N535=LRG_473t1:c.1605C>T, NM_004369.3:c.1605C>T, NM_057164.3:c.1605C>T, NM_057164.4:c.384C>T, NM_057165.3:c.1605C>T, NM_057165.4:c.987C>T, NM_057166.3:c.1002C>T, NM_057166.4:c.384C>T, NM_057167.3:c.987C>T, XM_005246065.1:c.1605C>T, XM_005246066.1:c.384C>T, XM_005246067.1:c.384C>T, XM_005246068.1:c.384C>TVOUS03/04/2017
119COL6A3Ex5NM_004369.3:c.1620A>Gp.Ser540= | p.S540=LRG_473t1:c.1620A>G, NM_004369.3:c.1620A>G, NM_057164.3:c.1620A>G, NM_057164.4:c.399A>G, NM_057165.3:c.1620A>G, NM_057165.4:c.1002A>G, NM_057166.3:c.1017A>G, NM_057166.4:c.399A>G, NM_057167.3:c.1002A>G, XM_005246065.1:c.1620A>G, XM_005246066.1:c.399A>G, XM_005246067.1:c.399A>G, XM_005246068.1:c.399A>GVOUS11/10/2017
120COL6A3Ex5NM_004369.3:c.1623C>Tp.Ala541= | p.A541=LRG_473t1:c.1623C>T, NM_004369.3:c.1623C>T, NM_057164.3:c.1623C>T, NM_057164.4:c.402C>T, NM_057165.3:c.1623C>T, NM_057165.4:c.1005C>T, NM_057166.3:c.1020C>T, NM_057166.4:c.402C>T, NM_057167.3:c.1005C>T, XM_005246065.1:c.1623C>T, XM_005246066.1:c.402C>T, XM_005246067.1:c.402C>T, XM_005246068.1:c.402C>TVOUS07/02/2018
121COL6A3Ex5NM_004369.3:c.1638C>Tp.Ala546= | p.A546=NM_004369.3:c.1638C>T, NM_057164.3:c.1638C>T, NM_057164.4:c.417C>T, NM_057165.3:c.1638C>T, NM_057165.4:c.1020C>T, NM_057166.3:c.1035C>T, NM_057166.4:c.417C>T, NM_057167.3:c.1020C>TBenign11/05/2012 
122COL6A3Ex5NM_004369.3:c.1688A>Gp.Asp563Gly | p.D563GNM_004369.3:c.1688A>G, NM_057164.3:c.1688A>G, NM_057164.4:c.467A>G, NM_057165.3:c.1688A>G, NM_057165.4:c.1070A>G, NM_057166.3:c.1085A>G, NM_057166.4:c.467A>G, NM_057167.3:c.1070A>GLikely benign08/17/2015 
123COL6A3Ex5NM_004369.3:c.1740T>Gp.Phe580Leu | p.F580LLRG_473t1:c.1740T>G, NM_004369.3:c.1740T>G, NM_057164.3:c.1740T>G, NM_057164.4:c.519T>G, NM_057165.3:c.1740T>G, NM_057165.4:c.1122T>G, NM_057166.3:c.1137T>G, NM_057166.4:c.519T>G, NM_057167.3:c.1122T>G, XM_005246065.1:c.1740T>G, XM_005246066.1:c.519T>G, XM_005246067.1:c.519T>G, XM_005246068.1:c.519T>GVOUS02/27/2017
124COL6A3Ex5NM_004369.3:c.1761C>Tp.Ala587= | p.A587=LRG_473t1:c.1761C>T, NM_004369.3:c.1761C>T, NM_057164.3:c.1761C>T, NM_057164.4:c.540C>T, NM_057165.3:c.1761C>T, NM_057165.4:c.1143C>T, NM_057166.3:c.1158C>T, NM_057166.4:c.540C>T, NM_057167.3:c.1143C>T, XM_005246065.1:c.1761C>T, XM_005246066.1:c.540C>T, XM_005246067.1:c.540C>T, XM_005246068.1:c.540C>TLikely benign11/21/2016 
125COL6A3Ex5NM_004369.3:c.1762G>Ap.Asp588Asn | p.D588NLRG_473t1:c.1762G>A, NM_004369.3:c.1762G>A, NM_057164.3:c.1762G>A, NM_057164.4:c.541G>A, NM_057165.3:c.1762G>A, NM_057165.4:c.1144G>A, NM_057166.3:c.1159G>A, NM_057166.4:c.541G>A, NM_057167.3:c.1144G>A, XM_005246065.1:c.1762G>A, XM_005246066.1:c.541G>A, XM_005246067.1:c.541G>A, XM_005246068.1:c.541G>AVOUS02/26/2016
126COL6A3Ex5NM_004369.3:c.1785C>Tp.Ile595= | p.I595=LRG_473t1:c.1785C>T, NM_004369.3:c.1785C>T, NM_057164.3:c.1785C>T, NM_057164.4:c.564C>T, NM_057165.3:c.1785C>T, NM_057165.4:c.1167C>T, NM_057166.3:c.1182C>T, NM_057166.4:c.564C>T, NM_057167.3:c.1167C>T, XM_005246065.1:c.1785C>T, XM_005246066.1:c.564C>T, XM_005246067.1:c.564C>T, XM_005246068.1:c.564C>TVOUS08/29/2016
127COL6A3Ex5NM_004369.3:c.1786G>Tp.Ala596Ser | p.A596SBenign11/05/2012 
128COL6A3Ex5NM_004369.3:c.1795_1796delTCinsATVOUS01/27/2016
129COL6A3Ex5NM_004369.3:c.1826G>Ap.Arg609Gln | p.R609QLRG_473t1:c.1826G>A, NM_004369.3:c.1826G>A, NM_057164.3:c.1826G>A, NM_057164.4:c.605G>A, NM_057165.3:c.1826G>A, NM_057165.4:c.1208G>A, NM_057166.3:c.1223G>A, NM_057166.4:c.605G>A, NM_057167.3:c.1208G>A, XM_005246065.1:c.1826G>A, XM_005246066.1:c.605G>A, XM_005246067.1:c.605G>A, XM_005246068.1:c.605G>AVOUS11/27/2018
130COL6A3Ex5NM_004369.3:c.1829C>Tp.Ala610Val | p.A610VLRG_473t1:c.1829C>T, NM_004369.3:c.1829C>T, NM_057164.3:c.1829C>T, NM_057164.4:c.608C>T, NM_057165.3:c.1829C>T, NM_057165.4:c.1211C>T, NM_057166.3:c.1226C>T, NM_057166.4:c.608C>T, NM_057167.3:c.1211C>T, XM_005246065.1:c.1829C>T, XM_005246066.1:c.608C>T, XM_005246067.1:c.608C>T, XM_005246068.1:c.608C>TVOUS06/07/2017
131COL6A3Ex5NM_004369.3:c.1846A>Gp.Met616Val | p.M616VLRG_473t1:c.1846A>G, NM_004369.3:c.1846A>G, NM_057164.3:c.1846A>G, NM_057164.4:c.625A>G, NM_057165.3:c.1846A>G, NM_057165.4:c.1228A>G, NM_057166.3:c.1243A>G, NM_057166.4:c.625A>G, NM_057167.3:c.1228A>G, XM_005246065.1:c.1846A>G, XM_005246066.1:c.625A>G, XM_005246067.1:c.625A>G, XM_005246068.1:c.625A>GVOUS07/21/2016
132COL6A3Ex5NM_004369.3:c.1867C>Tp.Pro623Ser | p.P623SLRG_473t1:c.1867C>T, NM_004369.3:c.1867C>T, NM_057164.3:c.1867C>T, NM_057164.4:c.646C>T, NM_057165.3:c.1867C>T, NM_057165.4:c.1249C>T, NM_057166.3:c.1264C>T, NM_057166.4:c.646C>T, NM_057167.3:c.1249C>T, XM_005246065.1:c.1867C>T, XM_005246066.1:c.646C>T, XM_005246067.1:c.646C>T, XM_005246068.1:c.646C>TVOUS12/12/2017
133COL6A3Ex5NM_004369.3:c.1872C>Ap.Leu624= | p.L624=LRG_473t1:c.1872C>A, NM_004369.3:c.1872C>A, NM_057164.3:c.1872C>A, NM_057164.4:c.651C>A, NM_057165.3:c.1872C>A, NM_057165.4:c.1254C>A, NM_057166.3:c.1269C>A, NM_057166.4:c.651C>A, NM_057167.3:c.1254C>A, XM_005246065.1:c.1872C>A, XM_005246066.1:c.651C>A, XM_005246067.1:c.651C>A, XM_005246068.1:c.651C>AVOUS06/16/2016
134COL6A3Ex5NM_004369.3:c.1897+3A>GLRG_473t1:c.1897+3A>G, NM_004369.3:c.1897+3A>G, NM_057164.3:c.1897+3A>G, NM_057164.4:c.676+3A>G, NM_057165.3:c.1897+3A>G, NM_057165.4:c.1279+3A>G, NM_057166.3:c.1294+3A>G, NM_057166.4:c.676+3A>G, NM_057167.3:c.1279+3A>G, XM_005246065.1:c.1897+3A>G, XM_005246066.1:c.676+3A>G, XM_005246067.1:c.676+3A>G, XM_005246068.1:c.676+3A>GVOUS06/28/2018
135COL6A3Ex6NM_004369.3:c.1898-10T>CLRG_473t1:c.1898-10T>C, NM_004369.3:c.1898-10T>C, NM_057164.3:c.1898-10T>C, NM_057164.4:c.677-10T>C, NM_057165.3:c.1897+1670T>C, NM_057165.4:c.1280-10T>C, NM_057166.3:c.1295-10T>C, NM_057166.4:c.676+1670T>C, NM_057167.3:c.1280-10T>C, XM_005246065.1:c.1897+1670T>C, XM_005246066.1:c.677-10T>C, XM_005246067.1:c.676+1670T>C, XM_005246068.1:c.677-10T>CVOUS11/08/2018
136COL6A3Ex6NM_004369.3:c.1898-5T>CLRG_473t1:c.1898-5T>C, NM_004369.3:c.1898-5T>C, NM_057164.3:c.1898-5T>C, NM_057164.4:c.677-5T>C, NM_057165.3:c.1897+1675T>C, NM_057165.4:c.1280-5T>C, NM_057166.3:c.1295-5T>C, NM_057166.4:c.676+1675T>C, NM_057167.3:c.1280-5T>C, XM_005246065.1:c.1897+1675T>C, XM_005246066.1:c.677-5T>C, XM_005246067.1:c.676+1675T>C, XM_005246068.1:c.677-5T>CVOUS03/28/2017
137COL6A3Ex6NM_004369.3:c.1914G>Ap.Arg638= | p.R638=Benign11/05/2012 
138COL6A3Ex6NM_004369.3:c.1920C>Ap.Ile640= | p.I640=LRG_473t1:c.1920C>A, NM_004369.3:c.1920C>A, NM_057164.3:c.1920C>A, NM_057164.4:c.699C>A, NM_057165.3:c.1897+1702C>A, NM_057165.4:c.1302C>A, NM_057166.3:c.1317C>A, NM_057166.4:c.676+1702C>A, NM_057167.3:c.1302C>A, XM_005246065.1:c.1897+1702C>A, XM_005246066.1:c.699C>A, XM_005246067.1:c.676+1702C>A, XM_005246068.1:c.699C>AVOUS12/08/2016
139COL6A3Ex6NM_004369.3:c.1939T>Ap.Ser647Thr | p.S647TLRG_473t1:c.1939T>A, NM_004369.3:c.1939T>A, NM_057164.3:c.1939T>A, NM_057164.4:c.718T>A, NM_057165.3:c.1897+1721T>A, NM_057165.4:c.1321T>A, NM_057166.3:c.1336T>A, NM_057166.4:c.676+1721T>A, NM_057167.3:c.1321T>A, XM_005246065.1:c.1897+1721T>A, XM_005246066.1:c.718T>A, XM_005246067.1:c.676+1721T>A, XM_005246068.1:c.718T>AVOUS04/12/2016
140COL6A3Ex6NM_004369.3:c.1948G>Ap.Val650Ile | p.V650INM_004369.3:c.1948G>A, NM_057164.3:c.1948G>A, NM_057164.4:c.727G>A, NM_057165.3:c.1897+1730G>A, NM_057165.4:c.1330G>A, NM_057166.3:c.1345G>A, NM_057166.4:c.676+1730G>A, NM_057167.3:c.1330G>A, XM_005246065.1:c.1897+1730G>A, XM_005246066.1:c.727G>A, XM_005246067.1:c.676+1730G>A, XM_005246068.1:c.727G>AVOUS01/05/2015
141COL6A3Ex6NM_004369.3:c.1958C>Ap.Thr653Asn | p.T653NLRG_473t1:c.1958C>A, NM_004369.3:c.1958C>A, NM_057164.3:c.1958C>A, NM_057164.4:c.737C>A, NM_057165.3:c.1897+1740C>A, NM_057165.4:c.1340C>A, NM_057166.3:c.1355C>A, NM_057166.4:c.676+1740C>A, NM_057167.3:c.1340C>A, XM_005246065.1:c.1897+1740C>A, XM_005246066.1:c.737C>A, XM_005246067.1:c.676+1740C>A, XM_005246068.1:c.737C>AVOUS06/07/2018
142COL6A3Ex6NM_004369.3:c.1961A>Gp.Asn654Ser | p.N654SNM_004369.3:c.1961A>G, NM_057164.3:c.1961A>G, NM_057164.4:c.740A>G, NM_057165.3:c.1897+1743A>G, NM_057165.4:c.1343A>G, NM_057166.3:c.1358A>G, NM_057166.4:c.676+1743A>G, NM_057167.3:c.1343A>G, XM_005246065.1:c.1897+1743A>G, XM_005246066.1:c.740A>G, XM_005246067.1:c.676+1743A>G, XM_005246068.1:c.740A>GVOUS07/17/2015
143COL6A3Ex6NM_004369.3:c.1971T>Cp.Tyr657= | p.Y657=LRG_473t1:c.1971T>C, NM_004369.3:c.1971T>C, NM_057164.3:c.1971T>C, NM_057164.4:c.750T>C, NM_057165.3:c.1897+1753T>C, NM_057165.4:c.1353T>C, NM_057166.3:c.1368T>C, NM_057166.4:c.676+1753T>C, NM_057167.3:c.1353T>C, XM_005246065.1:c.1897+1753T>C, XM_005246066.1:c.750T>C, XM_005246067.1:c.676+1753T>C, XM_005246068.1:c.750T>CVOUS06/09/2017
144COL6A3Ex6NM_004369.3:c.1975C>Tp.Arg659Cys | p.R659CLRG_473t1:c.1975C>T, NM_004369.3:c.1975C>T, NM_057164.3:c.1975C>T, NM_057164.4:c.754C>T, NM_057165.3:c.1897+1757C>T, NM_057165.4:c.1357C>T, NM_057166.3:c.1372C>T, NM_057166.4:c.676+1757C>T, NM_057167.3:c.1357C>T, XM_005246065.1:c.1897+1757C>T, XM_005246066.1:c.754C>T, XM_005246067.1:c.676+1757C>T, XM_005246068.1:c.754C>TVOUS07/24/2018
145COL6A3Ex6NM_004369.3:c.1976G>Ap.Arg659His | p.R659HLRG_473t1:c.1976G>A, NM_004369.3:c.1976G>A, NM_057164.3:c.1976G>A, NM_057164.4:c.755G>A, NM_057165.3:c.1897+1758G>A, NM_057165.4:c.1358G>A, NM_057166.3:c.1373G>A, NM_057166.4:c.676+1758G>A, NM_057167.3:c.1358G>A, XM_005246065.1:c.1897+1758G>A, XM_005246066.1:c.755G>A, XM_005246067.1:c.676+1758G>A, XM_005246068.1:c.755G>ABenign11/05/2012 
146COL6A3Ex6NM_004369.3:c.1977C>Tp.Arg659= | p.R659=LRG_473t1:c.1977C>T, NM_004369.3:c.1977C>T, NM_057164.3:c.1977C>T, NM_057164.4:c.756C>T, NM_057165.3:c.1897+1759C>T, NM_057165.4:c.1359C>T, NM_057166.3:c.1374C>T, NM_057166.4:c.676+1759C>T, NM_057167.3:c.1359C>T, XM_005246065.1:c.1897+1759C>T, XM_005246066.1:c.756C>T, XM_005246067.1:c.676+1759C>T, XM_005246068.1:c.756C>TVOUS12/21/2017
147COL6A3Ex6NM_004369.3:c.2029C>Tp.Arg677Cys | p.R677CLRG_473t1:c.2029C>T, NM_004369.3:c.2029C>T, NM_057164.3:c.2029C>T, NM_057164.4:c.808C>T, NM_057165.3:c.1898-1760C>T, NM_057165.4:c.1411C>T, NM_057166.3:c.1426C>T, NM_057166.4:c.677-1760C>T, NM_057167.3:c.1411C>T, XM_005246065.1:c.1898-1760C>T, XM_005246066.1:c.808C>T, XM_005246067.1:c.677-1760C>T, XM_005246068.1:c.808C>TVOUS04/04/2017
148COL6A3Ex6NM_004369.3:c.2030G>Tp.Arg677Leu | p.R677LLRG_473t1:c.2030G>T, NM_004369.3:c.2030G>T, NM_057164.3:c.2030G>T, NM_057164.4:c.809G>T, NM_057165.3:c.1898-1759G>T, NM_057165.4:c.1412G>T, NM_057166.3:c.1427G>T, NM_057166.4:c.677-1759G>T, NM_057167.3:c.1412G>T, XM_005246065.1:c.1898-1759G>T, XM_005246066.1:c.809G>T, XM_005246067.1:c.677-1759G>T, XM_005246068.1:c.809G>TVOUS06/01/2016
149COL6A3Ex6NM_004369.3:c.2030G>Ap.Arg677His | p.R677HLRG_473t1:c.2030G>A, NM_004369.3:c.2030G>A, NM_057164.3:c.2030G>A, NM_057164.4:c.809G>A, NM_057165.3:c.1898-1759G>A, NM_057165.4:c.1412G>A, NM_057166.3:c.1427G>A, NM_057166.4:c.677-1759G>A, NM_057167.3:c.1412G>A, XM_005246065.1:c.1898-1759G>A, XM_005246066.1:c.809G>A, XM_005246067.1:c.677-1759G>A, XM_005246068.1:c.809G>ABenign03/06/2015 
150COL6A3Ex6NM_004369.3:c.2035G>Tp.Gly679Cys | p.G679CLRG_473t1:c.2035G>T, NM_004369.3:c.2035G>T, NM_057164.3:c.2035G>T, NM_057164.4:c.814G>T, NM_057165.3:c.1898-1754G>T, NM_057165.4:c.1417G>T, NM_057166.3:c.1432G>T, NM_057166.4:c.677-1754G>T, NM_057167.3:c.1417G>T, XM_005246065.1:c.1898-1754G>T, XM_005246066.1:c.814G>T, XM_005246067.1:c.677-1754G>T, XM_005246068.1:c.814G>TVOUS08/24/2018
151COL6A3Ex6NM_004369.3:c.2068G>Ap.Glu690Lys | p.E690KLRG_473t1:c.2068G>A, NM_004369.3:c.2068G>A, NM_057164.3:c.2068G>A, NM_057164.4:c.847G>A, NM_057165.3:c.1898-1721G>A, NM_057165.4:c.1450G>A, NM_057166.3:c.1465G>A, NM_057166.4:c.677-1721G>A, NM_057167.3:c.1450G>A, XM_005246065.1:c.1898-1721G>A, XM_005246066.1:c.847G>A, XM_005246067.1:c.677-1721G>A, XM_005246068.1:c.847G>AVOUS03/16/2018
152COL6A3Ex6NM_004369.3:c.2083A>Gp.Thr695Ala | p.T695ALRG_473t1:c.2083A>G, NM_004369.3:c.2083A>G, NM_057164.3:c.2083A>G, NM_057164.4:c.862A>G, NM_057165.3:c.1898-1706A>G, NM_057165.4:c.1465A>G, NM_057166.3:c.1480A>G, NM_057166.4:c.677-1706A>G, NM_057167.3:c.1465A>G, XM_005246065.1:c.1898-1706A>G, XM_005246066.1:c.862A>G, XM_005246067.1:c.677-1706A>G, XM_005246068.1:c.862A>GVOUS04/04/2018
153COL6A3Ex6NM_004369.3:c.2086T>Cp.Tyr696His | p.Y696HLRG_473t1:c.2086T>C, NM_004369.3:c.2086T>C, NM_057164.3:c.2086T>C, NM_057164.4:c.865T>C, NM_057165.3:c.1898-1703T>C, NM_057165.4:c.1468T>C, NM_057166.3:c.1483T>C, NM_057166.4:c.677-1703T>C, NM_057167.3:c.1468T>C, XM_005246065.1:c.1898-1703T>C, XM_005246066.1:c.865T>C, XM_005246067.1:c.677-1703T>C, XM_005246068.1:c.865T>CVOUS06/26/2018
154COL6A3Ex6NM_004369.3:c.2094C>Tp.Thr698= | p.T698=LRG_473t1:c.2094C>T, NM_004369.3:c.2094C>T, NM_057164.3:c.2094C>T, NM_057164.4:c.873C>T, NM_057165.3:c.1898-1695C>T, NM_057165.4:c.1476C>T, NM_057166.3:c.1491C>T, NM_057166.4:c.677-1695C>T, NM_057167.3:c.1476C>T, XM_005246065.1:c.1898-1695C>T, XM_005246066.1:c.873C>T, XM_005246067.1:c.677-1695C>T, XM_005246068.1:c.873C>TVOUS08/07/2017
155COL6A3Ex6NM_004369.3:c.2145G>Tp.Ser715= | p.S715=LRG_473t1:c.2145G>T, NM_004369.3:c.2145G>T, NM_057164.3:c.2145G>T, NM_057164.4:c.924G>T, NM_057165.3:c.1898-1644G>T, NM_057165.4:c.1527G>T, NM_057166.3:c.1542G>T, NM_057166.4:c.677-1644G>T, NM_057167.3:c.1527G>T, XM_005246065.1:c.1898-1644G>T, XM_005246066.1:c.924G>T, XM_005246067.1:c.677-1644G>T, XM_005246068.1:c.924G>TVOUS07/17/2017
156COL6A3Ex6NM_004369.3:c.2145G>Ap.Ser715= | p.S715=LRG_473t1:c.2145G>A, NM_004369.3:c.2145G>A, NM_057164.3:c.2145G>A, NM_057164.4:c.924G>A, NM_057165.3:c.1898-1644G>A, NM_057165.4:c.1527G>A, NM_057166.3:c.1542G>A, NM_057166.4:c.677-1644G>A, NM_057167.3:c.1527G>A, XM_005246065.1:c.1898-1644G>A, XM_005246066.1:c.924G>A, XM_005246067.1:c.677-1644G>A, XM_005246068.1:c.924G>AVOUS03/10/2016
157COL6A3Ex6NM_004369.3:c.2146G>Ap.Gly716Ser | p.G716SLRG_473t1:c.2146G>A, NM_004369.3:c.2146G>A, NM_057164.3:c.2146G>A, NM_057164.4:c.925G>A, NM_057165.3:c.1898-1643G>A, NM_057165.4:c.1528G>A, NM_057166.3:c.1543G>A, NM_057166.4:c.677-1643G>A, NM_057167.3:c.1528G>A, XM_005246065.1:c.1898-1643G>A, XM_005246066.1:c.925G>A, XM_005246067.1:c.677-1643G>A, XM_005246068.1:c.925G>AVOUS11/13/2017
158COL6A3Ex6NM_004369.3:c.2147G>Ap.Gly716Asp | p.G716DLRG_473t1:c.2147G>A, NM_004369.3:c.2147G>A, NM_057164.3:c.2147G>A, NM_057164.4:c.926G>A, NM_057165.3:c.1898-1642G>A, NM_057165.4:c.1529G>A, NM_057166.3:c.1544G>A, NM_057166.4:c.677-1642G>A, NM_057167.3:c.1529G>A, XM_005246065.1:c.1898-1642G>A, XM_005246066.1:c.926G>A, XM_005246067.1:c.677-1642G>A, XM_005246068.1:c.926G>ALikely benign06/03/2016 
159COL6A3Ex6NM_004369.3:c.2180A>Cp.Tyr727Ser | p.Y727SLRG_473t1:c.2180A>C, NM_004369.3:c.2180A>C, NM_057164.3:c.2180A>C, NM_057164.4:c.959A>C, NM_057165.3:c.1898-1609A>C, NM_057165.4:c.1562A>C, NM_057166.3:c.1577A>C, NM_057166.4:c.677-1609A>C, NM_057167.3:c.1562A>C, XM_005246065.1:c.1898-1609A>C, XM_005246066.1:c.959A>C, XM_005246067.1:c.677-1609A>C, XM_005246068.1:c.959A>CVOUS10/04/2016
160COL6A3Ex6NM_004369.3:c.2196G>Ap.Thr732= | p.T732=LRG_473t1:c.2196G>A, NM_004369.3:c.2196G>A, NM_057164.3:c.2196G>A, NM_057164.4:c.975G>A, NM_057165.3:c.1898-1593G>A, NM_057165.4:c.1578G>A, NM_057166.3:c.1593G>A, NM_057166.4:c.677-1593G>A, NM_057167.3:c.1578G>A, XM_005246065.1:c.1898-1593G>A, XM_005246066.1:c.975G>A, XM_005246067.1:c.677-1593G>A, XM_005246068.1:c.975G>AVOUS06/02/2016
161COL6A3Ex6NM_004369.3:c.2205C>Tp.Gly735= | p.G735=LRG_473t1:c.2205C>T, NM_004369.3:c.2205C>T, NM_057164.3:c.2205C>T, NM_057164.4:c.984C>T, NM_057165.3:c.1898-1584C>T, NM_057165.4:c.1587C>T, NM_057166.3:c.1602C>T, NM_057166.4:c.677-1584C>T, NM_057167.3:c.1587C>T, XM_005246065.1:c.1898-1584C>T, XM_005246066.1:c.984C>T, XM_005246067.1:c.677-1584C>T, XM_005246068.1:c.984C>TLikely benign02/09/2018 
162COL6A3Ex6NM_004369.3:c.2206G>Ap.Gly736Ser | p.G736SLRG_473t1:c.2206G>A, NM_004369.3:c.2206G>A, NM_057164.3:c.2206G>A, NM_057164.4:c.985G>A, NM_057165.3:c.1898-1583G>A, NM_057165.4:c.1588G>A, NM_057166.3:c.1603G>A, NM_057166.4:c.677-1583G>A, NM_057167.3:c.1588G>A, XM_005246065.1:c.1898-1583G>A, XM_005246066.1:c.985G>A, XM_005246067.1:c.677-1583G>A, XM_005246068.1:c.985G>AVOUS04/04/2018
163COL6A3Ex6NM_004369.3:c.2218C>Tp.Arg740Cys | p.R740CLRG_473t1:c.2218C>T, NM_004369.3:c.2218C>T, NM_057164.3:c.2218C>T, NM_057164.4:c.997C>T, NM_057165.3:c.1898-1571C>T, NM_057165.4:c.1600C>T, NM_057166.3:c.1615C>T, NM_057166.4:c.677-1571C>T, NM_057167.3:c.1600C>T, XM_005246065.1:c.1898-1571C>T, XM_005246066.1:c.997C>T, XM_005246067.1:c.677-1571C>T, XM_005246068.1:c.997C>TVOUS06/27/2017
164COL6A3Ex6NM_004369.3:c.2219G>Ap.Arg740His | p.R740HNM_004369.3:c.2219G>A, NM_057164.3:c.2219G>A, NM_057164.4:c.998G>A, NM_057165.3:c.1898-1570G>A, NM_057165.4:c.1601G>A, NM_057166.3:c.1616G>A, NM_057166.4:c.677-1570G>A, NM_057167.3:c.1601G>A, XM_005246065.1:c.1898-1570G>A, XM_005246066.1:c.998G>A, XM_005246067.1:c.677-1570G>A, XM_005246068.1:c.998G>AVOUS10/28/2015
165COL6A3Ex6NM_004369.3:c.2231C>Tp.Pro744Leu | p.P744LLRG_473t1:c.2231C>T, NM_004369.3:c.2231C>T, NM_057164.3:c.2231C>T, NM_057164.4:c.1010C>T, NM_057165.3:c.1898-1558C>T, NM_057165.4:c.1613C>T, NM_057166.3:c.1628C>T, NM_057166.4:c.677-1558C>T, NM_057167.3:c.1613C>T, XM_005246065.1:c.1898-1558C>T, XM_005246066.1:c.1010C>T, XM_005246067.1:c.677-1558C>T, XM_005246068.1:c.1010C>TVOUS09/26/2018
166COL6A3Ex6NM_004369.3:c.2232G>Ap.Pro744= | p.P744=NM_004369.3:c.2232G>A, NM_057164.3:c.2232G>A, NM_057164.4:c.1011G>A, NM_057165.3:c.1898-1557G>A, NM_057165.4:c.1614G>A, NM_057166.3:c.1629G>A, NM_057166.4:c.677-1557G>A, NM_057167.3:c.1614G>A, XM_005246065.1:c.1898-1557G>A, XM_005246066.1:c.1011G>A, XM_005246067.1:c.677-1557G>A, XM_005246068.1:c.1011G>AVOUS01/05/2016
167COL6A3Ex6NM_004369.3:c.2261A>Gp.Gln754Arg | p.Q754RNM_004369.3:c.2261A>G, NM_057164.3:c.2261A>G, NM_057164.4:c.1040A>G, NM_057165.3:c.1898-1528A>G, NM_057165.4:c.1643A>G, NM_057166.3:c.1658A>G, NM_057166.4:c.677-1528A>G, NM_057167.3:c.1643A>G, XM_005246065.1:c.1898-1528A>G, XM_005246066.1:c.1040A>G, XM_005246067.1:c.677-1528A>G, XM_005246068.1:c.1040A>GVOUS08/19/2015
168COL6A3Ex6NM_004369.3:c.2292C>Tp.Asn764= | p.N764=LRG_473t1:c.2292C>T, NM_004369.3:c.2292C>T, NM_057164.3:c.2292C>T, NM_057164.4:c.1071C>T, NM_057165.3:c.1898-1497C>T, NM_057165.4:c.1674C>T, NM_057166.3:c.1689C>T, NM_057166.4:c.677-1497C>T, NM_057167.3:c.1674C>T, XM_005246065.1:c.1898-1497C>T, XM_005246066.1:c.1071C>T, XM_005246067.1:c.677-1497C>T, XM_005246068.1:c.1071C>TVOUS09/20/2018
169COL6A3Ex6NM_004369.3:c.2303G>Ap.Arg768His | p.R768HLRG_473t1:c.2303G>A, NM_004369.3:c.2303G>A, NM_057164.3:c.2303G>A, NM_057164.4:c.1082G>A, NM_057165.3:c.1898-1486G>A, NM_057165.4:c.1685G>A, NM_057166.3:c.1700G>A, NM_057166.4:c.677-1486G>A, NM_057167.3:c.1685G>A, XM_005246065.1:c.1898-1486G>A, XM_005246066.1:c.1082G>A, XM_005246067.1:c.677-1486G>A, XM_005246068.1:c.1082G>AVOUS09/25/2018
170COL6A3Ex6NM_004369.3:c.2304C>Tp.Arg768= | p.R768=LRG_473t1:c.2304C>T, NM_004369.3:c.2304C>T, NM_057164.3:c.2304C>T, NM_057164.4:c.1083C>T, NM_057165.3:c.1898-1485C>T, NM_057165.4:c.1686C>T, NM_057166.3:c.1701C>T, NM_057166.4:c.677-1485C>T, NM_057167.3:c.1686C>T, XM_005246065.1:c.1898-1485C>T, XM_005246066.1:c.1083C>T, XM_005246067.1:c.677-1485C>T, XM_005246068.1:c.1083C>TVOUS11/06/2018
171COL6A3Ex6NM_004369.3:c.2305G>Ap.Ala769Thr | p.A769TLRG_473t1:c.2305G>A, NM_004369.3:c.2305G>A, NM_057164.3:c.2305G>A, NM_057164.4:c.1084G>A, NM_057165.3:c.1898-1484G>A, NM_057165.4:c.1687G>A, NM_057166.3:c.1702G>A, NM_057166.4:c.677-1484G>A, NM_057167.3:c.1687G>A, XM_005246065.1:c.1898-1484G>A, XM_005246066.1:c.1084G>A, XM_005246067.1:c.677-1484G>A, XM_005246068.1:c.1084G>AVOUS04/26/2017
172COL6A3Ex6NM_004369.3:c.2306C>Tp.Ala769Val | p.A769VLRG_473t1:c.2306C>T, NM_004369.3:c.2306C>T, NM_057164.3:c.2306C>T, NM_057164.4:c.1085C>T, NM_057165.3:c.1898-1483C>T, NM_057165.4:c.1688C>T, NM_057166.3:c.1703C>T, NM_057166.4:c.677-1483C>T, NM_057167.3:c.1688C>T, XM_005246065.1:c.1898-1483C>T, XM_005246066.1:c.1085C>T, XM_005246067.1:c.677-1483C>T, XM_005246068.1:c.1085C>TVOUS12/28/2016
173COL6A3Ex6NM_004369.3:c.2324G>Tp.Cys775Phe | p.C775FLRG_473t1:c.2324G>T, NM_004369.3:c.2324G>T, NM_057164.3:c.2324G>T, NM_057164.4:c.1103G>T, NM_057165.3:c.1898-1465G>T, NM_057165.4:c.1706G>T, NM_057166.3:c.1721G>T, NM_057166.4:c.677-1465G>T, NM_057167.3:c.1706G>T, XM_005246065.1:c.1898-1465G>T, XM_005246066.1:c.1103G>T, XM_005246067.1:c.677-1465G>T, XM_005246068.1:c.1103G>TVOUS09/08/2016
174COL6A3Ex6NM_004369.3:c.2343G>Ap.Ala781= | p.A781=LRG_473t1:c.2343G>A, NM_004369.3:c.2343G>A, NM_057164.3:c.2343G>A, NM_057164.4:c.1122G>A, NM_057165.3:c.1898-1446G>A, NM_057165.4:c.1725G>A, NM_057166.3:c.1740G>A, NM_057166.4:c.677-1446G>A, NM_057167.3:c.1725G>A, XM_005246065.1:c.1898-1446G>A, XM_005246066.1:c.1122G>A, XM_005246067.1:c.677-1446G>A, XM_005246068.1:c.1122G>AVOUS09/08/2015
175COL6A3Ex6NM_004369.3:c.2350G>Ap.Ala784Thr | p.A784TLRG_473t1:c.2350G>A, NM_004369.3:c.2350G>A, NM_057164.3:c.2350G>A, NM_057164.4:c.1129G>A, NM_057165.3:c.1898-1439G>A, NM_057165.4:c.1732G>A, NM_057166.3:c.1747G>A, NM_057166.4:c.677-1439G>A, NM_057167.3:c.1732G>A, XM_005246065.1:c.1898-1439G>A, XM_005246066.1:c.1129G>A, XM_005246067.1:c.677-1439G>A, XM_005246068.1:c.1129G>AVOUS03/28/2017
176COL6A3Ex6NM_004369.3:c.2354A>Cp.Glu785Ala | p.E785ALRG_473t1:c.2354A>C, NM_004369.3:c.2354A>C, NM_057164.3:c.2354A>C, NM_057164.4:c.1133A>C, NM_057165.3:c.1898-1435A>C, NM_057165.4:c.1736A>C, NM_057166.3:c.1751A>C, NM_057166.4:c.677-1435A>C, NM_057167.3:c.1736A>C, XM_005246065.1:c.1898-1435A>C, XM_005246066.1:c.1133A>C, XM_005246067.1:c.677-1435A>C, XM_005246068.1:c.1133A>CVOUS06/27/2017
177COL6A3Ex6NM_004369.3:c.2367T>Ap.Ile789= | p.I789=LRG_473t1:c.2367T>A, NM_004369.3:c.2367T>A, NM_057164.3:c.2367T>A, NM_057164.4:c.1146T>A, NM_057165.3:c.1898-1422T>A, NM_057165.4:c.1749T>A, NM_057166.3:c.1764T>A, NM_057166.4:c.677-1422T>A, NM_057167.3:c.1749T>A, XM_005246065.1:c.1898-1422T>A, XM_005246066.1:c.1146T>A, XM_005246067.1:c.677-1422T>A, XM_005246068.1:c.1146T>AVOUS03/03/2016
178COL6A3Ex6NM_004369.3:c.2419G>Ap.Ala807Thr | p.A807TNM_004369.3:c.2419G>A, NM_057164.3:c.2419G>A, NM_057164.4:c.1198G>A, NM_057165.3:c.1898-1370G>A, NM_057165.4:c.1801G>A, NM_057166.3:c.1816G>A, NM_057166.4:c.677-1370G>A, NM_057167.3:c.1801G>ABenign11/05/2012 
179COL6A3Ex6NM_004369.3:c.2444C>Ap.Pro815His | p.P815HLRG_473t1:c.2444C>A, NM_004369.3:c.2444C>A, NM_057164.3:c.2444C>A, NM_057164.4:c.1223C>A, NM_057165.3:c.1898-1345C>A, NM_057165.4:c.1826C>A, NM_057166.3:c.1841C>A, NM_057166.4:c.677-1345C>A, NM_057167.3:c.1826C>A, XM_005246065.1:c.1898-1345C>A, XM_005246066.1:c.1223C>A, XM_005246067.1:c.677-1345C>A, XM_005246068.1:c.1223C>AVOUS07/18/2018
180COL6A3Ex6NM_004369.3:c.2463T>Cp.Ser821= | p.S821=NM_004369.3:c.2463T>C, NM_057164.3:c.2463T>C, NM_057164.4:c.1242T>C, NM_057165.3:c.1898-1326T>C, NM_057165.4:c.1845T>C, NM_057166.3:c.1860T>C, NM_057166.4:c.677-1326T>C, NM_057167.3:c.1845T>C, XM_005246065.1:c.1898-1326T>C, XM_005246066.1:c.1242T>C, XM_005246067.1:c.677-1326T>C, XM_005246068.1:c.1242T>CLikely benign07/14/2015 
181COL6A3Ex6NM_004369.3:c.2487C>Tp.Leu829= | p.L829=LRG_473t1:c.2487C>T, NM_004369.3:c.2487C>T, NM_057164.3:c.2487C>T, NM_057164.4:c.1266C>T, NM_057165.3:c.1898-1302C>T, NM_057165.4:c.1869C>T, NM_057166.3:c.1884C>T, NM_057166.4:c.677-1302C>T, NM_057167.3:c.1869C>T, XM_005246065.1:c.1898-1302C>T, XM_005246066.1:c.1266C>T, XM_005246067.1:c.677-1302C>T, XM_005246068.1:c.1266C>TVOUS07/18/2018
182COL6A3Ex6NM_004369.3:c.2488G>Ap.Ala830Thr | p.A830TLRG_473t1:c.2488G>A, NM_004369.3:c.2488G>A, NM_057164.3:c.2488G>A, NM_057164.4:c.1267G>A, NM_057165.3:c.1898-1301G>A, NM_057165.4:c.1870G>A, NM_057166.3:c.1885G>A, NM_057166.4:c.677-1301G>A, NM_057167.3:c.1870G>A, XM_005246065.1:c.1898-1301G>A, XM_005246066.1:c.1267G>A, XM_005246067.1:c.677-1301G>A, XM_005246068.1:c.1267G>AVOUS03/07/2017
183COL6A3Ex6NM_004369.3:c.2488G>Tp.Ala830Ser | p.A830SNM_004369.3:c.2488G>T, NM_057164.3:c.2488G>T, NM_057164.4:c.1267G>T, NM_057165.3:c.1898-1301G>T, NM_057165.4:c.1870G>T, NM_057166.3:c.1885G>T, NM_057166.4:c.677-1301G>T, NM_057167.3:c.1870G>TBenign02/14/2014 
184COL6A3Ex6NM_004369.3:c.2497+9C>TLRG_473t1:c.2497+9C>T, NM_004369.3:c.2497+9C>T, NM_057164.3:c.2497+9C>T, NM_057164.4:c.1276+9C>T, NM_057165.3:c.1898-1283C>T, NM_057165.4:c.1879+9C>T, NM_057166.3:c.1894+9C>T, NM_057166.4:c.677-1283C>T, NM_057167.3:c.1879+9C>T, XM_005246065.1:c.1898-1283C>T, XM_005246066.1:c.1276+9C>T, XM_005246067.1:c.677-1283C>T, XM_005246068.1:c.1276+9C>TVOUS02/18/2016
185COL6A3Ex6NM_004369.3:c.2497+9C>ALRG_473t1:c.2497+9C>A, NM_004369.3:c.2497+9C>A, NM_057164.3:c.2497+9C>A, NM_057164.4:c.1276+9C>A, NM_057165.3:c.1898-1283C>A, NM_057165.4:c.1879+9C>A, NM_057166.3:c.1894+9C>A, NM_057166.4:c.677-1283C>A, NM_057167.3:c.1879+9C>A, XM_005246065.1:c.1898-1283C>A, XM_005246066.1:c.1276+9C>A, XM_005246067.1:c.677-1283C>A, XM_005246068.1:c.1276+9C>AVOUS06/09/2016
186COL6A3Ex7NM_004369.3:c.2507G>Tp.Arg836Leu | p.R836LLRG_473t1:c.2507G>T, NM_004369.3:c.2507G>T, NM_057164.3:c.2507G>T, NM_057164.4:c.1286G>T, NM_057165.3:c.1907G>T, NM_057165.4:c.1889G>T, NM_057166.3:c.1904G>T, NM_057166.4:c.686G>T, NM_057167.3:c.1889G>T, XM_005246065.1:c.1907G>T, XM_005246066.1:c.1286G>T, XM_005246067.1:c.686G>T, XM_005246068.1:c.1286G>TVOUS09/19/2016
187COL6A3Ex7NM_004369.3:c.2525T>Cp.Phe842Ser | p.F842SLRG_473t1:c.2525T>C, NM_004369.3:c.2525T>C, NM_057164.3:c.2525T>C, NM_057164.4:c.1304T>C, NM_057165.3:c.1925T>C, NM_057165.4:c.1907T>C, NM_057166.3:c.1922T>C, NM_057166.4:c.704T>C, NM_057167.3:c.1907T>C, XM_005246065.1:c.1925T>C, XM_005246066.1:c.1304T>C, XM_005246067.1:c.704T>C, XM_005246068.1:c.1304T>CVOUS10/11/2016
188COL6A3Ex7NM_004369.3:c.2529C>Tp.Asp843= | p.D843=LRG_473t1:c.2529C>T, NM_004369.3:c.2529C>T, NM_057164.3:c.2529C>T, NM_057164.4:c.1308C>T, NM_057165.3:c.1929C>T, NM_057165.4:c.1911C>T, NM_057166.3:c.1926C>T, NM_057166.4:c.708C>T, NM_057167.3:c.1911C>T, XM_005246065.1:c.1929C>T, XM_005246066.1:c.1308C>T, XM_005246067.1:c.708C>T, XM_005246068.1:c.1308C>TVOUS07/11/2016
189COL6A3Ex7NM_004369.3:c.2544T>Cp.Leu848= | p.L848=LRG_473t1:c.2544T>C, NM_004369.3:c.2544T>C, NM_057164.3:c.2544T>C, NM_057164.4:c.1323T>C, NM_057165.3:c.1944T>C, NM_057165.4:c.1926T>C, NM_057166.3:c.1941T>C, NM_057166.4:c.723T>C, NM_057167.3:c.1926T>C, XM_005246065.1:c.1944T>C, XM_005246066.1:c.1323T>C, XM_005246067.1:c.723T>C, XM_005246068.1:c.1323T>CVOUS07/31/2018
190COL6A3Ex7NM_004369.3:c.2561T>Cp.Val854Ala | p.V854ALRG_473t1:c.2561T>C, NM_004369.3:c.2561T>C, NM_057164.3:c.2561T>C, NM_057164.4:c.1340T>C, NM_057165.3:c.1961T>C, NM_057165.4:c.1943T>C, NM_057166.3:c.1958T>C, NM_057166.4:c.740T>C, NM_057167.3:c.1943T>C, XM_005246065.1:c.1961T>C, XM_005246066.1:c.1340T>C, XM_005246067.1:c.740T>C, XM_005246068.1:c.1340T>CVOUS03/20/2018
191COL6A3Ex7NM_004369.3:c.2600A>Tp.Asn867Ile | p.N867ILRG_473t1:c.2600A>T, NM_004369.3:c.2600A>T, NM_057164.3:c.2600A>T, NM_057164.4:c.1379A>T, NM_057165.3:c.2000A>T, NM_057165.4:c.1982A>T, NM_057166.3:c.1997A>T, NM_057166.4:c.779A>T, NM_057167.3:c.1982A>T, XM_005246065.1:c.2000A>T, XM_005246066.1:c.1379A>T, XM_005246067.1:c.779A>T, XM_005246068.1:c.1379A>TVOUS12/06/2016
192COL6A3Ex7NM_004369.3:c.2613G>Ap.Glu871= | p.E871=LRG_473t1:c.2613G>A, NM_004369.3:c.2613G>A, NM_057164.3:c.2613G>A, NM_057164.4:c.1392G>A, NM_057165.3:c.2013G>A, NM_057165.4:c.1995G>A, NM_057166.3:c.2010G>A, NM_057166.4:c.792G>A, NM_057167.3:c.1995G>A, XM_005246065.1:c.2013G>A, XM_005246066.1:c.1392G>A, XM_005246067.1:c.792G>A, XM_005246068.1:c.1392G>AVOUS10/13/2017
193COL6A3Ex7NM_004369.3:c.2627C>Tp.Ala876Val | p.A876VLRG_473t1:c.2627C>T, NM_004369.3:c.2627C>T, NM_057164.3:c.2627C>T, NM_057164.4:c.1406C>T, NM_057165.3:c.2027C>T, NM_057165.4:c.2009C>T, NM_057166.3:c.2024C>T, NM_057166.4:c.806C>T, NM_057167.3:c.2009C>T, XM_005246065.1:c.2027C>T, XM_005246066.1:c.1406C>T, XM_005246067.1:c.806C>T, XM_005246068.1:c.1406C>TVOUS07/30/2018
194COL6A3Ex7NM_004369.3:c.2674G>Ap.Glu892Lys | p.E892KNM_004369.3:c.2674G>A, NM_057164.3:c.2674G>A, NM_057164.4:c.1453G>A, NM_057165.3:c.2074G>A, NM_057165.4:c.2056G>A, NM_057166.3:c.2071G>A, NM_057166.4:c.853G>A, NM_057167.3:c.2056G>A, XM_005246065.1:c.2074G>A, XM_005246066.1:c.1453G>A, XM_005246067.1:c.853G>A, XM_005246068.1:c.1453G>AVOUS09/05/2015
195COL6A3Ex7NM_004369.3:c.2730G>Ap.Thr910= | p.T910=LRG_473t1:c.2730G>A, NM_004369.3:c.2730G>A, NM_057164.3:c.2730G>A, NM_057164.4:c.1509G>A, NM_057165.3:c.2130G>A, NM_057165.4:c.2112G>A, NM_057166.3:c.2127G>A, NM_057166.4:c.909G>A, NM_057167.3:c.2112G>A, XM_005246065.1:c.2130G>A, XM_005246066.1:c.1509G>A, XM_005246067.1:c.909G>A, XM_005246068.1:c.1509G>AVOUS11/09/2017
196COL6A3Ex7NM_004369.3:c.2754C>Tp.Tyr918= | p.Y918=LRG_473t1:c.2754C>T, NM_004369.3:c.2754C>T, NM_057164.3:c.2754C>T, NM_057164.4:c.1533C>T, NM_057165.3:c.2154C>T, NM_057165.4:c.2136C>T, NM_057166.3:c.2151C>T, NM_057166.4:c.933C>T, NM_057167.3:c.2136C>T, XM_005246065.1:c.2154C>T, XM_005246066.1:c.1533C>T, XM_005246067.1:c.933C>T, XM_005246068.1:c.1533C>TVOUS06/20/2016
197COL6A3Ex7NM_004369.3:c.2756C>Tp.Ala919Val | p.A919VLRG_473t1:c.2756C>T, NM_004369.3:c.2756C>T, NM_057164.3:c.2756C>T, NM_057164.4:c.1535C>T, NM_057165.3:c.2156C>T, NM_057165.4:c.2138C>T, NM_057166.3:c.2153C>T, NM_057166.4:c.935C>T, NM_057167.3:c.2138C>T, XM_005246065.1:c.2156C>T, XM_005246066.1:c.1535C>T, XM_005246067.1:c.935C>T, XM_005246068.1:c.1535C>TVOUS06/08/2016
198COL6A3Ex7NM_004369.3:c.2808C>Tp.Ile936= | p.I936=LRG_473t1:c.2808C>T, NM_004369.3:c.2808C>T, NM_057164.3:c.2808C>T, NM_057164.4:c.1587C>T, NM_057165.3:c.2208C>T, NM_057165.4:c.2190C>T, NM_057166.3:c.2205C>T, NM_057166.4:c.987C>T, NM_057167.3:c.2190C>T, XM_005246065.1:c.2208C>T, XM_005246066.1:c.1587C>T, XM_005246067.1:c.987C>T, XM_005246068.1:c.1587C>TVOUS02/27/2017
199COL6A3Ex7NM_004369.3:c.2845G>Ap.Ala949Thr | p.A949TLRG_473t1:c.2845G>A, NM_004369.3:c.2845G>A, NM_057164.3:c.2845G>A, NM_057164.4:c.1624G>A, NM_057165.3:c.2245G>A, NM_057165.4:c.2227G>A, NM_057166.3:c.2242G>A, NM_057166.4:c.1024G>A, NM_057167.3:c.2227G>A, XM_005246065.1:c.2245G>A, XM_005246066.1:c.1624G>A, XM_005246067.1:c.1024G>A, XM_005246068.1:c.1624G>AVOUS11/27/2017
200COL6A3Ex7NM_004369.3:c.2863C>Tp.Arg955Cys | p.R955CLRG_473t1:c.2863C>T, NM_004369.3:c.2863C>T, NM_057164.3:c.2863C>T, NM_057164.4:c.1642C>T, NM_057165.3:c.2263C>T, NM_057165.4:c.2245C>T, NM_057166.3:c.2260C>T, NM_057166.4:c.1042C>T, NM_057167.3:c.2245C>T, XM_005246065.1:c.2263C>T, XM_005246066.1:c.1642C>T, XM_005246067.1:c.1042C>T, XM_005246068.1:c.1642C>TVOUS04/29/2016
201COL6A3Ex7NM_004369.3:c.2864G>Ap.Arg955His | p.R955HLRG_473t1:c.2864G>A, NM_004369.3:c.2864G>A, NM_057164.3:c.2864G>A, NM_057164.4:c.1643G>A, NM_057165.3:c.2264G>A, NM_057165.4:c.2246G>A, NM_057166.3:c.2261G>A, NM_057166.4:c.1043G>A, NM_057167.3:c.2246G>A, XM_005246065.1:c.2264G>A, XM_005246066.1:c.1643G>A, XM_005246067.1:c.1043G>A, XM_005246068.1:c.1643G>AVOUS12/19/2016
202COL6A3Ex7NM_004369.3:c.2909C>Gp.Pro970Arg | p.P970RLRG_473t1:c.2909C>G, NM_004369.3:c.2909C>G, NM_057164.3:c.2909C>G, NM_057164.4:c.1688C>G, NM_057165.3:c.2309C>G, NM_057165.4:c.2291C>G, NM_057166.3:c.2306C>G, NM_057166.4:c.1088C>G, NM_057167.3:c.2291C>G, XM_005246065.1:c.2309C>G, XM_005246066.1:c.1688C>G, XM_005246067.1:c.1088C>G, XM_005246068.1:c.1688C>GVOUS08/26/2016
203COL6A3Ex7NM_004369.3:c.2932G>Ap.Ala978Thr | p.A978TLRG_473t1:c.2932G>A, NM_004369.3:c.2932G>A, NM_057164.3:c.2932G>A, NM_057164.4:c.1711G>A, NM_057165.3:c.2332G>A, NM_057165.4:c.2314G>A, NM_057166.3:c.2329G>A, NM_057166.4:c.1111G>A, NM_057167.3:c.2314G>A, XM_005246065.1:c.2332G>A, XM_005246066.1:c.1711G>A, XM_005246067.1:c.1111G>A, XM_005246068.1:c.1711G>AVOUS08/23/2018
204COL6A3Ex7NM_004369.3:c.2952G>Cp.Glu984Asp | p.E984DLRG_473t1:c.2952G>C, NM_004369.3:c.2952G>C, NM_057164.3:c.2952G>C, NM_057164.4:c.1731G>C, NM_057165.3:c.2352G>C, NM_057165.4:c.2334G>C, NM_057166.3:c.2349G>C, NM_057166.4:c.1131G>C, NM_057167.3:c.2334G>C, XM_005246065.1:c.2352G>C, XM_005246066.1:c.1731G>C, XM_005246067.1:c.1131G>C, XM_005246068.1:c.1731G>CVOUS06/05/2017
205COL6A3Ex7NM_004369.3:c.2972C>Ap.Ala991Glu | p.A991ELRG_473t1:c.2972C>A, NM_004369.3:c.2972C>A, NM_057164.3:c.2972C>A, NM_057164.4:c.1751C>A, NM_057165.3:c.2372C>A, NM_057165.4:c.2354C>A, NM_057166.3:c.2369C>A, NM_057166.4:c.1151C>A, NM_057167.3:c.2354C>A, XM_005246065.1:c.2372C>A, XM_005246066.1:c.1751C>A, XM_005246067.1:c.1151C>A, XM_005246068.1:c.1751C>AVOUS02/15/2018
206COL6A3Ex7NM_004369.3:c.2977A>Gp.Ile993Val | p.I993VNM_004369.3:c.2977A>G, NM_057164.3:c.2977A>G, NM_057164.4:c.1756A>G, NM_057165.3:c.2377A>G, NM_057165.4:c.2359A>G, NM_057166.3:c.2374A>G, NM_057166.4:c.1156A>G, NM_057167.3:c.2359A>G, XM_005246065.1:c.2377A>G, XM_005246066.1:c.1756A>G, XM_005246067.1:c.1156A>G, XM_005246068.1:c.1756A>GVOUS10/07/2015
207COL6A3Ex7NM_004369.3:c.2984C>Tp.Ala995Val | p.A995VNM_004369.3:c.2984C>T, NM_057164.3:c.2984C>T, NM_057164.4:c.1763C>T, NM_057165.3:c.2384C>T, NM_057165.4:c.2366C>T, NM_057166.3:c.2381C>T, NM_057166.4:c.1163C>T, NM_057167.3:c.2366C>T, XM_005246065.1:c.2384C>T, XM_005246066.1:c.1763C>T, XM_005246067.1:c.1163C>T, XM_005246068.1:c.1763C>TVOUS07/02/2015
208COL6A3Ex7NM_004369.3:c.2985_2988delTGCAp.Ala996Serfs*13 | p.A996SfsX13LRG_473t1:c.2985_2988delTGCA, NM_004369.3:c.2985_2988delTGCA, NM_057164.3:c.2985_2988delTGCA, NM_057164.4:c.1764_1767delTGCA, NM_057165.3:c.2385_2388delTGCA, NM_057165.4:c.2367_2370delTGCA, NM_057166.3:c.2382_2385delTGCA, NM_057166.4:c.1164_1167delTGCA, NM_057167.3:c.2367_2370delTGCA, XM_005246065.1:c.2385_2388delTGCA, XM_005246066.1:c.1764_1767delTGCA, XM_005246067.1:c.1164_1167delTGCA, XM_005246068.1:c.1764_1767delTGCAPathogenic05/31/2018 
209COL6A3Ex7NM_004369.3:c.2994G>Ap.Ser998= | p.S998=LRG_473t1:c.2994G>A, NM_004369.3:c.2994G>A, NM_057164.3:c.2994G>A, NM_057164.4:c.1773G>A, NM_057165.3:c.2394G>A, NM_057165.4:c.2376G>A, NM_057166.3:c.2391G>A, NM_057166.4:c.1173G>A, NM_057167.3:c.2376G>A, XM_005246065.1:c.2394G>A, XM_005246066.1:c.1773G>A, XM_005246067.1:c.1173G>A, XM_005246068.1:c.1773G>AVOUS08/25/2017
210COL6A3Ex7NM_004369.3:c.3008G>Ap.Gly1003Glu | p.G1003ELRG_473t1:c.3008G>A, NM_004369.3:c.3008G>A, NM_057164.3:c.3008G>A, NM_057164.4:c.1787G>A, NM_057165.3:c.2408G>A, NM_057165.4:c.2390G>A, NM_057166.3:c.2405G>A, NM_057166.4:c.1187G>A, NM_057167.3:c.2390G>A, XM_005246065.1:c.2408G>A, XM_005246066.1:c.1787G>A, XM_005246067.1:c.1187G>A, XM_005246068.1:c.1787G>AVOUS08/30/2016
211COL6A3Ex7NM_004369.3:c.3040A>Cp.Lys1014Gln | p.K1014QLRG_473t1:c.3040A>C, NM_004369.3:c.3040A>C, NM_057164.3:c.3040A>C, NM_057164.4:c.1819A>C, NM_057165.3:c.2440A>C, NM_057165.4:c.2422A>C, NM_057166.3:c.2437A>C, NM_057166.4:c.1219A>C, NM_057167.3:c.2422A>C, XM_005246065.1:c.2440A>C, XM_005246066.1:c.1819A>C, XM_005246067.1:c.1219A>C, XM_005246068.1:c.1819A>CVOUS07/02/2018
212COL6A3Ex7NM_004369.3:c.3040A>Gp.Lys1014Glu | p.K1014ELRG_473t1:c.3040A>G, NM_004369.3:c.3040A>G, NM_057164.3:c.3040A>G, NM_057164.4:c.1819A>G, NM_057165.3:c.2440A>G, NM_057165.4:c.2422A>G, NM_057166.3:c.2437A>G, NM_057166.4:c.1219A>G, NM_057167.3:c.2422A>G, XM_005246065.1:c.2440A>G, XM_005246066.1:c.1819A>G, XM_005246067.1:c.1219A>G, XM_005246068.1:c.1819A>GVOUS11/15/2018
213COL6A3Ex7NM_004369.3:c.3045A>Gp.Ser1015= | p.S1015=NM_004369.3:c.3045A>G, NM_057164.3:c.3045A>G, NM_057164.4:c.1824A>G, NM_057165.3:c.2445A>G, NM_057165.4:c.2427A>G, NM_057166.3:c.2442A>G, NM_057166.4:c.1224A>G, NM_057167.3:c.2427A>G, XM_005246065.1:c.2445A>G, XM_005246066.1:c.1824A>G, XM_005246067.1:c.1224A>G, XM_005246068.1:c.1824A>GVOUS11/03/2015
214COL6A3Ex7NM_004369.3:c.3054C>Tp.Asn1018= | p.N1018=Benign11/05/2012 
215COL6A3Ex7NM_004369.3:c.3055G>Ap.Gly1019Arg | p.G1019RLRG_473t1:c.3055G>A, NM_004369.3:c.3055G>A, NM_057164.3:c.3055G>A, NM_057164.4:c.1834G>A, NM_057165.3:c.2455G>A, NM_057165.4:c.2437G>A, NM_057166.3:c.2452G>A, NM_057166.4:c.1234G>A, NM_057167.3:c.2437G>A, XM_005246065.1:c.2455G>A, XM_005246066.1:c.1834G>A, XM_005246067.1:c.1234G>A, XM_005246068.1:c.1834G>AVOUS06/01/2016
216COL6A3Ex7NM_004369.3:c.3063A>Gp.Pro1021= | p.P1021=LRG_473t1:c.3063A>G, NM_004369.3:c.3063A>G, NM_057164.3:c.3063A>G, NM_057164.4:c.1842A>G, NM_057165.3:c.2463A>G, NM_057165.4:c.2445A>G, NM_057166.3:c.2460A>G, NM_057166.4:c.1242A>G, NM_057167.3:c.2445A>G, XM_005246065.1:c.2463A>G, XM_005246066.1:c.1842A>G, XM_005246067.1:c.1242A>G, XM_005246068.1:c.1842A>GVOUS08/18/2016
217COL6A3Ex7NM_004369.3:c.3067C>Tp.Pro1023Ser | p.P1023SLRG_473t1:c.3067C>T, NM_004369.3:c.3067C>T, NM_057164.3:c.3067C>T, NM_057164.4:c.1846C>T, NM_057165.3:c.2467C>T, NM_057165.4:c.2449C>T, NM_057166.3:c.2464C>T, NM_057166.4:c.1246C>T, NM_057167.3:c.2449C>T, XM_005246065.1:c.2467C>T, XM_005246066.1:c.1846C>T, XM_005246067.1:c.1246C>T, XM_005246068.1:c.1846C>TVOUS02/23/2017
218COL6A3Ex8NM_004369.3:c.3071-16G>ABenign11/05/2012 
219COL6A3Ex8NM_004369.3:c.3071-6_3071-4delTCCLRG_473t1:c.3071-6_3071-4delTCC, NM_004369.3:c.3071-6_3071-4delTCC, NM_057164.3:c.3071-6_3071-4delTCC, NM_057164.4:c.1850-6_1850-4delTCC, NM_057165.3:c.2471-6_2471-4delTCC, NM_057165.4:c.2453-6_2453-4delTCC, NM_057166.3:c.2468-6_2468-4delTCC, NM_057166.4:c.1250-6_1250-4delTCC, NM_057167.3:c.2453-6_2453-4delTCC, XM_005246065.1:c.2471-6_2471-4delTCC, XM_005246066.1:c.1850-6_1850-4delTCC, XM_005246067.1:c.1250-6_1250-4delTCC, XM_005246068.1:c.1850-6_1850-4delTCCVOUS12/20/2018
220COL6A3Ex8NM_004369.3:c.3087C>Tp.Asp1029= | p.D1029=Benign11/05/2012 
221COL6A3Ex8NM_004369.3:c.3088G>Ap.Val1030Met | p.V1030MNM_004369.3:c.3088G>A, NM_057164.3:c.3088G>A, NM_057164.4:c.1867G>A, NM_057165.3:c.2488G>A, NM_057165.4:c.2470G>A, NM_057166.3:c.2485G>A, NM_057166.4:c.1267G>A, NM_057167.3:c.2470G>A, XM_005246065.1:c.2488G>A, XM_005246066.1:c.1867G>A, XM_005246067.1:c.1267G>A, XM_005246068.1:c.1867G>ABenign08/14/2015 
222COL6A3Ex8NM_004369.3:c.3118G>Ap.Val1040Ile | p.V1040ILRG_473t1:c.3118G>A, NM_004369.3:c.3118G>A, NM_057164.3:c.3118G>A, NM_057164.4:c.1897G>A, NM_057165.3:c.2518G>A, NM_057165.4:c.2500G>A, NM_057166.3:c.2515G>A, NM_057166.4:c.1297G>A, NM_057167.3:c.2500G>A, XM_005246065.1:c.2518G>A, XM_005246066.1:c.1897G>A, XM_005246067.1:c.1297G>A, XM_005246068.1:c.1897G>AVOUS08/14/2018
223COL6A3Ex8NM_004369.3:c.3129C>Tp.Gly1043= | p.G1043=NM_004369.3:c.3129C>T, NM_057164.3:c.3129C>T, NM_057164.4:c.1908C>T, NM_057165.3:c.2529C>T, NM_057165.4:c.2511C>T, NM_057166.3:c.2526C>T, NM_057166.4:c.1308C>T, NM_057167.3:c.2511C>TBenign07/31/2012 
224COL6A3Ex8NM_004369.3:c.3138G>Tp.Leu1046= | p.L1046=NM_004369.3:c.3138G>T, NM_057164.3:c.3138G>T, NM_057164.4:c.1917G>T, NM_057165.3:c.2538G>T, NM_057165.4:c.2520G>T, NM_057166.3:c.2535G>T, NM_057166.4:c.1317G>T, NM_057167.3:c.2520G>T, XM_005246065.1:c.2538G>T, XM_005246066.1:c.1917G>T, XM_005246067.1:c.1317G>T, XM_005246068.1:c.1917G>TVOUS02/26/2015
225COL6A3Ex8NM_004369.3:c.3141G>Cp.Leu1047Phe | p.L1047FNM_004369.3:c.3141G>C, NM_057164.3:c.3141G>C, NM_057164.4:c.1920G>C, NM_057165.3:c.2541G>C, NM_057165.4:c.2523G>C, NM_057166.3:c.2538G>C, NM_057166.4:c.1320G>C, NM_057167.3:c.2523G>C, XM_005246065.1:c.2541G>C, XM_005246066.1:c.1920G>C, XM_005246067.1:c.1320G>C, XM_005246068.1:c.1920G>CVOUS07/14/2015
226COL6A3Ex8NM_004369.3:c.3169A>Tp.Ser1057Cys | p.S1057CLRG_473t1:c.3169A>T, NM_004369.3:c.3169A>T, NM_057164.3:c.3169A>T, NM_057164.4:c.1948A>T, NM_057165.3:c.2569A>T, NM_057165.4:c.2551A>T, NM_057166.3:c.2566A>T, NM_057166.4:c.1348A>T, NM_057167.3:c.2551A>T, XM_005246065.1:c.2569A>T, XM_005246066.1:c.1948A>T, XM_005246067.1:c.1348A>T, XM_005246068.1:c.1948A>TVOUS01/05/2017
227COL6A3Ex8NM_004369.3:c.3178G>Ap.Val1060Met | p.V1060MLRG_473t1:c.3178G>A, NM_004369.3:c.3178G>A, NM_057164.3:c.3178G>A, NM_057164.4:c.1957G>A, NM_057165.3:c.2578G>A, NM_057165.4:c.2560G>A, NM_057166.3:c.2575G>A, NM_057166.4:c.1357G>A, NM_057167.3:c.2560G>A, XM_005246065.1:c.2578G>A, XM_005246066.1:c.1957G>A, XM_005246067.1:c.1357G>A, XM_005246068.1:c.1957G>AVOUS06/16/2017
228COL6A3Ex8NM_004369.3:c.3187G>Ap.Asp1063Asn | p.D1063NLRG_473t1:c.3187G>A, NM_004369.3:c.3187G>A, NM_057164.3:c.3187G>A, NM_057164.4:c.1966G>A, NM_057165.3:c.2587G>A, NM_057165.4:c.2569G>A, NM_057166.3:c.2584G>A, NM_057166.4:c.1366G>A, NM_057167.3:c.2569G>A, XM_005246065.1:c.2587G>A, XM_005246066.1:c.1966G>A, XM_005246067.1:c.1366G>A, XM_005246068.1:c.1966G>AVOUS12/29/2016
229COL6A3Ex8NM_004369.3:c.3190C>Tp.Arg1064Trp | p.R1064WLRG_473t1:c.3190C>T, NM_004369.3:c.3190C>T, NM_057164.3:c.3190C>T, NM_057164.4:c.1969C>T, NM_057165.3:c.2590C>T, NM_057165.4:c.2572C>T, NM_057166.3:c.2587C>T, NM_057166.4:c.1369C>T, NM_057167.3:c.2572C>T, XM_005246065.1:c.2590C>T, XM_005246066.1:c.1969C>T, XM_005246067.1:c.1369C>T, XM_005246068.1:c.1969C>TVOUS12/29/2017
230COL6A3Ex8NM_004369.3:c.3191G>Ap.Arg1064Gln | p.R1064QLRG_473t1:c.3191G>A, NM_004369.3:c.3191G>A, NM_057164.3:c.3191G>A, NM_057164.4:c.1970G>A, NM_057165.3:c.2591G>A, NM_057165.4:c.2573G>A, NM_057166.3:c.2588G>A, NM_057166.4:c.1370G>A, NM_057167.3:c.2573G>ABenign09/03/2015 
231COL6A3Ex8NM_004369.3:c.3198C>Tp.Arg1066= | p.R1066=LRG_473t1:c.3198C>T, NM_004369.3:c.3198C>T, NM_057164.3:c.3198C>T, NM_057164.4:c.1977C>T, NM_057165.3:c.2598C>T, NM_057165.4:c.2580C>T, NM_057166.3:c.2595C>T, NM_057166.4:c.1377C>T, NM_057167.3:c.2580C>T, XM_005246065.1:c.2598C>T, XM_005246066.1:c.1977C>T, XM_005246067.1:c.1377C>T, XM_005246068.1:c.1977C>TVOUS03/01/2016
232COL6A3Ex8NM_004369.3:c.3199G>Ap.Val1067Met | p.V1067MLRG_473t1:c.3199G>A, NM_004369.3:c.3199G>A, NM_057164.3:c.3199G>A, NM_057164.4:c.1978G>A, NM_057165.3:c.2599G>A, NM_057165.4:c.2581G>A, NM_057166.3:c.2596G>A, NM_057166.4:c.1378G>A, NM_057167.3:c.2581G>A, XM_005246065.1:c.2599G>A, XM_005246066.1:c.1978G>A, XM_005246067.1:c.1378G>A, XM_005246068.1:c.1978G>AVOUS01/17/2019
233COL6A3Ex8NM_004369.3:c.3205G>Ap.Val1069Met | p.V1069MLRG_473t1:c.3205G>A, NM_004369.3:c.3205G>A, NM_057164.3:c.3205G>A, NM_057164.4:c.1984G>A, NM_057165.3:c.2605G>A, NM_057165.4:c.2587G>A, NM_057166.3:c.2602G>A, NM_057166.4:c.1384G>A, NM_057167.3:c.2587G>A, XM_005246065.1:c.2605G>A, XM_005246066.1:c.1984G>A, XM_005246067.1:c.1384G>A, XM_005246068.1:c.1984G>ABenign07/12/2016 
234COL6A3Ex8NM_004369.3:c.3220G>Ap.Asp1074Asn | p.D1074NLRG_473t1:c.3220G>A, NM_004369.3:c.3220G>A, NM_057164.3:c.3220G>A, NM_057164.4:c.1999G>A, NM_057165.3:c.2620G>A, NM_057165.4:c.2602G>A, NM_057166.3:c.2617G>A, NM_057166.4:c.1399G>A, NM_057167.3:c.2602G>A, XM_005246065.1:c.2620G>A, XM_005246066.1:c.1999G>A, XM_005246067.1:c.1399G>A, XM_005246068.1:c.1999G>AVOUS05/03/2017
235COL6A3Ex8NM_004369.3:c.3223C>Tp.Arg1075Trp | p.R1075WLRG_473t1:c.3223C>T, NM_004369.3:c.3223C>T, NM_057164.3:c.3223C>T, NM_057164.4:c.2002C>T, NM_057165.3:c.2623C>T, NM_057165.4:c.2605C>T, NM_057166.3:c.2620C>T, NM_057166.4:c.1402C>T, NM_057167.3:c.2605C>T, XM_005246065.1:c.2623C>T, XM_005246066.1:c.2002C>T, XM_005246067.1:c.1402C>T, XM_005246068.1:c.2002C>TVOUS08/25/2016
236COL6A3Ex8NM_004369.3:c.3223C>Ap.Arg1075= | p.R1075=VOUS11/05/2012
237COL6A3Ex8NM_004369.3:c.3228C>Gp.Thr1076= | p.T1076=NM_004369.3:c.3228C>G, NM_057164.3:c.3228C>G, NM_057164.4:c.2007C>G, NM_057165.3:c.2628C>G, NM_057165.4:c.2610C>G, NM_057166.3:c.2625C>G, NM_057166.4:c.1407C>G, NM_057167.3:c.2610C>G, XM_005246065.1:c.2628C>G, XM_005246066.1:c.2007C>G, XM_005246067.1:c.1407C>G, XM_005246068.1:c.2007C>GVOUS12/14/2015
238COL6A3Ex8NM_004369.3:c.3238T>Ap.Phe1080Ile | p.F1080INM_004369.3:c.3238T>A, NM_057164.3:c.3238T>A, NM_057164.4:c.2017T>A, NM_057165.3:c.2638T>A, NM_057165.4:c.2620T>A, NM_057166.3:c.2635T>A, NM_057166.4:c.1417T>A, NM_057167.3:c.2620T>A, XM_005246065.1:c.2638T>A, XM_005246066.1:c.2017T>A, XM_005246067.1:c.1417T>A, XM_005246068.1:c.2017T>AVOUS12/07/2015
239COL6A3Ex8NM_004369.3:c.3256A>Gp.Met1086Val | p.M1086VLRG_473t1:c.3256A>G, NM_004369.3:c.3256A>G, NM_057164.3:c.3256A>G, NM_057164.4:c.2035A>G, NM_057165.3:c.2656A>G, NM_057165.4:c.2638A>G, NM_057166.3:c.2653A>G, NM_057166.4:c.1435A>G, NM_057167.3:c.2638A>G, XM_005246065.1:c.2656A>G, XM_005246066.1:c.2035A>G, XM_005246067.1:c.1435A>G, XM_005246068.1:c.2035A>GVOUS09/14/2017
240COL6A3Ex8NM_004369.3:c.3262A>Cp.Lys1088Gln | p.K1088QNM_004369.3:c.3262A>C, NM_057164.3:c.3262A>C, NM_057164.4:c.2041A>C, NM_057165.3:c.2662A>C, NM_057165.4:c.2644A>C, NM_057166.3:c.2659A>C, NM_057166.4:c.1441A>C, NM_057167.3:c.2644A>C, XM_005246065.1:c.2662A>C, XM_005246066.1:c.2041A>C, XM_005246067.1:c.1441A>C, XM_005246068.1:c.2041A>CBenign09/16/2014 
241COL6A3Ex8NM_004369.3:c.3270C>Tp.Asp1090= | p.D1090=Likely benign03/10/2014 
242COL6A3Ex8NM_004369.3:c.3279C>Tp.Asn1093= | p.N1093=LRG_473t1:c.3279C>T, NM_004369.3:c.3279C>T, NM_057164.3:c.3279C>T, NM_057164.4:c.2058C>T, NM_057165.3:c.2679C>T, NM_057165.4:c.2661C>T, NM_057166.3:c.2676C>T, NM_057166.4:c.1458C>T, NM_057167.3:c.2661C>T, XM_005246065.1:c.2679C>T, XM_005246066.1:c.2058C>T, XM_005246067.1:c.1458C>T, XM_005246068.1:c.2058C>TVOUS06/05/2018
243COL6A3Ex8NM_004369.3:c.3287G>Ap.Arg1096His | p.R1096HLRG_473t1:c.3287G>A, NM_004369.3:c.3287G>A, NM_057164.3:c.3287G>A, NM_057164.4:c.2066G>A, NM_057165.3:c.2687G>A, NM_057165.4:c.2669G>A, NM_057166.3:c.2684G>A, NM_057166.4:c.1466G>A, NM_057167.3:c.2669G>AVOUS11/03/2016
244COL6A3Ex8NM_004369.3:c.3318C>Tp.Pro1106= | p.P1106=LRG_473t1:c.3318C>T, NM_004369.3:c.3318C>T, NM_057164.3:c.3318C>T, NM_057164.4:c.2097C>T, NM_057165.3:c.2718C>T, NM_057165.4:c.2700C>T, NM_057166.3:c.2715C>T, NM_057166.4:c.1497C>T, NM_057167.3:c.2700C>T, XM_005246065.1:c.2718C>T, XM_005246066.1:c.2097C>T, XM_005246067.1:c.1497C>T, XM_005246068.1:c.2097C>TVOUS10/04/2016
245COL6A3Ex8NM_004369.3:c.3324C>Tp.Thr1108= | p.T1108=LRG_473t1:c.3324C>T, NM_004369.3:c.3324C>T, NM_057164.3:c.3324C>T, NM_057164.4:c.2103C>T, NM_057165.3:c.2724C>T, NM_057165.4:c.2706C>T, NM_057166.3:c.2721C>T, NM_057166.4:c.1503C>T, NM_057167.3:c.2706C>T, XM_005246065.1:c.2724C>T, XM_005246066.1:c.2103C>T, XM_005246067.1:c.1503C>T, XM_005246068.1:c.2103C>TVOUS12/07/2018
246COL6A3Ex8NM_004369.3:c.3331G>Ap.Ala1111Thr | p.A1111TLRG_473t1:c.3331G>A, NM_004369.3:c.3331G>A, NM_057164.3:c.3331G>A, NM_057164.4:c.2110G>A, NM_057165.3:c.2731G>A, NM_057165.4:c.2713G>A, NM_057166.3:c.2728G>A, NM_057166.4:c.1510G>A, NM_057167.3:c.2713G>A, XM_005246065.1:c.2731G>A, XM_005246066.1:c.2110G>A, XM_005246067.1:c.1510G>A, XM_005246068.1:c.2110G>AVOUS02/16/2016
247COL6A3Ex8NM_004369.3:c.3371C>Tp.Ala1124Val | p.A1124VLRG_473t1:c.3371C>T, NM_004369.3:c.3371C>T, NM_057164.3:c.3371C>T, NM_057164.4:c.2150C>T, NM_057165.3:c.2771C>T, NM_057165.4:c.2753C>T, NM_057166.3:c.2768C>T, NM_057166.4:c.1550C>T, NM_057167.3:c.2753C>T, XM_005246065.1:c.2771C>T, XM_005246066.1:c.2150C>T, XM_005246067.1:c.1550C>T, XM_005246068.1:c.2150C>TVOUS09/14/2016
248COL6A3Ex8NM_004369.3:c.3419C>Tp.Thr1140Met | p.T1140MLRG_473t1:c.3419C>T, NM_004369.3:c.3419C>T, NM_057164.3:c.3419C>T, NM_057164.4:c.2198C>T, NM_057165.3:c.2819C>T, NM_057165.4:c.2801C>T, NM_057166.3:c.2816C>T, NM_057166.4:c.1598C>T, NM_057167.3:c.2801C>T, XM_005246065.1:c.2819C>T, XM_005246066.1:c.2198C>T, XM_005246067.1:c.1598C>T, XM_005246068.1:c.2198C>TLikely benign01/19/2017 
249COL6A3Ex8NM_004369.3:c.3420G>Ap.Thr1140= | p.T1140=Benign11/05/2012 
250COL6A3Ex8NM_004369.3:c.3445C>Tp.Arg1149Trp | p.R1149WLRG_473t1:c.3445C>T, NM_004369.3:c.3445C>T, NM_057164.3:c.3445C>T, NM_057164.4:c.2224C>T, NM_057165.3:c.2845C>T, NM_057165.4:c.2827C>T, NM_057166.3:c.2842C>T, NM_057166.4:c.1624C>T, NM_057167.3:c.2827C>T, XM_005246065.1:c.2845C>T, XM_005246066.1:c.2224C>T, XM_005246067.1:c.1624C>T, XM_005246068.1:c.2224C>TVOUS07/17/2018
251COL6A3Ex8NM_004369.3:c.3446G>Ap.Arg1149Gln | p.R1149QNM_004369.3:c.3446G>A, NM_057164.3:c.3446G>A, NM_057164.4:c.2225G>A, NM_057165.3:c.2846G>A, NM_057165.4:c.2828G>A, NM_057166.3:c.2843G>A, NM_057166.4:c.1625G>A, NM_057167.3:c.2828G>A, XM_005246065.1:c.2846G>A, XM_005246066.1:c.2225G>A, XM_005246067.1:c.1625G>A, XM_005246068.1:c.2225G>ALikely benign09/15/2015 
252COL6A3Ex8NM_004369.3:c.3462C>Tp.Val1154= | p.V1154=LRG_473t1:c.3462C>T, NM_004369.3:c.3462C>T, NM_057164.3:c.3462C>T, NM_057164.4:c.2241C>T, NM_057165.3:c.2862C>T, NM_057165.4:c.2844C>T, NM_057166.3:c.2859C>T, NM_057166.4:c.1641C>T, NM_057167.3:c.2844C>T, XM_005246065.1:c.2862C>T, XM_005246066.1:c.2241C>T, XM_005246067.1:c.1641C>T, XM_005246068.1:c.2241C>TVOUS07/14/2016
253COL6A3Ex8NM_004369.3:c.3475G>Cp.Gly1159Arg | p.G1159RNM_004369.3:c.3475G>C, NM_057164.3:c.3475G>C, NM_057164.4:c.2254G>C, NM_057165.3:c.2875G>C, NM_057165.4:c.2857G>C, NM_057166.3:c.2872G>C, NM_057166.4:c.1654G>C, NM_057167.3:c.2857G>C, XM_005246065.1:c.2875G>C, XM_005246066.1:c.2254G>C, XM_005246067.1:c.1654G>C, XM_005246068.1:c.2254G>CVOUS10/08/2015
254COL6A3Ex8NM_004369.3:c.3499A>Tp.Ile1167Phe | p.I1167FNM_004369.3:c.3499A>T, NM_057164.3:c.3499A>T, NM_057164.4:c.2278A>T, NM_057165.3:c.2899A>T, NM_057165.4:c.2881A>T, NM_057166.3:c.2896A>T, NM_057166.4:c.1678A>T, NM_057167.3:c.2881A>T, XM_005246065.1:c.2899A>T, XM_005246066.1:c.2278A>T, XM_005246067.1:c.1678A>T, XM_005246068.1:c.2278A>TVOUS12/14/2015
255COL6A3Ex8NM_004369.3:c.3501C>Tp.Ile1167= | p.I1167=LRG_473t1:c.3501C>T, NM_004369.3:c.3501C>T, NM_057164.3:c.3501C>T, NM_057164.4:c.2280C>T, NM_057165.3:c.2901C>T, NM_057165.4:c.2883C>T, NM_057166.3:c.2898C>T, NM_057166.4:c.1680C>T, NM_057167.3:c.2883C>T, XM_005246065.1:c.2901C>T, XM_005246066.1:c.2280C>T, XM_005246067.1:c.1680C>T, XM_005246068.1:c.2280C>TVOUS09/19/2017
256COL6A3Ex8NM_004369.3:c.3507C>Tp.Asn1169= | p.N1169=LRG_473t1:c.3507C>T, NM_004369.3:c.3507C>T, NM_057164.3:c.3507C>T, NM_057164.4:c.2286C>T, NM_057165.3:c.2907C>T, NM_057165.4:c.2889C>T, NM_057166.3:c.2904C>T, NM_057166.4:c.1686C>T, NM_057167.3:c.2889C>T, XM_005246065.1:c.2907C>T, XM_005246066.1:c.2286C>T, XM_005246067.1:c.1686C>T, XM_005246068.1:c.2286C>TVOUS01/22/2016
257COL6A3Ex8NM_004369.3:c.3555C>Tp.Ala1185= | p.A1185=NM_004369.3:c.3555C>T, NM_057164.3:c.3555C>T, NM_057164.4:c.2334C>T, NM_057165.3:c.2955C>T, NM_057165.4:c.2937C>T, NM_057166.3:c.2952C>T, NM_057166.4:c.1734C>T, NM_057167.3:c.2937C>T, XM_005246065.1:c.2955C>T, XM_005246066.1:c.2334C>T, XM_005246067.1:c.1734C>T, XM_005246068.1:c.2334C>TVOUS08/17/2015
258COL6A3Ex8NM_004369.3:c.3569C>Ap.Thr1190Asn | p.T1190NLRG_473t1:c.3569C>A, NM_004369.3:c.3569C>A, NM_057164.3:c.3569C>A, NM_057164.4:c.2348C>A, NM_057165.3:c.2969C>A, NM_057165.4:c.2951C>A, NM_057166.3:c.2966C>A, NM_057166.4:c.1748C>A, NM_057167.3:c.2951C>A, XM_005246065.1:c.2969C>A, XM_005246066.1:c.2348C>A, XM_005246067.1:c.1748C>A, XM_005246068.1:c.2348C>AVOUS12/05/2019
259COL6A3Ex8NM_004369.3:c.3588C>Tp.Thr1196= | p.T1196=LRG_473t1:c.3588C>T, NM_004369.3:c.3588C>T, NM_057164.3:c.3588C>T, NM_057164.4:c.2367C>T, NM_057165.3:c.2988C>T, NM_057165.4:c.2970C>T, NM_057166.3:c.2985C>T, NM_057166.4:c.1767C>T, NM_057167.3:c.2970C>T, XM_005246065.1:c.2988C>T, XM_005246066.1:c.2367C>T, XM_005246067.1:c.1767C>T, XM_005246068.1:c.2367C>TVOUS03/23/2018
260COL6A3Ex8NM_004369.3:c.3589G>Ap.Val1197Ile | p.V1197INM_004369.3:c.3589G>A, NM_057164.3:c.3589G>A, NM_057164.4:c.2368G>A, NM_057165.3:c.2989G>A, NM_057165.4:c.2971G>A, NM_057166.3:c.2986G>A, NM_057166.4:c.1768G>A, NM_057167.3:c.2971G>A, XM_005246065.1:c.2989G>A, XM_005246066.1:c.2368G>A, XM_005246067.1:c.1768G>A, XM_005246068.1:c.2368G>AVOUS03/11/2015
261COL6A3Ex8NM_004369.3:c.3595C>Gp.Gln1199Glu | p.Q1199ELRG_473t1:c.3595C>G, NM_004369.3:c.3595C>G, NM_057164.3:c.3595C>G, NM_057164.4:c.2374C>G, NM_057165.3:c.2995C>G, NM_057165.4:c.2977C>G, NM_057166.3:c.2992C>G, NM_057166.4:c.1774C>G, NM_057167.3:c.2977C>G, XM_005246065.1:c.2995C>G, XM_005246066.1:c.2374C>G, XM_005246067.1:c.1774C>G, XM_005246068.1:c.2374C>GVOUS10/07/2016
262COL6A3Ex8NM_004369.3:c.3619C>Ap.Gln1207Lys | p.Q1207KNM_004369.3:c.3619C>A, NM_057164.3:c.3619C>A, NM_057164.4:c.2398C>A, NM_057165.3:c.3019C>A, NM_057165.4:c.3001C>A, NM_057166.3:c.3016C>A, NM_057166.4:c.1798C>A, NM_057167.3:c.3001C>A, XM_005246065.1:c.3019C>A, XM_005246066.1:c.2398C>A, XM_005246067.1:c.1798C>A, XM_005246068.1:c.2398C>AVOUS08/18/2015
263COL6A3Ex8NM_004369.3:c.3624C>Tp.Leu1208= | p.L1208=LRG_473t1:c.3624C>T, NM_004369.3:c.3624C>T, NM_057164.3:c.3624C>T, NM_057164.4:c.2403C>T, NM_057165.3:c.3024C>T, NM_057165.4:c.3006C>T, NM_057166.3:c.3021C>T, NM_057166.4:c.1803C>T, NM_057167.3:c.3006C>T, XM_005246065.1:c.3024C>T, XM_005246066.1:c.2403C>T, XM_005246067.1:c.1803C>T, XM_005246068.1:c.2403C>TVOUS03/23/2018
264COL6A3Ex8NM_004369.3:c.3629G>Ap.Arg1210His | p.R1210HLRG_473t1:c.3629G>A, NM_004369.3:c.3629G>A, NM_057164.3:c.3629G>A, NM_057164.4:c.2408G>A, NM_057165.3:c.3029G>A, NM_057165.4:c.3011G>A, NM_057166.3:c.3026G>A, NM_057166.4:c.1808G>A, NM_057167.3:c.3011G>A, XM_005246065.1:c.3029G>A, XM_005246066.1:c.2408G>A, XM_005246067.1:c.1808G>A, XM_005246068.1:c.2408G>AVOUS10/17/2017
265COL6A3Ex8NM_004369.3:c.3630C>Tp.Arg1210= | p.R1210=LRG_473t1:c.3630C>T, NM_004369.3:c.3630C>T, NM_057164.3:c.3630C>T, NM_057164.4:c.2409C>T, NM_057165.3:c.3030C>T, NM_057165.4:c.3012C>T, NM_057166.3:c.3027C>T, NM_057166.4:c.1809C>T, NM_057167.3:c.3012C>T, XM_005246065.1:c.3030C>T, XM_005246066.1:c.2409C>T, XM_005246067.1:c.1809C>T, XM_005246068.1:c.2409C>TVOUS05/05/2017
266COL6A3Ex8NM_004369.3:c.3664C>Tp.Pro1222Ser | p.P1222SLRG_473t1:c.3664C>T, NM_004369.3:c.3664C>T, NM_057164.3:c.3664C>T, NM_057164.4:c.2443C>T, NM_057165.3:c.3064C>T, NM_057165.4:c.3046C>T, NM_057166.3:c.3061C>T, NM_057166.4:c.1843C>T, NM_057167.3:c.3046C>T, XM_005246065.1:c.3064C>T, XM_005246066.1:c.2443C>T, XM_005246067.1:c.1843C>T, XM_005246068.1:c.2443C>TVOUS02/28/2017
267COL6A3Ex9NM_004369.3:c.3680-5C>TLRG_473t1:c.3680-5C>T, NM_004369.3:c.3680-5C>T, NM_057164.3:c.3680-5C>T, NM_057164.4:c.2459-5C>T, NM_057165.3:c.3080-5C>T, NM_057165.4:c.3062-5C>T, NM_057166.3:c.3077-5C>T, NM_057166.4:c.1859-5C>T, NM_057167.3:c.3062-5C>T, XM_005246065.1:c.3080-5C>T, XM_005246066.1:c.2459-5C>T, XM_005246067.1:c.1859-5C>T, XM_005246068.1:c.2459-5C>TVOUS11/15/2016
268COL6A3Ex9NM_004369.3:c.3680-4G>ALRG_473t1:c.3680-4G>A, NM_004369.3:c.3680-4G>A, NM_057164.3:c.3680-4G>A, NM_057164.4:c.2459-4G>A, NM_057165.3:c.3080-4G>A, NM_057165.4:c.3062-4G>A, NM_057166.3:c.3077-4G>A, NM_057166.4:c.1859-4G>A, NM_057167.3:c.3062-4G>A, XM_005246065.1:c.3080-4G>A, XM_005246066.1:c.2459-4G>A, XM_005246067.1:c.1859-4G>A, XM_005246068.1:c.2459-4G>AVOUS10/08/2019
269COL6A3Ex9NM_004369.3:c.3699C>Tp.Asp1233= | p.D1233=LRG_473t1:c.3699C>T, NM_004369.3:c.3699C>T, NM_057164.3:c.3699C>T, NM_057164.4:c.2478C>T, NM_057165.3:c.3099C>T, NM_057165.4:c.3081C>T, NM_057166.3:c.3096C>T, NM_057166.4:c.1878C>T, NM_057167.3:c.3081C>T, XM_005246065.1:c.3099C>T, XM_005246066.1:c.2478C>T, XM_005246067.1:c.1878C>T, XM_005246068.1:c.2478C>TVOUS02/06/2019
270COL6A3Ex9NM_004369.3:c.3715G>Ap.Asp1239Asn | p.D1239NLRG_473t1:c.3715G>A, NM_004369.3:c.3715G>A, NM_057164.3:c.3715G>A, NM_057164.4:c.2494G>A, NM_057165.3:c.3115G>A, NM_057165.4:c.3097G>A, NM_057166.3:c.3112G>A, NM_057166.4:c.1894G>A, NM_057167.3:c.3097G>A, XM_005246065.1:c.3115G>A, XM_005246066.1:c.2494G>A, XM_005246067.1:c.1894G>A, XM_005246068.1:c.2494G>AVOUS09/14/2015
271COL6A3Ex9NM_004369.3:c.3732C>Tp.Ala1244= | p.A1244=LRG_473t1:c.3732C>T, NM_004369.3:c.3732C>T, NM_057164.3:c.3732C>T, NM_057164.4:c.2511C>T, NM_057165.3:c.3132C>T, NM_057165.4:c.3114C>T, NM_057166.3:c.3129C>T, NM_057166.4:c.1911C>T, NM_057167.3:c.3114C>T, XM_005246065.1:c.3132C>T, XM_005246066.1:c.2511C>T, XM_005246067.1:c.1911C>T, XM_005246068.1:c.2511C>TVOUS04/27/2017
272COL6A3Ex9NM_004369.3:c.3741G>Cp.Glu1247Asp | p.E1247DLRG_473t1:c.3741G>C, NM_004369.3:c.3741G>C, NM_057164.3:c.3741G>C, NM_057164.4:c.2520G>C, NM_057165.3:c.3141G>C, NM_057165.4:c.3123G>C, NM_057166.3:c.3138G>C, NM_057166.4:c.1920G>C, NM_057167.3:c.3123G>C, XM_005246065.1:c.3141G>C, XM_005246066.1:c.2520G>C, XM_005246067.1:c.1920G>C, XM_005246068.1:c.2520G>CVOUS11/30/2018
273COL6A3Ex9NM_004369.3:c.3751G>Ap.Val1251Ile | p.V1251ILRG_473t1:c.3751G>A, NM_004369.3:c.3751G>A, NM_057164.3:c.3751G>A, NM_057164.4:c.2530G>A, NM_057165.3:c.3151G>A, NM_057165.4:c.3133G>A, NM_057166.3:c.3148G>A, NM_057166.4:c.1930G>A, NM_057167.3:c.3133G>A, XM_005246065.1:c.3151G>A, XM_005246066.1:c.2530G>A, XM_005246067.1:c.1930G>A, XM_005246068.1:c.2530G>AVOUS06/05/2018
274COL6A3Ex9NM_004369.3:c.3754C>Tp.Arg1252Cys | p.R1252CLRG_473t1:c.3754C>T, NM_004369.3:c.3754C>T, NM_057164.3:c.3754C>T, NM_057164.4:c.2533C>T, NM_057165.3:c.3154C>T, NM_057165.4:c.3136C>T, NM_057166.3:c.3151C>T, NM_057166.4:c.1933C>T, NM_057167.3:c.3136C>T, XM_005246065.1:c.3154C>T, XM_005246066.1:c.2533C>T, XM_005246067.1:c.1933C>T, XM_005246068.1:c.2533C>TVOUS09/14/2017
275COL6A3Ex9NM_004369.3:c.3755G>Ap.Arg1252His | p.R1252HLRG_473t1:c.3755G>A, NM_004369.3:c.3755G>A, NM_057164.3:c.3755G>A, NM_057164.4:c.2534G>A, NM_057165.3:c.3155G>A, NM_057165.4:c.3137G>A, NM_057166.3:c.3152G>A, NM_057166.4:c.1934G>A, NM_057167.3:c.3137G>A, XM_005246065.1:c.3155G>A, XM_005246066.1:c.2534G>A, XM_005246067.1:c.1934G>A, XM_005246068.1:c.2534G>AVOUS07/26/2016
276COL6A3Ex9NM_004369.3:c.3760C>Tp.Leu1254Phe | p.L1254FLRG_473t1:c.3760C>T, NM_004369.3:c.3760C>T, NM_057164.3:c.3760C>T, NM_057164.4:c.2539C>T, NM_057165.3:c.3160C>T, NM_057165.4:c.3142C>T, NM_057166.3:c.3157C>T, NM_057166.4:c.1939C>T, NM_057167.3:c.3142C>T, XM_005246065.1:c.3160C>T, XM_005246066.1:c.2539C>T, XM_005246067.1:c.1939C>T, XM_005246068.1:c.2539C>TVOUS08/09/2016
277COL6A3Ex9NM_004369.3:c.3810G>Tp.Arg1270= | p.R1270=LRG_473t1:c.3810G>T, NM_004369.3:c.3810G>T, NM_057164.3:c.3810G>T, NM_057164.4:c.2589G>T, NM_057165.3:c.3210G>T, NM_057165.4:c.3192G>T, NM_057166.3:c.3207G>T, NM_057166.4:c.1989G>T, NM_057167.3:c.3192G>T, XM_005246065.1:c.3210G>T, XM_005246066.1:c.2589G>T, XM_005246067.1:c.1989G>T, XM_005246068.1:c.2589G>TVOUS10/26/2016
278COL6A3Ex9NM_004369.3:c.3831C>Tp.Ser1277= | p.S1277=LRG_473t1:c.3831C>T, NM_004369.3:c.3831C>T, NM_057164.3:c.3831C>T, NM_057164.4:c.2610C>T, NM_057165.3:c.3231C>T, NM_057165.4:c.3213C>T, NM_057166.3:c.3228C>T, NM_057166.4:c.2010C>T, NM_057167.3:c.3213C>T, XM_005246065.1:c.3231C>T, XM_005246066.1:c.2610C>T, XM_005246067.1:c.2010C>T, XM_005246068.1:c.2610C>TVOUS05/23/2018
279COL6A3Ex9NM_004369.3:c.3832G>Ap.Asp1278Asn | p.D1278NLRG_473t1:c.3832G>A, NM_004369.3:c.3832G>A, NM_057164.3:c.3832G>A, NM_057164.4:c.2611G>A, NM_057165.3:c.3232G>A, NM_057165.4:c.3214G>A, NM_057166.3:c.3229G>A, NM_057166.4:c.2011G>A, NM_057167.3:c.3214G>A, XM_005246065.1:c.3232G>A, XM_005246066.1:c.2611G>A, XM_005246067.1:c.2011G>A, XM_005246068.1:c.2611G>AVOUS08/20/2018
280COL6A3Ex9NM_004369.3:c.3837C>Ap.Asp1279Glu | p.D1279ELRG_473t1:c.3837C>A, NM_004369.3:c.3837C>A, NM_057164.3:c.3837C>A, NM_057164.4:c.2616C>A, NM_057165.3:c.3237C>A, NM_057165.4:c.3219C>A, NM_057166.3:c.3234C>A, NM_057166.4:c.2016C>A, NM_057167.3:c.3219C>A, XM_005246065.1:c.3237C>A, XM_005246066.1:c.2616C>A, XM_005246067.1:c.2016C>A, XM_005246068.1:c.2616C>AVOUS08/09/2016
281COL6A3Ex9NM_004369.3:c.3841A>Gp.Lys1281Glu | p.K1281ELRG_473t1:c.3841A>G, NM_004369.3:c.3841A>G, NM_057164.3:c.3841A>G, NM_057164.4:c.2620A>G, NM_057165.3:c.3241A>G, NM_057165.4:c.3223A>G, NM_057166.3:c.3238A>G, NM_057166.4:c.2020A>G, NM_057167.3:c.3223A>G, XM_005246065.1:c.3241A>G, XM_005246066.1:c.2620A>G, XM_005246067.1:c.2020A>G, XM_005246068.1:c.2620A>GVOUS06/02/2016
282COL6A3Ex9NM_004369.3:c.3852C>Ap.Phe1284Leu | p.F1284LLRG_473t1:c.3852C>A, NM_004369.3:c.3852C>A, NM_057164.3:c.3852C>A, NM_057164.4:c.2631C>A, NM_057165.3:c.3252C>A, NM_057165.4:c.3234C>A, NM_057166.3:c.3249C>A, NM_057166.4:c.2031C>A, NM_057167.3:c.3234C>A, XM_005246065.1:c.3252C>A, XM_005246066.1:c.2631C>A, XM_005246067.1:c.2031C>A, XM_005246068.1:c.2631C>AVOUS04/12/2017
283COL6A3Ex9NM_004369.3:c.3852C>Tp.Phe1284= | p.F1284=NM_004369.3:c.3852C>T, NM_057164.3:c.3852C>T, NM_057164.4:c.2631C>T, NM_057165.3:c.3252C>T, NM_057165.4:c.3234C>T, NM_057166.3:c.3249C>T, NM_057166.4:c.2031C>T, NM_057167.3:c.3234C>T, XM_005246065.1:c.3252C>T, XM_005246066.1:c.2631C>T, XM_005246067.1:c.2031C>T, XM_005246068.1:c.2631C>TVOUS07/06/2015
284COL6A3Ex9NM_004369.3:c.3859A>Tp.Asn1287Tyr | p.N1287YNM_004369.3:c.3859A>T, NM_057164.3:c.3859A>T, NM_057164.4:c.2638A>T, NM_057165.3:c.3259A>T, NM_057165.4:c.3241A>T, NM_057166.3:c.3256A>T, NM_057166.4:c.2038A>T, NM_057167.3:c.3241A>T, XM_005246065.1:c.3259A>T, XM_005246066.1:c.2638A>T, XM_005246067.1:c.2038A>T, XM_005246068.1:c.2638A>TVOUS02/02/2016
285COL6A3Ex9NM_004369.3:c.3879T>Gp.Asp1293Glu | p.D1293ENM_004369.3:c.3879T>G, NM_057164.3:c.3879T>G, NM_057164.4:c.2658T>G, NM_057165.3:c.3279T>G, NM_057165.4:c.3261T>G, NM_057166.3:c.3276T>G, NM_057166.4:c.2058T>G, NM_057167.3:c.3261T>G, XM_005246065.1:c.3279T>G, XM_005246066.1:c.2658T>G, XM_005246067.1:c.2058T>G, XM_005246068.1:c.2658T>GBenign03/01/2015 
286COL6A3Ex9NM_004369.3:c.3894G>Ap.Ala1298= | p.A1298=LRG_473t1:c.3894G>A, NM_004369.3:c.3894G>A, NM_057164.3:c.3894G>A, NM_057164.4:c.2673G>A, NM_057165.3:c.3294G>A, NM_057165.4:c.3276G>A, NM_057166.3:c.3291G>A, NM_057166.4:c.2073G>A, NM_057167.3:c.3276G>A, XM_005246065.1:c.3294G>A, XM_005246066.1:c.2673G>A, XM_005246067.1:c.2073G>A, XM_005246068.1:c.2673G>AVOUS06/06/2017
287COL6A3Ex9NM_004369.3:c.3901C>Tp.Arg1301Trp | p.R1301WLRG_473t1:c.3901C>T, NM_004369.3:c.3901C>T, NM_057164.3:c.3901C>T, NM_057164.4:c.2680C>T, NM_057165.3:c.3301C>T, NM_057165.4:c.3283C>T, NM_057166.3:c.3298C>T, NM_057166.4:c.2080C>T, NM_057167.3:c.3283C>T, XM_005246065.1:c.3301C>T, XM_005246066.1:c.2680C>T, XM_005246067.1:c.2080C>T, XM_005246068.1:c.2680C>TVOUS05/31/2016
288COL6A3Ex9NM_004369.3:c.3902G>Ap.Arg1301Gln | p.R1301QLRG_473t1:c.3902G>A, NM_004369.3:c.3902G>A, NM_057164.3:c.3902G>A, NM_057164.4:c.2681G>A, NM_057165.3:c.3302G>A, NM_057165.4:c.3284G>A, NM_057166.3:c.3299G>A, NM_057166.4:c.2081G>A, NM_057167.3:c.3284G>A, XM_005246065.1:c.3302G>A, XM_005246066.1:c.2681G>A, XM_005246067.1:c.2081G>A, XM_005246068.1:c.2681G>AVOUS10/03/2018
289COL6A3Ex9NM_004369.3:c.3909G>Tp.Arg1303Ser | p.R1303SLRG_473t1:c.3909G>T, NM_004369.3:c.3909G>T, NM_057164.3:c.3909G>T, NM_057164.4:c.2688G>T, NM_057165.3:c.3309G>T, NM_057165.4:c.3291G>T, NM_057166.3:c.3306G>T, NM_057166.4:c.2088G>T, NM_057167.3:c.3291G>T, XM_005246065.1:c.3309G>T, XM_005246066.1:c.2688G>T, XM_005246067.1:c.2088G>T, XM_005246068.1:c.2688G>TVOUS06/28/2018
290COL6A3Ex9NM_004369.3:c.3923G>Ap.Arg1308Gln | p.R1308QLRG_473t1:c.3923G>A, NM_004369.3:c.3923G>A, NM_057164.3:c.3923G>A, NM_057164.4:c.2702G>A, NM_057165.3:c.3323G>A, NM_057165.4:c.3305G>A, NM_057166.3:c.3320G>A, NM_057166.4:c.2102G>A, NM_057167.3:c.3305G>A, XM_005246065.1:c.3323G>A, XM_005246066.1:c.2702G>A, XM_005246067.1:c.2102G>A, XM_005246068.1:c.2702G>AVOUS12/16/2016
291COL6A3Ex9NM_004369.3:c.3932A>Gp.Asn1311Ser | p.N1311SLRG_473t1:c.3932A>G, NM_004369.3:c.3932A>G, NM_057164.3:c.3932A>G, NM_057164.4:c.2711A>G, NM_057165.3:c.3332A>G, NM_057165.4:c.3314A>G, NM_057166.3:c.3329A>G, NM_057166.4:c.2111A>G, NM_057167.3:c.3314A>G, XM_005246065.1:c.3332A>G, XM_005246066.1:c.2711A>G, XM_005246067.1:c.2111A>G, XM_005246068.1:c.2711A>GVOUS11/28/2017
292COL6A3Ex9NM_004369.3:c.3934G>Ap.Val1312Met | p.V1312MLRG_473t1:c.3934G>A, NM_004369.3:c.3934G>A, NM_057164.3:c.3934G>A, NM_057164.4:c.2713G>A, NM_057165.3:c.3334G>A, NM_057165.4:c.3316G>A, NM_057166.3:c.3331G>A, NM_057166.4:c.2113G>A, NM_057167.3:c.3316G>A, XM_005246065.1:c.3334G>A, XM_005246066.1:c.2713G>A, XM_005246067.1:c.2113G>A, XM_005246068.1:c.2713G>AVOUS01/25/2018
293COL6A3Ex9NM_004369.3:c.3944C>Tp.Ala1315Val | p.A1315VLRG_473t1:c.3944C>T, NM_004369.3:c.3944C>T, NM_057164.3:c.3944C>T, NM_057164.4:c.2723C>T, NM_057165.3:c.3344C>T, NM_057165.4:c.3326C>T, NM_057166.3:c.3341C>T, NM_057166.4:c.2123C>T, NM_057167.3:c.3326C>T, XM_005246065.1:c.3344C>T, XM_005246066.1:c.2723C>T, XM_005246067.1:c.2123C>T, XM_005246068.1:c.2723C>TVOUS03/29/2016
294COL6A3Ex9NM_004369.3:c.3954C>Tp.Tyr1318= | p.Y1318=LRG_473t1:c.3954C>T, NM_004369.3:c.3954C>T, NM_057164.3:c.3954C>T, NM_057164.4:c.2733C>T, NM_057165.3:c.3354C>T, NM_057165.4:c.3336C>T, NM_057166.3:c.3351C>T, NM_057166.4:c.2133C>T, NM_057167.3:c.3336C>T, XM_005246065.1:c.3354C>T, XM_005246066.1:c.2733C>T, XM_005246067.1:c.2133C>T, XM_005246068.1:c.2733C>TVOUS12/20/2016
295COL6A3Ex9NM_004369.3:c.3982C>Tp.Leu1328= | p.L1328=NM_004369.3:c.3982C>T, NM_057164.3:c.3982C>T, NM_057164.4:c.2761C>T, NM_057165.3:c.3382C>T, NM_057165.4:c.3364C>T, NM_057166.3:c.3379C>T, NM_057166.4:c.2161C>T, NM_057167.3:c.3364C>TVOUS01/28/2014
296COL6A3Ex9NM_004369.3:c.3991C>Tp.Arg1331Cys | p.R1331CLRG_473t1:c.3991C>T, NM_004369.3:c.3991C>T, NM_057164.3:c.3991C>T, NM_057164.4:c.2770C>T, NM_057165.3:c.3391C>T, NM_057165.4:c.3373C>T, NM_057166.3:c.3388C>T, NM_057166.4:c.2170C>T, NM_057167.3:c.3373C>T, XM_005246065.1:c.3391C>T, XM_005246066.1:c.2770C>T, XM_005246067.1:c.2170C>T, XM_005246068.1:c.2770C>TVOUS03/27/2018
297COL6A3Ex9NM_004369.3:c.4005C>Tp.Gly1335= | p.G1335=LRG_473t1:c.4005C>T, NM_004369.3:c.4005C>T, NM_057164.3:c.4005C>T, NM_057164.4:c.2784C>T, NM_057165.3:c.3405C>T, NM_057165.4:c.3387C>T, NM_057166.3:c.3402C>T, NM_057166.4:c.2184C>T, NM_057167.3:c.3387C>T, XM_005246065.1:c.3405C>T, XM_005246066.1:c.2784C>T, XM_005246067.1:c.2184C>T, XM_005246068.1:c.2784C>TBenign11/02/2016 
298COL6A3Ex9NM_004369.3:c.4006G>Ap.Val1336Ile | p.V1336INM_004369.3:c.4006G>A, NM_057164.3:c.4006G>A, NM_057164.4:c.2785G>A, NM_057165.3:c.3406G>A, NM_057165.4:c.3388G>A, NM_057166.3:c.3403G>A, NM_057166.4:c.2185G>A, NM_057167.3:c.3388G>A, XM_005246065.1:c.3406G>A, XM_005246066.1:c.2785G>A, XM_005246067.1:c.2185G>A, XM_005246068.1:c.2785G>ABenign12/09/2015 
299COL6A3Ex9NM_004369.3:c.4011G>Ap.Pro1337= | p.P1337=LRG_473t1:c.4011G>A, NM_004369.3:c.4011G>A, NM_057164.3:c.4011G>A, NM_057164.4:c.2790G>A, NM_057165.3:c.3411G>A, NM_057165.4:c.3393G>A, NM_057166.3:c.3408G>A, NM_057166.4:c.2190G>A, NM_057167.3:c.3393G>A, XM_005246065.1:c.3411G>A, XM_005246066.1:c.2790G>A, XM_005246067.1:c.2190G>A, XM_005246068.1:c.2790G>AVOUS01/24/2018
300COL6A3Ex9NM_004369.3:c.4032G>Ap.Ser1344= | p.S1344=LRG_473t1:c.4032G>A, NM_004369.3:c.4032G>A, NM_057164.3:c.4032G>A, NM_057164.4:c.2811G>A, NM_057165.3:c.3432G>A, NM_057165.4:c.3414G>A, NM_057166.3:c.3429G>A, NM_057166.4:c.2211G>A, NM_057167.3:c.3414G>A, XM_005246065.1:c.3432G>A, XM_005246066.1:c.2811G>A, XM_005246067.1:c.2211G>A, XM_005246068.1:c.2811G>ALikely benign06/03/2016 
301COL6A3Ex9NM_004369.3:c.4047C>Tp.Asp1349= | p.D1349=LRG_473t1:c.4047C>T, NM_004369.3:c.4047C>T, NM_057164.3:c.4047C>T, NM_057164.4:c.2826C>T, NM_057165.3:c.3447C>T, NM_057165.4:c.3429C>T, NM_057166.3:c.3444C>T, NM_057166.4:c.2226C>T, NM_057167.3:c.3429C>T, XM_005246065.1:c.3447C>T, XM_005246066.1:c.2826C>T, XM_005246067.1:c.2226C>T, XM_005246068.1:c.2826C>TVOUS01/08/2016
302COL6A3Ex9NM_004369.3:c.4065G>Ap.Pro1355= | p.P1355=LRG_473t1:c.4065G>A, NM_004369.3:c.4065G>A, NM_057164.3:c.4065G>A, NM_057164.4:c.2844G>A, NM_057165.3:c.3465G>A, NM_057165.4:c.3447G>A, NM_057166.3:c.3462G>A, NM_057166.4:c.2244G>A, NM_057167.3:c.3447G>A, XM_005246065.1:c.3465G>A, XM_005246066.1:c.2844G>A, XM_005246067.1:c.2244G>A, XM_005246068.1:c.2844G>AVOUS11/16/2016
303COL6A3Ex9NM_004369.3:c.4066G>Ap.Ala1356Thr | p.A1356TLRG_473t1:c.4066G>A, NM_004369.3:c.4066G>A, NM_057164.3:c.4066G>A, NM_057164.4:c.2845G>A, NM_057165.3:c.3466G>A, NM_057165.4:c.3448G>A, NM_057166.3:c.3463G>A, NM_057166.4:c.2245G>A, NM_057167.3:c.3448G>A, XM_005246065.1:c.3466G>A, XM_005246066.1:c.2845G>A, XM_005246067.1:c.2245G>A, XM_005246068.1:c.2845G>AVOUS02/27/2018
304COL6A3Ex9NM_004369.3:c.4090G>Ap.Val1364Met | p.V1364MBenign11/05/2012 
305COL6A3Ex9NM_004369.3:c.4103C>Tp.Thr1368Met | p.T1368MLRG_473t1:c.4103C>T, NM_004369.3:c.4103C>T, NM_057164.3:c.4103C>T, NM_057164.4:c.2882C>T, NM_057165.3:c.3503C>T, NM_057165.4:c.3485C>T, NM_057166.3:c.3500C>T, NM_057166.4:c.2282C>T, NM_057167.3:c.3485C>T, XM_005246065.1:c.3503C>T, XM_005246066.1:c.2882C>T, XM_005246067.1:c.2282C>T, XM_005246068.1:c.2882C>TVOUS12/04/2018
306COL6A3Ex9NM_004369.3:c.4104G>Ap.Thr1368= | p.T1368=LRG_473t1:c.4104G>A, NM_004369.3:c.4104G>A, NM_057164.3:c.4104G>A, NM_057164.4:c.2883G>A, NM_057165.3:c.3504G>A, NM_057165.4:c.3486G>A, NM_057166.3:c.3501G>A, NM_057166.4:c.2283G>A, NM_057167.3:c.3486G>A, XM_005246065.1:c.3504G>A, XM_005246066.1:c.2883G>A, XM_005246067.1:c.2283G>A, XM_005246068.1:c.2883G>AVOUS01/17/2017
307COL6A3Ex9NM_004369.3:c.4107C>Tp.Ile1369= | p.I1369=Benign05/16/2013 
308COL6A3Ex9NM_004369.3:c.4117G>Ap.Ala1373Thr | p.A1373TLRG_473t1:c.4117G>A, NM_004369.3:c.4117G>A, NM_057164.3:c.4117G>A, NM_057164.4:c.2896G>A, NM_057165.3:c.3517G>A, NM_057165.4:c.3499G>A, NM_057166.3:c.3514G>A, NM_057166.4:c.2296G>A, NM_057167.3:c.3499G>A, XM_005246065.1:c.3517G>A, XM_005246066.1:c.2896G>A, XM_005246067.1:c.2296G>A, XM_005246068.1:c.2896G>ALikely benign10/26/2016 
309COL6A3Ex9NM_004369.3:c.4121A>Tp.Asp1374Val | p.D1374VNM_004369.3:c.4121A>T, NM_057164.3:c.4121A>T, NM_057164.4:c.2900A>T, NM_057165.3:c.3521A>T, NM_057165.4:c.3503A>T, NM_057166.3:c.3518A>T, NM_057166.4:c.2300A>T, NM_057167.3:c.3503A>T, XM_005246065.1:c.3521A>T, XM_005246066.1:c.2900A>T, XM_005246067.1:c.2300A>T, XM_005246068.1:c.2900A>TVOUS02/12/2016
310COL6A3Ex9NM_004369.3:c.4124delANM_004369.3:c.4124delA, NM_057164.3:c.4124delA, NM_057164.4:c.2903delA, NM_057165.3:c.3524delA, NM_057165.4:c.3506delA, NM_057166.3:c.3521delA, NM_057166.4:c.2303delA, NM_057167.3:c.3506delA, XM_005246065.1:c.3524delA, XM_005246066.1:c.2903delA, XM_005246067.1:c.2303delA, XM_005246068.1:c.2903delAPathogenic08/18/2015 
311COL6A3Ex9NM_004369.3:c.4141A>Tp.Ile1381Phe | p.I1381FLRG_473t1:c.4141A>T, NM_004369.3:c.4141A>T, NM_057164.3:c.4141A>T, NM_057164.4:c.2920A>T, NM_057165.3:c.3541A>T, NM_057165.4:c.3523A>T, NM_057166.3:c.3538A>T, NM_057166.4:c.2320A>T, NM_057167.3:c.3523A>T, XM_005246065.1:c.3541A>T, XM_005246066.1:c.2920A>T, XM_005246067.1:c.2320A>T, XM_005246068.1:c.2920A>TVOUS12/04/2015
312COL6A3Ex9NM_004369.3:c.4146G>Ap.Ser1382= | p.S1382=LRG_473t1:c.4146G>A, NM_004369.3:c.4146G>A, NM_057164.3:c.4146G>A, NM_057164.4:c.2925G>A, NM_057165.3:c.3546G>A, NM_057165.4:c.3528G>A, NM_057166.3:c.3543G>A, NM_057166.4:c.2325G>A, NM_057167.3:c.3528G>A, XM_005246065.1:c.3546G>A, XM_005246066.1:c.2925G>A, XM_005246067.1:c.2325G>A, XM_005246068.1:c.2925G>AVOUS09/14/2018
313COL6A3Ex9NM_004369.3:c.4146G>Tp.Ser1382= | p.S1382=LRG_473t1:c.4146G>T, NM_004369.3:c.4146G>T, NM_057164.3:c.4146G>T, NM_057164.4:c.2925G>T, NM_057165.3:c.3546G>T, NM_057165.4:c.3528G>T, NM_057166.3:c.3543G>T, NM_057166.4:c.2325G>T, NM_057167.3:c.3528G>T, XM_005246065.1:c.3546G>T, XM_005246066.1:c.2925G>T, XM_005246067.1:c.2325G>T, XM_005246068.1:c.2925G>TVOUS03/13/2018
314COL6A3Ex9NM_004369.3:c.4155C>Tp.Pro1385= | p.P1385=LRG_473t1:c.4155C>T, NM_004369.3:c.4155C>T, NM_057164.3:c.4155C>T, NM_057164.4:c.2934C>T, NM_057165.3:c.3555C>T, NM_057165.4:c.3537C>T, NM_057166.3:c.3552C>T, NM_057166.4:c.2334C>T, NM_057167.3:c.3537C>T, XM_005246065.1:c.3555C>T, XM_005246066.1:c.2934C>T, XM_005246067.1:c.2334C>T, XM_005246068.1:c.2934C>TVOUS09/07/2017
315COL6A3Ex9NM_004369.3:c.4156G>Ap.Glu1386Lys | p.E1386KLRG_473t1:c.4156G>A, NM_004369.3:c.4156G>A, NM_057164.3:c.4156G>A, NM_057164.4:c.2935G>A, NM_057165.3:c.3556G>A, NM_057165.4:c.3538G>A, NM_057166.3:c.3553G>A, NM_057166.4:c.2335G>A, NM_057167.3:c.3538G>A, XM_005246065.1:c.3556G>A, XM_005246066.1:c.2935G>A, XM_005246067.1:c.2335G>A, XM_005246068.1:c.2935G>ABenign01/07/2015 
316COL6A3Ex9NM_004369.3:c.4169C>Tp.Ser1390Leu | p.S1390LLRG_473t1:c.4169C>T, NM_004369.3:c.4169C>T, NM_057164.3:c.4169C>T, NM_057164.4:c.2948C>T, NM_057165.3:c.3569C>T, NM_057165.4:c.3551C>T, NM_057166.3:c.3566C>T, NM_057166.4:c.2348C>T, NM_057167.3:c.3551C>T, XM_005246065.1:c.3569C>T, XM_005246066.1:c.2948C>T, XM_005246067.1:c.2348C>T, XM_005246068.1:c.2948C>TBenign05/26/2016 
317COL6A3Ex9NM_004369.3:c.4178C>Gp.Thr1393Ser | p.T1393SLRG_473t1:c.4178C>G, NM_004369.3:c.4178C>G, NM_057164.3:c.4178C>G, NM_057164.4:c.2957C>G, NM_057165.3:c.3578C>G, NM_057165.4:c.3560C>G, NM_057166.3:c.3575C>G, NM_057166.4:c.2357C>G, NM_057167.3:c.3560C>G, XM_005246065.1:c.3578C>G, XM_005246066.1:c.2957C>G, XM_005246067.1:c.2357C>G, XM_005246068.1:c.2957C>GVOUS08/25/2017
318COL6A3Ex9NM_004369.3:c.4184G>Ap.Arg1395Gln | p.R1395QNM_004369.3:c.4184G>A, NM_057164.3:c.4184G>A, NM_057164.4:c.2963G>A, NM_057165.3:c.3584G>A, NM_057165.4:c.3566G>A, NM_057166.3:c.3581G>A, NM_057166.4:c.2363G>A, NM_057167.3:c.3566G>ABenign12/19/2013 
319COL6A3Ex9NM_004369.3:c.4197C>Ap.Ser1399Arg | p.S1399RLRG_473t1:c.4197C>A, NM_004369.3:c.4197C>A, NM_057164.3:c.4197C>A, NM_057164.4:c.2976C>A, NM_057165.3:c.3597C>A, NM_057165.4:c.3579C>A, NM_057166.3:c.3594C>A, NM_057166.4:c.2376C>A, NM_057167.3:c.3579C>A, XM_005246065.1:c.3597C>A, XM_005246066.1:c.2976C>A, XM_005246067.1:c.2376C>A, XM_005246068.1:c.2976C>AVOUS07/12/2017
320COL6A3Ex9NM_004369.3:c.4199T>Ap.Leu1400Gln | p.L1400QLRG_473t1:c.4199T>A, NM_004369.3:c.4199T>A, NM_057164.3:c.4199T>A, NM_057164.4:c.2978T>A, NM_057165.3:c.3599T>A, NM_057165.4:c.3581T>A, NM_057166.3:c.3596T>A, NM_057166.4:c.2378T>A, NM_057167.3:c.3581T>A, XM_005246065.1:c.3599T>A, XM_005246066.1:c.2978T>A, XM_005246067.1:c.2378T>A, XM_005246068.1:c.2978T>AVOUS05/23/2018
321COL6A3Ex9NM_004369.3:c.4217C>Tp.Thr1406Met | p.T1406MNM_004369.3:c.4217C>T, NM_057164.3:c.4217C>T, NM_057164.4:c.2996C>T, NM_057165.3:c.3617C>T, NM_057165.4:c.3599C>T, NM_057166.3:c.3614C>T, NM_057166.4:c.2396C>T, NM_057167.3:c.3599C>T, XM_005246065.1:c.3617C>T, XM_005246066.1:c.2996C>T, XM_005246067.1:c.2396C>T, XM_005246068.1:c.2996C>TLikely benign09/15/2015 
322COL6A3Ex9NM_004369.3:c.4227G>Ap.Thr1409= | p.T1409=LRG_473t1:c.4227G>A, NM_004369.3:c.4227G>A, NM_057164.3:c.4227G>A, NM_057164.4:c.3006G>A, NM_057165.3:c.3627G>A, NM_057165.4:c.3609G>A, NM_057166.3:c.3624G>A, NM_057166.4:c.2406G>A, NM_057167.3:c.3609G>A, XM_005246065.1:c.3627G>A, XM_005246066.1:c.3006G>A, XM_005246067.1:c.2406G>A, XM_005246068.1:c.3006G>AVOUS03/23/2016
323COL6A3Ex9NM_004369.3:c.4234A>Tp.Thr1412Ser | p.T1412SLRG_473t1:c.4234A>T, NM_004369.3:c.4234A>T, NM_057164.3:c.4234A>T, NM_057164.4:c.3013A>T, NM_057165.3:c.3634A>T, NM_057165.4:c.3616A>T, NM_057166.3:c.3631A>T, NM_057166.4:c.2413A>T, NM_057167.3:c.3616A>T, XM_005246065.1:c.3634A>T, XM_005246066.1:c.3013A>T, XM_005246067.1:c.2413A>T, XM_005246068.1:c.3013A>TVOUS10/10/2016
324COL6A3Ex9NM_004369.3:c.4239A>Gp.Ser1413= | p.S1413=LRG_473t1:c.4239A>G, NM_004369.3:c.4239A>G, NM_057164.3:c.4239A>G, NM_057164.4:c.3018A>G, NM_057165.3:c.3639A>G, NM_057165.4:c.3621A>G, NM_057166.3:c.3636A>G, NM_057166.4:c.2418A>G, NM_057167.3:c.3621A>G, XM_005246065.1:c.3639A>G, XM_005246066.1:c.3018A>G, XM_005246067.1:c.2418A>G, XM_005246068.1:c.3018A>GVOUS05/14/2018
325COL6A3Ex9NM_004369.3:c.4252A>Gp.Lys1418Glu | p.K1418ELRG_473t1:c.4252A>G, NM_004369.3:c.4252A>G, NM_057164.3:c.4252A>G, NM_057164.4:c.3031A>G, NM_057165.3:c.3652A>G, NM_057165.4:c.3634A>G, NM_057166.3:c.3649A>G, NM_057166.4:c.2431A>G, NM_057167.3:c.3634A>G, XM_005246065.1:c.3652A>G, XM_005246066.1:c.3031A>G, XM_005246067.1:c.2431A>G, XM_005246068.1:c.3031A>GVOUS08/30/2018
326COL6A3Ex9NM_004369.3:c.4252_4254delAAGLRG_473t1:c.4252_4254delAAG, NM_004369.3:c.4252_4254delAAG, NM_057164.3:c.4252_4254delAAG, NM_057164.4:c.3031_3033delAAG, NM_057165.3:c.3652_3654delAAG, NM_057165.4:c.3634_3636delAAG, NM_057166.3:c.3649_3651delAAG, NM_057166.4:c.2431_2433delAAG, NM_057167.3:c.3634_3636delAAG, XM_005246065.1:c.3652_3654delAAG, XM_005246066.1:c.3031_3033delAAG, XM_005246067.1:c.2431_2433delAAG, XM_005246068.1:c.3031_3033delAAGVOUS03/01/2016
327COL6A3Ex9NM_004369.3:c.4257C>Gp.Leu1419= | p.L1419=LRG_473t1:c.4257C>G, NM_004369.3:c.4257C>G, NM_057164.3:c.4257C>G, NM_057164.4:c.3036C>G, NM_057165.3:c.3657C>G, NM_057165.4:c.3639C>G, NM_057166.3:c.3654C>G, NM_057166.4:c.2436C>G, NM_057167.3:c.3639C>G, XM_005246065.1:c.3657C>G, XM_005246066.1:c.3036C>G, XM_005246067.1:c.2436C>G, XM_005246068.1:c.3036C>GVOUS06/23/2016
328COL6A3Ex9NM_004369.3:c.4271G>Ap.Arg1424His | p.R1424HLRG_473t1:c.4271G>A, NM_004369.3:c.4271G>A, NM_057164.3:c.4271G>A, NM_057164.4:c.3050G>A, NM_057165.3:c.3671G>A, NM_057165.4:c.3653G>A, NM_057166.3:c.3668G>A, NM_057166.4:c.2450G>A, NM_057167.3:c.3653G>A, XM_005246065.1:c.3671G>A, XM_005246066.1:c.3050G>A, XM_005246067.1:c.2450G>A, XM_005246068.1:c.3050G>AVOUS06/06/2017
329COL6A3Ex9NM_004369.3:c.4285+9G>ANM_004369.3:c.4285+9G>A, NM_057164.3:c.4285+9G>A, NM_057164.4:c.3073G>A, NM_057165.3:c.3685+9G>A, NM_057165.4:c.3676G>A, NM_057166.3:c.3682+9G>A, NM_057166.4:c.2464+9G>A, NM_057167.3:c.3667+9G>ABenign11/05/2012 
330COL6A3Ex9NM_004369.3:c.4285+17G>ABenign11/05/2012 
331COL6A3Ex10NM_004369.3:c.4309A>Tp.Ile1437Phe | p.I1437FLRG_473t1:c.4309A>T, NM_004369.3:c.4309A>T, NM_057164.3:c.4286-478A>T, NM_057164.4:c.*2531A>T, NM_057165.3:c.3709A>T, NM_057165.4:c.*2531A>T, NM_057166.3:c.3706A>T, NM_057166.4:c.2488A>T, NM_057167.3:c.3691A>T, XM_005246065.1:c.3709A>T, XM_005246066.1:c.3088A>T, XM_005246067.1:c.2488A>T, XM_005246068.1:c.*2531A>TVOUS10/04/2017
332COL6A3Ex10NM_004369.3:c.4311T>Cp.Ile1437= | p.I1437=Benign07/31/2012 
333COL6A3Ex10NM_004369.3:c.4323C>Tp.Ile1441= | p.I1441=LRG_473t1:c.4323C>T, NM_004369.3:c.4323C>T, NM_057164.3:c.4286-464C>T, NM_057164.4:c.*2545C>T, NM_057165.3:c.3723C>T, NM_057165.4:c.*2545C>T, NM_057166.3:c.3720C>T, NM_057166.4:c.2502C>T, NM_057167.3:c.3705C>T, XM_005246065.1:c.3723C>T, XM_005246066.1:c.3102C>T, XM_005246067.1:c.2502C>T, XM_005246068.1:c.*2545C>TVOUS12/07/2018
334COL6A3Ex10NM_004369.3:c.4324G>Ap.Asp1442Asn | p.D1442NLRG_473t1:c.4324G>A, NM_004369.3:c.4324G>A, NM_057164.3:c.4286-463G>A, NM_057164.4:c.*2546G>A, NM_057165.3:c.3724G>A, NM_057165.4:c.*2546G>A, NM_057166.3:c.3721G>A, NM_057166.4:c.2503G>A, NM_057167.3:c.3706G>A, XM_005246065.1:c.3724G>A, XM_005246066.1:c.3103G>A, XM_005246067.1:c.2503G>A, XM_005246068.1:c.*2546G>AVOUS07/12/2016
335COL6A3Ex10NM_004369.3:c.4366C>Tp.Arg1456* | p.R1456XLRG_473t1:c.4366C>T, NM_004369.3:c.4366C>T, NM_057164.3:c.4286-421C>T, NM_057164.4:c.*2588C>T, NM_057165.3:c.3766C>T, NM_057165.4:c.*2588C>T, NM_057166.3:c.3763C>T, NM_057166.4:c.2545C>T, NM_057167.3:c.3748C>T, XM_005246065.1:c.3766C>T, XM_005246066.1:c.3145C>T, XM_005246067.1:c.2545C>T, XM_005246068.1:c.*2588C>TPathogenic03/23/2017 
336COL6A3Ex10NM_004369.3:c.4399A>Gp.Asn1467Asp | p.N1467DLRG_473t1:c.4399A>G, NM_004369.3:c.4399A>G, NM_057164.3:c.4286-388A>G, NM_057164.4:c.*2621A>G, NM_057165.3:c.3799A>G, NM_057165.4:c.*2621A>G, NM_057166.3:c.3796A>G, NM_057166.4:c.2578A>G, NM_057167.3:c.3781A>GLikely benign07/03/2017 
337COL6A3Ex10NM_004369.3:c.4402A>Gp.Ile1468Val | p.I1468VLRG_473t1:c.4402A>G, NM_004369.3:c.4402A>G, NM_057164.3:c.4286-385A>G, NM_057164.4:c.*2624A>G, NM_057165.3:c.3802A>G, NM_057165.4:c.*2624A>G, NM_057166.3:c.3799A>G, NM_057166.4:c.2581A>G, NM_057167.3:c.3784A>G, XM_005246065.1:c.3802A>G, XM_005246066.1:c.3181A>G, XM_005246067.1:c.2581A>G, XM_005246068.1:c.*2624A>GVOUS09/20/2018
338COL6A3Ex10NM_004369.3:c.4404C>Tp.Ile1468= | p.I1468=LRG_473t1:c.4404C>T, NM_004369.3:c.4404C>T, NM_057164.3:c.4286-383C>T, NM_057164.4:c.*2626C>T, NM_057165.3:c.3804C>T, NM_057165.4:c.*2626C>T, NM_057166.3:c.3801C>T, NM_057166.4:c.2583C>T, NM_057167.3:c.3786C>T, XM_005246065.1:c.3804C>T, XM_005246066.1:c.3183C>T, XM_005246067.1:c.2583C>T, XM_005246068.1:c.*2626C>TVOUS05/25/2018
339COL6A3Ex10NM_004369.3:c.4413T>Cp.Ser1471= | p.S1471=NM_004369.3:c.4413T>C, NM_057164.3:c.4286-374T>C, NM_057164.4:c.*2635T>C, NM_057165.3:c.3813T>C, NM_057165.4:c.*2635T>C, NM_057166.3:c.3810T>C, NM_057166.4:c.2592T>C, NM_057167.3:c.3795T>C, XM_005246065.1:c.3813T>C, XM_005246066.1:c.3192T>C, XM_005246067.1:c.2592T>C, XM_005246068.1:c.*2635T>CVOUS06/03/2015
340COL6A3Ex10NM_004369.3:c.4423G>Tp.Val1475Phe | p.V1475FNM_004369.3:c.4423G>T, NM_057164.3:c.4286-364G>T, NM_057164.4:c.*2645G>T, NM_057165.3:c.3823G>T, NM_057165.4:c.*2645G>T, NM_057166.3:c.3820G>T, NM_057166.4:c.2602G>T, NM_057167.3:c.3805G>T, XM_005246065.1:c.3823G>T, XM_005246066.1:c.3202G>T, XM_005246067.1:c.2602G>T, XM_005246068.1:c.*2645G>TVOUS08/31/2015
341COL6A3Ex10NM_004369.3:c.4425T>Cp.Val1475= | p.V1475=LRG_473t1:c.4425T>C, NM_004369.3:c.4425T>C, NM_057164.3:c.4286-362T>C, NM_057164.4:c.*2647T>C, NM_057165.3:c.3825T>C, NM_057165.4:c.*2647T>C, NM_057166.3:c.3822T>C, NM_057166.4:c.2604T>C, NM_057167.3:c.3807T>C, XM_005246065.1:c.3825T>C, XM_005246066.1:c.3204T>C, XM_005246067.1:c.2604T>C, XM_005246068.1:c.*2647T>CVOUS09/07/2016
342COL6A3Ex10NM_004369.3:c.4431C>Tp.Val1477= | p.V1477=LRG_473t1:c.4431C>T, NM_004369.3:c.4431C>T, NM_057164.3:c.4286-356C>T, NM_057164.4:c.*2653C>T, NM_057165.3:c.3831C>T, NM_057165.4:c.*2653C>T, NM_057166.3:c.3828C>T, NM_057166.4:c.2610C>T, NM_057167.3:c.3813C>T, XM_005246065.1:c.3831C>T, XM_005246066.1:c.3210C>T, XM_005246067.1:c.2610C>T, XM_005246068.1:c.*2653C>TVOUS05/12/2016
343COL6A3Ex10NM_004369.3:c.4432G>Ap.Val1478Met | p.V1478MLRG_473t1:c.4432G>A, NM_004369.3:c.4432G>A, NM_057164.3:c.4286-355G>A, NM_057164.4:c.*2654G>A, NM_057165.3:c.3832G>A, NM_057165.4:c.*2654G>A, NM_057166.3:c.3829G>A, NM_057166.4:c.2611G>A, NM_057167.3:c.3814G>A, XM_005246065.1:c.3832G>A, XM_005246066.1:c.3211G>A, XM_005246067.1:c.2611G>A, XM_005246068.1:c.*2654G>AVOUS01/11/2019
344COL6A3Ex10NM_004369.3:c.4436A>Tp.Gln1479Leu | p.Q1479LLRG_473t1:c.4436A>T, NM_004369.3:c.4436A>T, NM_057164.3:c.4286-351A>T, NM_057164.4:c.*2658A>T, NM_057165.3:c.3836A>T, NM_057165.4:c.*2658A>T, NM_057166.3:c.3833A>T, NM_057166.4:c.2615A>T, NM_057167.3:c.3818A>T, XM_005246065.1:c.3836A>T, XM_005246066.1:c.3215A>T, XM_005246067.1:c.2615A>T, XM_005246068.1:c.*2658A>TVOUS03/05/2017
345COL6A3Ex10NM_004369.3:c.4448A>Tp.Asp1483Val | p.D1483VNM_004369.3:c.4448A>T, NM_057164.3:c.4286-339A>T, NM_057164.4:c.*2670A>T, NM_057165.3:c.3848A>T, NM_057165.4:c.*2670A>T, NM_057166.3:c.3845A>T, NM_057166.4:c.2627A>T, NM_057167.3:c.3830A>T, XM_005246065.1:c.3848A>T, XM_005246066.1:c.3227A>T, XM_005246067.1:c.2627A>T, XM_005246068.1:c.*2670A>TVOUS11/10/2015
346COL6A3Ex10NM_004369.3:c.4491C>Tp.Ala1497= | p.A1497=LRG_473t1:c.4491C>T, NM_004369.3:c.4491C>T, NM_057164.3:c.4286-296C>T, NM_057164.4:c.*2713C>T, NM_057165.3:c.3891C>T, NM_057165.4:c.*2713C>T, NM_057166.3:c.3888C>T, NM_057166.4:c.2670C>T, NM_057167.3:c.3873C>T, XM_005246065.1:c.3891C>T, XM_005246066.1:c.3270C>T, XM_005246067.1:c.2670C>T, XM_005246068.1:c.*2713C>TVOUS11/02/2016
347COL6A3Ex10NM_004369.3:c.4503C>Tp.Asp1501= | p.D1501=LRG_473t1:c.4503C>T, NM_004369.3:c.4503C>T, NM_057164.3:c.4286-284C>T, NM_057164.4:c.*2725C>T, NM_057165.3:c.3903C>T, NM_057165.4:c.*2725C>T, NM_057166.3:c.3900C>T, NM_057166.4:c.2682C>T, NM_057167.3:c.3885C>TVOUS12/29/2017
348COL6A3Ex10NM_004369.3:c.4504G>Tp.Ala1502Ser | p.A1502SLRG_473t1:c.4504G>T, NM_004369.3:c.4504G>T, NM_057164.3:c.4286-283G>T, NM_057164.4:c.*2726G>T, NM_057165.3:c.3904G>T, NM_057165.4:c.*2726G>T, NM_057166.3:c.3901G>T, NM_057166.4:c.2683G>T, NM_057167.3:c.3886G>T, XM_005246065.1:c.3904G>T, XM_005246066.1:c.3283G>T, XM_005246067.1:c.2683G>T, XM_005246068.1:c.*2726G>TVOUS10/16/2017
349COL6A3Ex10NM_004369.3:c.4510C>Ap.Arg1504= | p.R1504=LRG_473t1:c.4510C>A, NM_004369.3:c.4510C>A, NM_057164.3:c.4286-277C>A, NM_057164.4:c.*2732C>A, NM_057165.3:c.3910C>A, NM_057165.4:c.*2732C>A, NM_057166.3:c.3907C>A, NM_057166.4:c.2689C>A, NM_057167.3:c.3892C>A, XM_005246065.1:c.3910C>A, XM_005246066.1:c.3289C>A, XM_005246067.1:c.2689C>A, XM_005246068.1:c.*2732C>AVOUS02/02/2016
350COL6A3Ex10NM_004369.3:c.4510C>Tp.Arg1504Trp | p.R1504WLRG_473t1:c.4510C>T, NM_004369.3:c.4510C>T, NM_057164.3:c.4286-277C>T, NM_057164.4:c.*2732C>T, NM_057165.3:c.3910C>T, NM_057165.4:c.*2732C>T, NM_057166.3:c.3907C>T, NM_057166.4:c.2689C>T, NM_057167.3:c.3892C>TVOUS03/15/2018
351COL6A3Ex10NM_004369.3:c.4524C>Gp.Leu1508= | p.L1508=LRG_473t1:c.4524C>G, NM_004369.3:c.4524C>G, NM_057164.3:c.4286-263C>G, NM_057164.4:c.*2746C>G, NM_057165.3:c.3924C>G, NM_057165.4:c.*2746C>G, NM_057166.3:c.3921C>G, NM_057166.4:c.2703C>G, NM_057167.3:c.3906C>G, XM_005246065.1:c.3924C>G, XM_005246066.1:c.3303C>G, XM_005246067.1:c.2703C>G, XM_005246068.1:c.*2746C>GVOUS05/17/2016
352COL6A3Ex10NM_004369.3:c.4533G>Tp.Gly1511= | p.G1511=Benign07/31/2012 
353COL6A3Ex10NM_004369.3:c.4603C>Tp.Arg1535Cys | p.R1535CLRG_473t1:c.4603C>T, NM_004369.3:c.4603C>T, NM_057164.3:c.4286-184C>T, NM_057164.4:c.*2825C>T, NM_057165.3:c.4003C>T, NM_057165.4:c.*2825C>T, NM_057166.3:c.4000C>T, NM_057166.4:c.2782C>T, NM_057167.3:c.3985C>T, XM_005246065.1:c.4003C>T, XM_005246066.1:c.3382C>T, XM_005246067.1:c.2782C>T, XM_005246068.1:c.*2825C>TVOUS07/19/2016
354COL6A3Ex10NM_004369.3:c.4608A>Gp.Ile1536Met | p.I1536MLRG_473t1:c.4608A>G, NM_004369.3:c.4608A>G, NM_057164.3:c.4286-179A>G, NM_057164.4:c.*2830A>G, NM_057165.3:c.4008A>G, NM_057165.4:c.*2830A>G, NM_057166.3:c.4005A>G, NM_057166.4:c.2787A>G, NM_057167.3:c.3990A>G, XM_005246065.1:c.4008A>G, XM_005246066.1:c.3387A>G, XM_005246067.1:c.2787A>G, XM_005246068.1:c.*2830A>GVOUS08/24/2018
355COL6A3Ex10NM_004369.3:c.4662C>Tp.Asp1554= | p.D1554=NM_004369.3:c.4662C>T, NM_057164.3:c.4286-125C>T, NM_057164.4:c.*2884C>T, NM_057165.3:c.4062C>T, NM_057165.4:c.*2884C>T, NM_057166.3:c.4059C>T, NM_057166.4:c.2841C>T, NM_057167.3:c.4044C>T, XM_005246065.1:c.4062C>T, XM_005246066.1:c.3441C>T, XM_005246067.1:c.2841C>T, XM_005246068.1:c.*2884C>TVOUS07/21/2015
356COL6A3Ex10NM_004369.3:c.4663G>Ap.Asp1555Asn | p.D1555NLRG_473t1:c.4663G>A, NM_004369.3:c.4663G>A, NM_057164.3:c.4286-124G>A, NM_057164.4:c.*2885G>A, NM_057165.3:c.4063G>A, NM_057165.4:c.*2885G>A, NM_057166.3:c.4060G>A, NM_057166.4:c.2842G>A, NM_057167.3:c.4045G>A, XM_005246065.1:c.4063G>A, XM_005246066.1:c.3442G>A, XM_005246067.1:c.2842G>A, XM_005246068.1:c.*2885G>AVOUS05/09/2017
357COL6A3Ex10NM_004369.3:c.4671C>Tp.Ser1557= | p.S1557=LRG_473t1:c.4671C>T, NM_004369.3:c.4671C>T, NM_057164.3:c.4286-116C>T, NM_057164.4:c.*2893C>T, NM_057165.3:c.4071C>T, NM_057165.4:c.*2893C>T, NM_057166.3:c.4068C>T, NM_057166.4:c.2850C>T, NM_057167.3:c.4053C>T, XM_005246065.1:c.4071C>T, XM_005246066.1:c.3450C>T, XM_005246067.1:c.2850C>T, XM_005246068.1:c.*2893C>TVOUS11/22/2017
358COL6A3Ex10NM_004369.3:c.4677C>Tp.Phe1559= | p.F1559=LRG_473t1:c.4677C>T, NM_004369.3:c.4677C>T, NM_057164.3:c.4286-110C>T, NM_057164.4:c.*2899C>T, NM_057165.3:c.4077C>T, NM_057165.4:c.*2899C>T, NM_057166.3:c.4074C>T, NM_057166.4:c.2856C>T, NM_057167.3:c.4059C>T, XM_005246065.1:c.4077C>T, XM_005246066.1:c.3456C>T, XM_005246067.1:c.2856C>T, XM_005246068.1:c.*2899C>TVOUS09/11/2016
359COL6A3Ex10NM_004369.3:c.4678G>Ap.Ala1560Thr | p.A1560TLRG_473t1:c.4678G>A, NM_004369.3:c.4678G>A, NM_057164.3:c.4286-109G>A, NM_057164.4:c.*2900G>A, NM_057165.3:c.4078G>A, NM_057165.4:c.*2900G>A, NM_057166.3:c.4075G>A, NM_057166.4:c.2857G>A, NM_057167.3:c.4060G>A, XM_005246065.1:c.4078G>A, XM_005246066.1:c.3457G>A, XM_005246067.1:c.2857G>A, XM_005246068.1:c.*2900G>AVOUS03/17/2016
360COL6A3Ex10NM_004369.3:c.4683G>Ap.Gln1561= | p.Q1561=Benign07/17/2012 
361COL6A3Ex10NM_004369.3:c.4689C>Gp.Ile1563Met | p.I1563MLRG_473t1:c.4689C>G, NM_004369.3:c.4689C>G, NM_057164.3:c.4286-98C>G, NM_057164.4:c.*2911C>G, NM_057165.3:c.4089C>G, NM_057165.4:c.*2911C>G, NM_057166.3:c.4086C>G, NM_057166.4:c.2868C>G, NM_057167.3:c.4071C>G, XM_005246065.1:c.4089C>G, XM_005246066.1:c.3468C>G, XM_005246067.1:c.2868C>G, XM_005246068.1:c.*2911C>GVOUS02/28/2017
362COL6A3Ex10NM_004369.3:c.4690C>Gp.Arg1564Gly | p.R1564GLRG_473t1:c.4690C>G, NM_004369.3:c.4690C>G, NM_057164.3:c.4286-97C>G, NM_057164.4:c.*2912C>G, NM_057165.3:c.4090C>G, NM_057165.4:c.*2912C>G, NM_057166.3:c.4087C>G, NM_057166.4:c.2869C>G, NM_057167.3:c.4072C>G, XM_005246065.1:c.4090C>G, XM_005246066.1:c.3469C>G, XM_005246067.1:c.2869C>G, XM_005246068.1:c.*2912C>GVOUS06/21/2018
363COL6A3Ex10NM_004369.3:c.4697C>Tp.Ser1566Leu | p.S1566LLRG_473t1:c.4697C>T, NM_004369.3:c.4697C>T, NM_057164.3:c.4286-90C>T, NM_057164.4:c.*2919C>T, NM_057165.3:c.4097C>T, NM_057165.4:c.*2919C>T, NM_057166.3:c.4094C>T, NM_057166.4:c.2876C>T, NM_057167.3:c.4079C>T, XM_005246065.1:c.4097C>T, XM_005246066.1:c.3476C>T, XM_005246067.1:c.2876C>T, XM_005246068.1:c.*2919C>TVOUS06/20/2016
364COL6A3Ex10NM_004369.3:c.4726C>Tp.Arg1576Trp | p.R1576WLRG_473t1:c.4726C>T, NM_004369.3:c.4726C>T, NM_057164.3:c.4286-61C>T, NM_057164.4:c.*2948C>T, NM_057165.3:c.4126C>T, NM_057165.4:c.*2948C>T, NM_057166.3:c.4123C>T, NM_057166.4:c.2905C>T, NM_057167.3:c.4108C>T, XM_005246065.1:c.4126C>T, XM_005246066.1:c.3505C>T, XM_005246067.1:c.2905C>T, XM_005246068.1:c.*2948C>TVOUS06/16/2017
365COL6A3Ex10NM_004369.3:c.4727G>Ap.Arg1576Gln | p.R1576QNM_004369.3:c.4727G>A, NM_057164.3:c.4286-60G>A, NM_057164.4:c.*2949G>A, NM_057165.3:c.4127G>A, NM_057165.4:c.*2949G>A, NM_057166.3:c.4124G>A, NM_057166.4:c.2906G>A, NM_057167.3:c.4109G>A, XM_005246065.1:c.4127G>A, XM_005246066.1:c.3506G>A, XM_005246067.1:c.2906G>A, XM_005246068.1:c.*2949G>ABenign11/05/2012 
366COL6A3Ex10NM_004369.3:c.4765G>Ap.Asp1589Asn | p.D1589NLRG_473t1:c.4765G>A, NM_004369.3:c.4765G>A, NM_057164.3:c.4286-22G>A, NM_057164.4:c.*2987G>A, NM_057165.3:c.4165G>A, NM_057165.4:c.*2987G>A, NM_057166.3:c.4162G>A, NM_057166.4:c.2944G>A, NM_057167.3:c.4147G>A, XM_005246065.1:c.4165G>A, XM_005246066.1:c.3544G>A, XM_005246067.1:c.2944G>A, XM_005246068.1:c.*2987G>AVOUS09/14/2018
367COL6A3Ex10NM_004369.3:c.4786G>Tp.Val1596Leu | p.V1596LNM_004369.3:c.4786G>T, NM_057164.3:c.4286-1G>T, NM_057164.4:c.*3008G>T, NM_057165.3:c.4186G>T, NM_057165.4:c.*3008G>T, NM_057166.3:c.4183G>T, NM_057166.4:c.2965G>T, NM_057167.3:c.4168G>T, XM_005246065.1:c.4186G>T, XM_005246066.1:c.3565G>T, XM_005246067.1:c.2965G>T, XM_005246068.1:c.*3008G>TVOUS08/05/2015
368COL6A3Ex10NM_004369.3:c.4835C>Ap.Ser1612* | p.S1612XLRG_473t1:c.4835C>A, NM_004369.3:c.4835C>A, NM_057164.3:c.4334C>A, NM_057164.4:c.*3057C>A, NM_057165.3:c.4235C>A, NM_057165.4:c.*3057C>A, NM_057166.3:c.4232C>A, NM_057166.4:c.3014C>A, NM_057167.3:c.4217C>A, XM_005246065.1:c.4235C>A, XM_005246066.1:c.3614C>A, XM_005246067.1:c.3014C>A, XM_005246068.1:c.*3057C>APathogenic10/30/2016 
369COL6A3Ex10NM_004369.3:c.4835C>Tp.Ser1612Leu | p.S1612LLRG_473t1:c.4835C>T, NM_004369.3:c.4835C>T, NM_057164.3:c.4334C>T, NM_057164.4:c.*3057C>T, NM_057165.3:c.4235C>T, NM_057165.4:c.*3057C>T, NM_057166.3:c.4232C>T, NM_057166.4:c.3014C>T, NM_057167.3:c.4217C>T, XM_005246065.1:c.4235C>T, XM_005246066.1:c.3614C>T, XM_005246067.1:c.3014C>T, XM_005246068.1:c.*3057C>TVOUS08/30/2016
370COL6A3Ex10NM_004369.3:c.4844C>Ap.Pro1615His | p.P1615HLRG_473t1:c.4844C>A, NM_004369.3:c.4844C>A, NM_057164.3:c.4343C>A, NM_057164.4:c.*3066C>A, NM_057165.3:c.4244C>A, NM_057165.4:c.*3066C>A, NM_057166.3:c.4241C>A, NM_057166.4:c.3023C>A, NM_057167.3:c.4226C>A, XM_005246065.1:c.4244C>A, XM_005246066.1:c.3623C>A, XM_005246067.1:c.3023C>A, XM_005246068.1:c.*3066C>AVOUS09/02/2016
371COL6A3Ex10NM_004369.3:c.4848C>Tp.Ser1616= | p.S1616=LRG_473t1:c.4848C>T, NM_004369.3:c.4848C>T, NM_057164.3:c.4347C>T, NM_057164.4:c.*3070C>T, NM_057165.3:c.4248C>T, NM_057165.4:c.*3070C>T, NM_057166.3:c.4245C>T, NM_057166.4:c.3027C>T, NM_057167.3:c.4230C>T, XM_005246065.1:c.4248C>T, XM_005246066.1:c.3627C>T, XM_005246067.1:c.3027C>T, XM_005246068.1:c.*3070C>TVOUS07/02/2018
372COL6A3Ex10NM_004369.3:c.4849G>Tp.Ala1617Ser | p.A1617SLRG_473t1:c.4849G>T, NM_004369.3:c.4849G>T, NM_057164.3:c.4348G>T, NM_057164.4:c.*3071G>T, NM_057165.3:c.4249G>T, NM_057165.4:c.*3071G>T, NM_057166.3:c.4246G>T, NM_057166.4:c.3028G>T, NM_057167.3:c.4231G>T, XM_005246065.1:c.4249G>T, XM_005246066.1:c.3628G>T, XM_005246067.1:c.3028G>T, XM_005246068.1:c.*3071G>TVOUS01/25/2018
373COL6A3Ex10NM_004369.3:c.4849G>Ap.Ala1617Thr | p.A1617TLRG_473t1:c.4849G>A, NM_004369.3:c.4849G>A, NM_057164.3:c.4348G>A, NM_057164.4:c.*3071G>A, NM_057165.3:c.4249G>A, NM_057165.4:c.*3071G>A, NM_057166.3:c.4246G>A, NM_057166.4:c.3028G>A, NM_057167.3:c.4231G>A, XM_005246065.1:c.4249G>A, XM_005246066.1:c.3628G>A, XM_005246067.1:c.3028G>A, XM_005246068.1:c.*3071G>AVOUS06/27/2017
374COL6A3Ex10NM_004369.3:c.4873G>Ap.Val1625Met | p.V1625MVOUS11/05/2012
375COL6A3Ex10NM_004369.3:c.4888C>Tp.Pro1630Ser | p.P1630SLRG_473t1:c.4888C>T, NM_004369.3:c.4888C>T, NM_057164.3:c.4387C>T, NM_057164.4:c.*3110C>T, NM_057165.3:c.4288C>T, NM_057165.4:c.*3110C>T, NM_057166.3:c.4285C>T, NM_057166.4:c.3067C>T, NM_057167.3:c.4270C>T, XM_005246065.1:c.4288C>T, XM_005246066.1:c.3667C>T, XM_005246067.1:c.3067C>T, XM_005246068.1:c.*3110C>TVOUS10/07/2015
376COL6A3Ex10NM_004369.3:c.4895G>Ap.Arg1632Gln | p.R1632QBenign11/05/2012 
377COL6A3Ex10NM_004369.3:c.4900+9C>TLRG_473t1:c.4900+9C>T, NM_004369.3:c.4900+9C>T, NM_057164.3:c.4399+9C>T, NM_057164.4:c.*3131C>T, NM_057165.3:c.4300+9C>T, NM_057165.4:c.*3131C>T, NM_057166.3:c.4297+9C>T, NM_057166.4:c.3079+9C>T, NM_057167.3:c.4282+9C>T, XM_005246065.1:c.4300+9C>T, XM_005246066.1:c.3679+9C>T, XM_005246067.1:c.3079+9C>T, XM_005246068.1:c.*3131C>TVOUS02/02/2016
378COL6A3Ex10NM_004369.3:c.4900+10G>ALRG_473t1:c.4900+10G>A, NM_004369.3:c.4900+10G>A, NM_057164.3:c.4399+10G>A, NM_057164.4:c.*3132G>A, NM_057165.3:c.4300+10G>A, NM_057165.4:c.*3132G>A, NM_057166.3:c.4297+10G>A, NM_057166.4:c.3079+10G>A, NM_057167.3:c.4282+10G>A, XM_005246065.1:c.4300+10G>A, XM_005246066.1:c.3679+10G>A, XM_005246067.1:c.3079+10G>A, XM_005246068.1:c.*3132G>AVOUS05/04/2017
379COL6A3Ex11NM_004369.3:c.4912G>Ap.Ala1638Thr | p.A1638TLRG_473t1:c.4912G>A, NM_004369.3:c.4912G>A, NM_057164.3:c.4411G>A, NM_057164.4:c.*4410G>A, NM_057165.3:c.4312G>A, NM_057165.4:c.*4410G>A, NM_057166.3:c.4309G>A, NM_057166.4:c.3091G>A, NM_057167.3:c.4294G>A, XM_005246065.1:c.4312G>A, XM_005246066.1:c.3691G>A, XM_005246067.1:c.3091G>A, XM_005246068.1:c.*4410G>ABenign01/30/2015 
380COL6A3Ex11NM_004369.3:c.4978C>Tp.Arg1660Cys | p.R1660CLRG_473t1:c.4978C>T, NM_004369.3:c.4978C>T, NM_057164.3:c.4477C>T, NM_057164.4:c.*4476C>T, NM_057165.3:c.4378C>T, NM_057165.4:c.*4476C>T, NM_057166.3:c.4375C>T, NM_057166.4:c.3157C>T, NM_057167.3:c.4360C>T, XM_005246065.1:c.4378C>T, XM_005246066.1:c.3757C>T, XM_005246067.1:c.3157C>T, XM_005246068.1:c.*4476C>TVOUS10/12/2016
381COL6A3Ex11NM_004369.3:c.4984G>Tp.Val1662Leu | p.V1662LLRG_473t1:c.4984G>T, NM_004369.3:c.4984G>T, NM_057164.3:c.4483G>T, NM_057164.4:c.*4482G>T, NM_057165.3:c.4384G>T, NM_057165.4:c.*4482G>T, NM_057166.3:c.4381G>T, NM_057166.4:c.3163G>T, NM_057167.3:c.4366G>T, XM_005246065.1:c.4384G>T, XM_005246066.1:c.3763G>T, XM_005246067.1:c.3163G>T, XM_005246068.1:c.*4482G>TVOUS06/30/2016
382COL6A3Ex11NM_004369.3:c.5010T>Ap.Tyr1670* | p.Y1670XLRG_473t1:c.5010T>A, NM_004369.3:c.5010T>A, NM_057164.3:c.4509T>A, NM_057164.4:c.*4508T>A, NM_057165.3:c.4410T>A, NM_057165.4:c.*4508T>A, NM_057166.3:c.4407T>A, NM_057166.4:c.3189T>A, NM_057167.3:c.4392T>A, XM_005246065.1:c.4410T>A, XM_005246066.1:c.3789T>A, XM_005246067.1:c.3189T>A, XM_005246068.1:c.*4508T>APathogenic08/14/2015 
383COL6A3Ex11NM_004369.3:c.5019C>Tp.Gly1673= | p.G1673=LRG_473t1:c.5019C>T, NM_004369.3:c.5019C>T, NM_057164.3:c.4518C>T, NM_057164.4:c.*4517C>T, NM_057165.3:c.4419C>T, NM_057165.4:c.*4517C>T, NM_057166.3:c.4416C>T, NM_057166.4:c.3198C>T, NM_057167.3:c.4401C>T, XM_005246065.1:c.4419C>T, XM_005246066.1:c.3798C>T, XM_005246067.1:c.3198C>T, XM_005246068.1:c.*4517C>TVOUS05/31/2016
384COL6A3Ex11NM_004369.3:c.5036G>Ap.Gly1679Glu | p.G1679ELRG_473t1:c.5036G>A, NM_004369.3:c.5036G>A, NM_057164.3:c.4535G>A, NM_057164.4:c.*4534G>A, NM_057165.3:c.4436G>A, NM_057165.4:c.*4534G>A, NM_057166.3:c.4433G>A, NM_057166.4:c.3215G>A, NM_057167.3:c.4418G>A, XM_005246065.1:c.4436G>A, XM_005246066.1:c.3815G>A, XM_005246067.1:c.3215G>A, XM_005246068.1:c.*4534G>ALikely pathogenic09/23/2016 
385COL6A3Ex11NM_004369.3:c.5059C>Tp.Pro1687Ser | p.P1687SBenign01/02/2013 
386COL6A3Ex11NM_004369.3:c.5085C>Gp.Asp1695Glu | p.D1695ELRG_473t1:c.5085C>G, NM_004369.3:c.5085C>G, NM_057164.3:c.4584C>G, NM_057164.4:c.*4583C>G, NM_057165.3:c.4485C>G, NM_057165.4:c.*4583C>G, NM_057166.3:c.4482C>G, NM_057166.4:c.3264C>G, NM_057167.3:c.4467C>G, XM_005246065.1:c.4485C>G, XM_005246066.1:c.3864C>G, XM_005246067.1:c.3264C>G, XM_005246068.1:c.*4583C>GVOUS03/29/2017
387COL6A3Ex11NM_004369.3:c.5095A>Cp.Lys1699Gln | p.K1699QLRG_473t1:c.5095A>C, NM_004369.3:c.5095A>C, NM_057164.3:c.4594A>C, NM_057164.4:c.*4593A>C, NM_057165.3:c.4495A>C, NM_057165.4:c.*4593A>C, NM_057166.3:c.4492A>C, NM_057166.4:c.3274A>C, NM_057167.3:c.4477A>C, XM_005246065.1:c.4495A>C, XM_005246066.1:c.3874A>C, XM_005246067.1:c.3274A>C, XM_005246068.1:c.*4593A>CVOUS01/11/2018
388COL6A3Ex11NM_004369.3:c.5100G>Ap.Arg1700= | p.R1700=Benign11/05/2012 
389COL6A3Ex11NM_004369.3:c.5113G>Ap.Ala1705Thr | p.A1705TNM_004369.3:c.5113G>A, NM_057164.3:c.4612G>A, NM_057164.4:c.*4611G>A, NM_057165.3:c.4513G>A, NM_057165.4:c.*4611G>A, NM_057166.3:c.4510G>A, NM_057166.4:c.3292G>A, NM_057167.3:c.4495G>A, XM_005246065.1:c.4513G>A, XM_005246066.1:c.3892G>A, XM_005246067.1:c.3292G>A, XM_005246068.1:c.*4611G>AVOUS08/17/2015
390COL6A3Ex11NM_004369.3:c.5118C>Tp.Ile1706= | p.I1706=LRG_473t1:c.5118C>T, NM_004369.3:c.5118C>T, NM_057164.3:c.4617C>T, NM_057164.4:c.*4616C>T, NM_057165.3:c.4518C>T, NM_057165.4:c.*4616C>T, NM_057166.3:c.4515C>T, NM_057166.4:c.3297C>T, NM_057167.3:c.4500C>T, XM_005246065.1:c.4518C>T, XM_005246066.1:c.3897C>T, XM_005246067.1:c.3297C>T, XM_005246068.1:c.*4616C>TVOUS07/22/2019
391COL6A3Ex11NM_004369.3:c.5139G>Ap.Gly1713= | p.G1713=LRG_473t1:c.5139G>A, NM_004369.3:c.5139G>A, NM_057164.3:c.4638G>A, NM_057164.4:c.*4637G>A, NM_057165.3:c.4539G>A, NM_057165.4:c.*4637G>A, NM_057166.3:c.4536G>A, NM_057166.4:c.3318G>A, NM_057167.3:c.4521G>A, XM_005246065.1:c.4539G>A, XM_005246066.1:c.3918G>A, XM_005246067.1:c.3318G>A, XM_005246068.1:c.*4637G>AVOUS11/15/2019
392COL6A3Ex11NM_004369.3:c.5148C>Tp.His1716= | p.H1716=LRG_473t1:c.5148C>T, NM_004369.3:c.5148C>T, NM_057164.3:c.4647C>T, NM_057164.4:c.*4646C>T, NM_057165.3:c.4548C>T, NM_057165.4:c.*4646C>T, NM_057166.3:c.4545C>T, NM_057166.4:c.3327C>T, NM_057167.3:c.4530C>T, XM_005246065.1:c.4548C>T, XM_005246066.1:c.3927C>T, XM_005246067.1:c.3327C>T, XM_005246068.1:c.*4646C>TVOUS12/06/2016
393COL6A3Ex11NM_004369.3:c.5170G>Ap.Glu1724Lys | p.E1724KVOUS11/05/2012
394COL6A3Ex11NM_004369.3:c.5180G>Ap.Arg1727Gln | p.R1727QLRG_473t1:c.5180G>A, NM_004369.3:c.5180G>A, NM_057164.3:c.4679G>A, NM_057164.4:c.*4678G>A, NM_057165.3:c.4580G>A, NM_057165.4:c.*4678G>A, NM_057166.3:c.4577G>A, NM_057166.4:c.3359G>A, NM_057167.3:c.4562G>A, XM_005246065.1:c.4580G>A, XM_005246066.1:c.3959G>A, XM_005246067.1:c.3359G>A, XM_005246068.1:c.*4678G>AVOUS10/03/2017
395COL6A3Ex11NM_004369.3:c.5203G>Tp.Ala1735Ser | p.A1735SLRG_473t1:c.5203G>T, NM_004369.3:c.5203G>T, NM_057164.3:c.4702G>T, NM_057164.4:c.*4701G>T, NM_057165.3:c.4603G>T, NM_057165.4:c.*4701G>T, NM_057166.3:c.4600G>T, NM_057166.4:c.3382G>T, NM_057167.3:c.4585G>T, XM_005246065.1:c.4603G>T, XM_005246066.1:c.3982G>T, XM_005246067.1:c.3382G>T, XM_005246068.1:c.*4701G>TVOUS07/25/2016
396COL6A3Ex11NM_004369.3:c.5213G>Ap.Arg1738His | p.R1738HLRG_473t1:c.5213G>A, NM_004369.3:c.5213G>A, NM_057164.3:c.4712G>A, NM_057164.4:c.*4711G>A, NM_057165.3:c.4613G>A, NM_057165.4:c.*4711G>A, NM_057166.3:c.4610G>A, NM_057166.4:c.3392G>A, NM_057167.3:c.4595G>A, XM_005246065.1:c.4613G>A, XM_005246066.1:c.3992G>A, XM_005246067.1:c.3392G>A, XM_005246068.1:c.*4711G>AVOUS11/04/2016
397COL6A3Ex11NM_004369.3:c.5225G>Ap.Arg1742Gln | p.R1742QNM_004369.3:c.5225G>A, NM_057164.3:c.4724G>A, NM_057164.4:c.*4723G>A, NM_057165.3:c.4625G>A, NM_057165.4:c.*4723G>A, NM_057166.3:c.4622G>A, NM_057166.4:c.3404G>A, NM_057167.3:c.4607G>A, XM_005246065.1:c.4625G>A, XM_005246066.1:c.4004G>A, XM_005246067.1:c.3404G>A, XM_005246068.1:c.*4723G>AVOUS11/03/2015
398COL6A3Ex11NM_004369.3:c.5253G>Ap.Thr1751= | p.T1751=NM_004369.3:c.5253G>A, NM_057164.3:c.4752G>A, NM_057164.4:c.*4751G>A, NM_057165.3:c.4653G>A, NM_057165.4:c.*4751G>A, NM_057166.3:c.4650G>A, NM_057166.4:c.3432G>A, NM_057167.3:c.4635G>A, XM_005246065.1:c.4653G>A, XM_005246066.1:c.4032G>A, XM_005246067.1:c.3432G>A, XM_005246068.1:c.*4751G>AVOUS02/15/2016
399COL6A3Ex11NM_004369.3:c.5261A>Gp.Lys1754Arg | p.K1754RNM_004369.3:c.5261A>G, NM_057164.3:c.4760A>G, NM_057164.4:c.*4759A>G, NM_057165.3:c.4661A>G, NM_057165.4:c.*4759A>G, NM_057166.3:c.4658A>G, NM_057166.4:c.3440A>G, NM_057167.3:c.4643A>G, XM_005246065.1:c.4661A>G, XM_005246066.1:c.4040A>G, XM_005246067.1:c.3440A>G, XM_005246068.1:c.*4759A>GBenign11/05/2012 
400COL6A3Ex11NM_004369.3:c.5296C>Gp.Leu1766Val | p.L1766VLRG_473t1:c.5296C>G, NM_004369.3:c.5296C>G, NM_057164.3:c.4795C>G, NM_057164.4:c.*4794C>G, NM_057165.3:c.4696C>G, NM_057165.4:c.*4794C>G, NM_057166.3:c.4693C>G, NM_057166.4:c.3475C>G, NM_057167.3:c.4678C>G, XM_005246065.1:c.4696C>G, XM_005246066.1:c.4075C>G, XM_005246067.1:c.3475C>G, XM_005246068.1:c.*4794C>GVOUS07/13/2016
401COL6A3Ex11NM_004369.3:c.5315A>Gp.Lys1772Arg | p.K1772RLRG_473t1:c.5315A>G, NM_004369.3:c.5315A>G, NM_057164.3:c.4814A>G, NM_057164.4:c.*4813A>G, NM_057165.3:c.4715A>G, NM_057165.4:c.*4813A>G, NM_057166.3:c.4712A>G, NM_057166.4:c.3494A>G, NM_057167.3:c.4697A>G, XM_005246065.1:c.4715A>G, XM_005246066.1:c.4094A>G, XM_005246067.1:c.3494A>G, XM_005246068.1:c.*4813A>GVOUS03/15/2018
402COL6A3Ex11NM_004369.3:c.5341A>Gp.Ile1781Val | p.I1781VNM_004369.3:c.5341A>G, NM_057164.3:c.4840A>G, NM_057164.4:c.*4839A>G, NM_057165.3:c.4741A>G, NM_057165.4:c.*4839A>G, NM_057166.3:c.4738A>G, NM_057166.4:c.3520A>G, NM_057167.3:c.4723A>G, XM_005246065.1:c.4741A>G, XM_005246066.1:c.4120A>G, XM_005246067.1:c.3520A>G, XM_005246068.1:c.*4839A>GVOUS03/03/2015
403COL6A3Ex11NM_004369.3:c.5378G>Ap.Ser1793Asn | p.S1793NLRG_473t1:c.5378G>A, NM_004369.3:c.5378G>A, NM_057164.3:c.4877G>A, NM_057164.4:c.*4876G>A, NM_057165.3:c.4778G>A, NM_057165.4:c.*4876G>A, NM_057166.3:c.4775G>A, NM_057166.4:c.3557G>A, NM_057167.3:c.4760G>A, XM_005246065.1:c.4778G>A, XM_005246066.1:c.4157G>A, XM_005246067.1:c.3557G>A, XM_005246068.1:c.*4876G>AVOUS12/05/2015
404COL6A3Ex11NM_004369.3:c.5379C>Tp.Ser1793= | p.S1793=LRG_473t1:c.5379C>T, NM_004369.3:c.5379C>T, NM_057164.3:c.4878C>T, NM_057164.4:c.*4877C>T, NM_057165.3:c.4779C>T, NM_057165.4:c.*4877C>T, NM_057166.3:c.4776C>T, NM_057166.4:c.3558C>T, NM_057167.3:c.4761C>T, XM_005246065.1:c.4779C>T, XM_005246066.1:c.4158C>T, XM_005246067.1:c.3558C>T, XM_005246068.1:c.*4877C>TVOUS06/25/2018
405COL6A3Ex11NM_004369.3:c.5387C>Tp.Ala1796Val | p.A1796VLRG_473t1:c.5387C>T, NM_004369.3:c.5387C>T, NM_057164.3:c.4886C>T, NM_057164.4:c.*4885C>T, NM_057165.3:c.4787C>T, NM_057165.4:c.*4885C>T, NM_057166.3:c.4784C>T, NM_057166.4:c.3566C>T, NM_057167.3:c.4769C>T, XM_005246065.1:c.4787C>T, XM_005246066.1:c.4166C>T, XM_005246067.1:c.3566C>T, XM_005246068.1:c.*4885C>TVOUS04/03/2018
406COL6A3Ex11NM_004369.3:c.5392C>Tp.Arg1798Cys | p.R1798CLRG_473t1:c.5392C>T, NM_004369.3:c.5392C>T, NM_057164.3:c.4891C>T, NM_057164.4:c.*4890C>T, NM_057165.3:c.4792C>T, NM_057165.4:c.*4890C>T, NM_057166.3:c.4789C>T, NM_057166.4:c.3571C>T, NM_057167.3:c.4774C>T, XM_005246065.1:c.4792C>T, XM_005246066.1:c.4171C>T, XM_005246067.1:c.3571C>T, XM_005246068.1:c.*4890C>TVOUS09/06/2016
407COL6A3Ex11NM_004369.3:c.5393G>Ap.Arg1798His | p.R1798HLRG_473t1:c.5393G>A, NM_004369.3:c.5393G>A, NM_057164.3:c.4892G>A, NM_057164.4:c.*4891G>A, NM_057165.3:c.4793G>A, NM_057165.4:c.*4891G>A, NM_057166.3:c.4790G>A, NM_057166.4:c.3572G>A, NM_057167.3:c.4775G>A, XM_005246065.1:c.4793G>A, XM_005246066.1:c.4172G>A, XM_005246067.1:c.3572G>A, XM_005246068.1:c.*4891G>AVOUS03/23/2017
408COL6A3Ex11NM_004369.3:c.5394C>Tp.Arg1798= | p.R1798=LRG_473t1:c.5394C>T, NM_004369.3:c.5394C>T, NM_057164.3:c.4893C>T, NM_057164.4:c.*4892C>T, NM_057165.3:c.4794C>T, NM_057165.4:c.*4892C>T, NM_057166.3:c.4791C>T, NM_057166.4:c.3573C>T, NM_057167.3:c.4776C>T, XM_005246065.1:c.4794C>T, XM_005246066.1:c.4173C>T, XM_005246067.1:c.3573C>T, XM_005246068.1:c.*4892C>TVOUS12/31/2015
409COL6A3Ex11NM_004369.3:c.5403C>Tp.Asn1801= | p.N1801=LRG_473t1:c.5403C>T, NM_004369.3:c.5403C>T, NM_057164.3:c.4902C>T, NM_057164.4:c.*4901C>T, NM_057165.3:c.4803C>T, NM_057165.4:c.*4901C>T, NM_057166.3:c.4800C>T, NM_057166.4:c.3582C>T, NM_057167.3:c.4785C>T, XM_005246065.1:c.4803C>T, XM_005246066.1:c.4182C>T, XM_005246067.1:c.3582C>T, XM_005246068.1:c.*4901C>TVOUS12/28/2016
410COL6A3Ex11NM_004369.3:c.5418C>Tp.Ser1806= | p.S1806=VOUS09/19/2012
411COL6A3Ex11NM_004369.3:c.5426G>Ap.Ser1809Asn | p.S1809NLRG_473t1:c.5426G>A, NM_004369.3:c.5426G>A, NM_057164.3:c.4925G>A, NM_057164.4:c.*4924G>A, NM_057165.3:c.4826G>A, NM_057165.4:c.*4924G>A, NM_057166.3:c.4823G>A, NM_057166.4:c.3605G>A, NM_057167.3:c.4808G>A, XM_005246065.1:c.4826G>A, XM_005246066.1:c.4205G>A, XM_005246067.1:c.3605G>A, XM_005246068.1:c.*4924G>AVOUS12/28/2016
412COL6A3Ex11NM_004369.3:c.5470C>Tp.Leu1824Phe | p.L1824FLRG_473t1:c.5470C>T, NM_004369.3:c.5470C>T, NM_057164.3:c.4969C>T, NM_057164.4:c.*4968C>T, NM_057165.3:c.4870C>T, NM_057165.4:c.*4968C>T, NM_057166.3:c.4867C>T, NM_057166.4:c.3649C>T, NM_057167.3:c.4852C>T, XM_005246065.1:c.4870C>T, XM_005246066.1:c.4249C>T, XM_005246067.1:c.3649C>T, XM_005246068.1:c.*4968C>TVOUS08/09/2016
413COL6A3Ex12NM_004369.3:c.5501-4C>GLRG_473t1:c.5501-4C>G, NM_004369.3:c.5501-4C>G, NM_057164.3:c.5000-4C>G, NM_057165.3:c.4901-4C>G, NM_057166.3:c.4898-4C>G, NM_057166.4:c.3680-4C>G, NM_057167.3:c.4883-4C>G, XM_005246065.1:c.4901-4C>G, XM_005246066.1:c.4280-4C>G, XM_005246067.1:c.3680-4C>GVOUS09/19/2016
414COL6A3Ex12NM_004369.3:c.5522T>Gp.Leu1841Arg | p.L1841RLRG_473t1:c.5522T>G, NM_004369.3:c.5522T>G, NM_057164.3:c.5021T>G, NM_057165.3:c.4922T>G, NM_057166.3:c.4919T>G, NM_057166.4:c.3701T>G, NM_057167.3:c.4904T>G, XM_005246065.1:c.4922T>G, XM_005246066.1:c.4301T>G, XM_005246067.1:c.3701T>GVOUS02/23/2016
415COL6A3Ex12NM_004369.3:c.5522T>Cp.Leu1841Pro | p.L1841PLRG_473t1:c.5522T>C, NM_004369.3:c.5522T>C, NM_057164.3:c.5021T>C, NM_057165.3:c.4922T>C, NM_057166.3:c.4919T>C, NM_057166.4:c.3701T>C, NM_057167.3:c.4904T>C, XM_005246065.1:c.4922T>C, XM_005246066.1:c.4301T>C, XM_005246067.1:c.3701T>CVOUS05/13/2016
416COL6A3Ex12NM_004369.3:c.5525G>Ap.Gly1842Glu | p.G1842ELRG_473t1:c.5525G>A, NM_004369.3:c.5525G>A, NM_057164.3:c.5024G>A, NM_057165.3:c.4925G>A, NM_057166.3:c.4922G>A, NM_057166.4:c.3704G>A, NM_057167.3:c.4907G>A, XM_005246065.1:c.4925G>A, XM_005246066.1:c.4304G>A, XM_005246067.1:c.3704G>AVOUS06/13/2018
417COL6A3Ex12NM_004369.3:c.5534G>Tp.Gly1845Val | p.G1845VLRG_473t1:c.5534G>T, NM_004369.3:c.5534G>T, NM_057164.3:c.5033G>T, NM_057165.3:c.4934G>T, NM_057166.3:c.4931G>T, NM_057166.4:c.3713G>T, NM_057167.3:c.4916G>T, XM_005246065.1:c.4934G>T, XM_005246066.1:c.4313G>T, XM_005246067.1:c.3713G>TVOUS09/27/2016
418COL6A3Ex12NM_004369.3:c.5542G>Tp.Asp1848Tyr | p.D1848YLRG_473t1:c.5542G>T, NM_004369.3:c.5542G>T, NM_057164.3:c.5041G>T, NM_057165.3:c.4942G>T, NM_057166.3:c.4939G>T, NM_057166.4:c.3721G>T, NM_057167.3:c.4924G>T, XM_005246065.1:c.4942G>T, XM_005246066.1:c.4321G>T, XM_005246067.1:c.3721G>TVOUS03/27/2018
419COL6A3Ex12NM_004369.3:c.5555T>Cp.Phe1852Ser | p.F1852SLRG_473t1:c.5555T>C, NM_004369.3:c.5555T>C, NM_057164.3:c.5054T>C, NM_057165.3:c.4955T>C, NM_057166.3:c.4952T>C, NM_057166.4:c.3734T>C, NM_057167.3:c.4937T>C, XM_005246065.1:c.4955T>C, XM_005246066.1:c.4334T>C, XM_005246067.1:c.3734T>CVOUS11/11/2016
420COL6A3Ex12NM_004369.3:c.5575G>Ap.Glu1859Lys | p.E1859KLRG_473t1:c.5575G>A, NM_004369.3:c.5575G>A, NM_057164.3:c.5074G>A, NM_057165.3:c.4975G>A, NM_057166.3:c.4972G>A, NM_057166.4:c.3754G>A, NM_057167.3:c.4957G>A, XM_005246065.1:c.4975G>A, XM_005246066.1:c.4354G>A, XM_005246067.1:c.3754G>AVOUS01/04/2018
421COL6A3Ex12NM_004369.3:c.5590G>Ap.Ala1864Thr | p.A1864TNM_004369.3:c.5590G>A, NM_057164.3:c.5089G>A, NM_057165.3:c.4990G>A, NM_057166.3:c.4987G>A, NM_057166.4:c.3769G>A, NM_057167.3:c.4972G>A, XM_005246065.1:c.4990G>A, XM_005246066.1:c.4369G>A, XM_005246067.1:c.3769G>AVOUS09/10/2015
422COL6A3Ex12NM_004369.3:c.5607C>Tp.Ile1869= | p.I1869=LRG_473t1:c.5607C>T, NM_004369.3:c.5607C>T, NM_057164.3:c.5106C>T, NM_057165.3:c.5007C>T, NM_057166.3:c.5004C>T, NM_057166.4:c.3786C>T, NM_057167.3:c.4989C>T, XM_005246065.1:c.5007C>T, XM_005246066.1:c.4386C>T, XM_005246067.1:c.3786C>TVOUS06/01/2016
423COL6A3Ex12NM_004369.3:c.5609G>Ap.Ser1870Asn | p.S1870NLRG_473t1:c.5609G>A, NM_004369.3:c.5609G>A, NM_057164.3:c.5108G>A, NM_057165.3:c.5009G>A, NM_057166.3:c.5006G>A, NM_057166.4:c.3788G>A, NM_057167.3:c.4991G>A, XM_005246065.1:c.5009G>A, XM_005246066.1:c.4388G>A, XM_005246067.1:c.3788G>ABenign06/16/2016 
424COL6A3Ex12NM_004369.3:c.5610C>Ap.Ser1870Arg | p.S1870RLRG_473t1:c.5610C>A, NM_004369.3:c.5610C>A, NM_057164.3:c.5109C>A, NM_057165.3:c.5010C>A, NM_057166.3:c.5007C>A, NM_057166.4:c.3789C>A, NM_057167.3:c.4992C>A, XM_005246065.1:c.5010C>A, XM_005246066.1:c.4389C>A, XM_005246067.1:c.3789C>ABenign09/14/2016 
425COL6A3Ex12NM_004369.3:c.5619C>Tp.His1873= | p.H1873=LRG_473t1:c.5619C>T, NM_004369.3:c.5619C>TVOUS10/04/2018
426COL6A3Ex12NM_004369.3:c.5622G>Ap.Arg1874= | p.R1874=LRG_473t1:c.5622G>A, NM_004369.3:c.5622G>A, NM_057164.3:c.5121G>A, NM_057165.3:c.5022G>A, NM_057166.3:c.5019G>A, NM_057166.4:c.3801G>A, NM_057167.3:c.5004G>A, XM_005246065.1:c.5022G>A, XM_005246066.1:c.4401G>A, XM_005246067.1:c.3801G>AVOUS06/20/2016
427COL6A3Ex12NM_004369.3:c.5632A>Cp.Ser1878Arg | p.S1878RLRG_473t1:c.5632A>C, NM_004369.3:c.5632A>C, NM_057164.3:c.5131A>C, NM_057165.3:c.5032A>C, NM_057166.3:c.5029A>C, NM_057166.4:c.3811A>C, NM_057167.3:c.5014A>C, XM_005246065.1:c.5032A>C, XM_005246066.1:c.4411A>C, XM_005246067.1:c.3811A>CVOUS12/14/2017
428COL6A3Ex12NM_004369.3:c.5632_5633delAGinsCCp.Ser1878Pro | p.S1878PLRG_473t1:c.5632_5633delinsCC, NM_004369.3:c.5632_5633delinsCC, NM_057164.3:c.5131_5132delinsCC, NM_057165.3:c.5032_5033delinsCC, NM_057166.3:c.5029_5030delinsCC, NM_057166.4:c.3811_3812delinsCC, NM_057167.3:c.5014_5015delinsCC, XM_005246065.1:c.5032_5033delinsCC, XM_005246066.1:c.4411_4412delinsCC, XM_005246067.1:c.3811_3812delinsCCVOUS12/14/2017
429COL6A3Ex12NM_004369.3:c.5633G>Cp.Ser1878Thr | p.S1878TLRG_473t1:c.5633G>C, NM_004369.3:c.5633G>C, NM_057164.3:c.5132G>C, NM_057165.3:c.5033G>C, NM_057166.3:c.5030G>C, NM_057166.4:c.3812G>C, NM_057167.3:c.5015G>C, XM_005246065.1:c.5033G>C, XM_005246066.1:c.4412G>C, XM_005246067.1:c.3812G>CVOUS12/14/2017
430COL6A3Ex12NM_004369.3:c.5634C>Tp.Ser1878= | p.S1878=NM_004369.3:c.5634C>T, NM_057164.3:c.5133C>T, NM_057165.3:c.5034C>T, NM_057166.3:c.5031C>T, NM_057166.4:c.3813C>T, NM_057167.3:c.5016C>T, XM_005246065.1:c.5034C>T, XM_005246066.1:c.4413C>T, XM_005246067.1:c.3813C>TVOUS01/12/2016
431COL6A3Ex12NM_004369.3:c.5635G>Ap.Gly1879Ser | p.G1879SLRG_473t1:c.5635G>A, NM_004369.3:c.5635G>A, NM_057164.3:c.5134G>A, NM_057165.3:c.5035G>A, NM_057166.3:c.5032G>A, NM_057166.4:c.3814G>A, NM_057167.3:c.5017G>A, XM_005246065.1:c.5035G>A, XM_005246066.1:c.4414G>A, XM_005246067.1:c.3814G>AVOUS01/19/2018
432COL6A3Ex12NM_004369.3:c.5645C>Tp.Ser1882Leu | p.S1882LLRG_473t1:c.5645C>T, NM_004369.3:c.5645C>T, NM_057164.3:c.5144C>T, NM_057165.3:c.5045C>T, NM_057166.3:c.5042C>T, NM_057166.4:c.3824C>T, NM_057167.3:c.5027C>T, XM_005246065.1:c.5045C>T, XM_005246066.1:c.4424C>T, XM_005246067.1:c.3824C>TVOUS07/08/2016
433COL6A3Ex12NM_004369.3:c.5649C>Ap.Pro1883= | p.P1883=LRG_473t1:c.5649C>A, NM_004369.3:c.5649C>A, NM_057164.3:c.5148C>A, NM_057165.3:c.5049C>A, NM_057166.3:c.5046C>A, NM_057166.4:c.3828C>A, NM_057167.3:c.5031C>A, XM_005246065.1:c.5049C>A, XM_005246066.1:c.4428C>A, XM_005246067.1:c.3828C>AVOUS08/22/2016
434COL6A3Ex12NM_004369.3:c.5652C>Tp.Thr1884= | p.T1884=LRG_473t1:c.5652C>T, NM_004369.3:c.5652C>T, NM_057164.3:c.5151C>T, NM_057165.3:c.5052C>T, NM_057166.3:c.5049C>T, NM_057166.4:c.3831C>T, NM_057167.3:c.5034C>T, XM_005246065.1:c.5052C>T, XM_005246066.1:c.4431C>T, XM_005246067.1:c.3831C>TVOUS12/14/2017
435COL6A3Ex12NM_004369.3:c.5680C>Tp.Pro1894Ser | p.P1894SLRG_473t1:c.5680C>T, NM_004369.3:c.5680C>T, NM_057164.3:c.5179C>T, NM_057165.3:c.5080C>T, NM_057166.3:c.5077C>T, NM_057166.4:c.3859C>T, NM_057167.3:c.5062C>T, XM_005246065.1:c.5080C>T, XM_005246066.1:c.4459C>T, XM_005246067.1:c.3859C>TVOUS12/10/2015
436COL6A3Ex12NM_004369.3:c.5684C>Tp.Ser1895Leu | p.S1895LVOUS10/09/2014
437COL6A3Ex12NM_004369.3:c.5712C>Tp.Asp1904= | p.D1904=LRG_473t1:c.5712C>T, NM_004369.3:c.5712C>T, NM_057164.3:c.5211C>T, NM_057165.3:c.5112C>T, NM_057166.3:c.5109C>T, NM_057166.4:c.3891C>T, NM_057167.3:c.5094C>T, XM_005246065.1:c.5112C>T, XM_005246066.1:c.4491C>T, XM_005246067.1:c.3891C>TLikely benign04/12/2017 
438COL6A3Ex12NM_004369.3:c.5734G>Ap.Glu1912Lys | p.E1912KLRG_473t1:c.5734G>A, NM_004369.3:c.5734G>A, NM_057164.3:c.5233G>A, NM_057165.3:c.5134G>A, NM_057166.3:c.5131G>A, NM_057166.4:c.3913G>A, NM_057167.3:c.5116G>A, XM_005246065.1:c.5134G>A, XM_005246066.1:c.4513G>A, XM_005246067.1:c.3913G>AVOUS10/05/2016
439COL6A3Ex12NM_004369.3:c.5743C>Tp.Arg1915Trp | p.R1915WLRG_473t1:c.5743C>T, NM_004369.3:c.5743C>T, NM_057164.3:c.5242C>T, NM_057165.3:c.5143C>T, NM_057166.3:c.5140C>T, NM_057166.4:c.3922C>T, NM_057167.3:c.5125C>T, XM_005246065.1:c.5143C>T, XM_005246066.1:c.4522C>T, XM_005246067.1:c.3922C>TVOUS11/21/2018
440COL6A3Ex12NM_004369.3:c.5750T>Cp.Met1917Thr | p.M1917TLRG_473t1:c.5750T>C, NM_004369.3:c.5750T>C, NM_057164.3:c.5249T>C, NM_057165.3:c.5150T>C, NM_057166.3:c.5147T>C, NM_057166.4:c.3929T>C, NM_057167.3:c.5132T>C, XM_005246065.1:c.5150T>C, XM_005246066.1:c.4529T>C, XM_005246067.1:c.3929T>CVOUS09/06/2018
441COL6A3Ex12NM_004369.3:c.5794G>Ap.Val1932Ile | p.V1932ILRG_473t1:c.5794G>A, NM_004369.3:c.5794G>A, NM_057164.3:c.5293G>A, NM_057165.3:c.5194G>A, NM_057166.3:c.5191G>A, NM_057166.4:c.3973G>A, NM_057167.3:c.5176G>A, XM_005246065.1:c.5194G>A, XM_005246066.1:c.4573G>A, XM_005246067.1:c.3973G>AVOUS08/22/2017
442COL6A3Ex12NM_004369.3:c.5820C>Tp.Ser1940= | p.S1940=LRG_473t1:c.5820C>T, NM_004369.3:c.5820C>T, NM_057164.3:c.5319C>T, NM_057165.3:c.5220C>T, NM_057166.3:c.5217C>T, NM_057166.4:c.3999C>T, NM_057167.3:c.5202C>T, XM_005246065.1:c.5220C>T, XM_005246066.1:c.4599C>T, XM_005246067.1:c.3999C>TBenign08/30/2016 
443COL6A3Ex12NM_004369.3:c.5822C>Tp.Ser1941Leu | p.S1941LNM_004369.3:c.5822C>T, NM_057164.3:c.5321C>T, NM_057165.3:c.5222C>T, NM_057166.3:c.5219C>T, NM_057166.4:c.4001C>T, NM_057167.3:c.5204C>T, XM_005246065.1:c.5222C>T, XM_005246066.1:c.4601C>T, XM_005246067.1:c.4001C>TVOUS01/03/2016
444COL6A3Ex12NM_004369.3:c.5825C>Tp.Pro1942Leu | p.P1942LLRG_473t1:c.5825C>T, NM_004369.3:c.5825C>T, NM_057164.3:c.5324C>T, NM_057165.3:c.5225C>T, NM_057166.3:c.5222C>T, NM_057166.4:c.4004C>T, NM_057167.3:c.5207C>T, XM_005246065.1:c.5225C>T, XM_005246066.1:c.4604C>T, XM_005246067.1:c.4004C>TVOUS08/17/2016
445COL6A3Ex12NM_004369.3:c.5826G>Ap.Pro1942= | p.P1942=LRG_473t1:c.5826G>A, NM_004369.3:c.5826G>A, NM_057164.3:c.5325G>A, NM_057165.3:c.5226G>A, NM_057166.3:c.5223G>A, NM_057166.4:c.4005G>A, NM_057167.3:c.5208G>A, XM_005246065.1:c.5226G>A, XM_005246066.1:c.4605G>A, XM_005246067.1:c.4005G>AVOUS04/27/2018
446COL6A3Ex12NM_004369.3:c.5833G>Cp.Val1945Leu | p.V1945LLRG_473t1:c.5833G>C, NM_004369.3:c.5833G>C, NM_057164.3:c.5332G>C, NM_057165.3:c.5233G>C, NM_057166.3:c.5230G>C, NM_057166.4:c.4012G>C, NM_057167.3:c.5215G>C, XM_005246065.1:c.5233G>C, XM_005246066.1:c.4612G>C, XM_005246067.1:c.4012G>CVOUS12/19/2016
447COL6A3Ex12NM_004369.3:c.5838+1G>TLRG_473t1:c.5838+1G>T, NM_004369.3:c.5838+1G>T, NM_057164.3:c.5337+1G>T, NM_057165.3:c.5238+1G>T, NM_057166.3:c.5235+1G>T, NM_057166.4:c.4017+1G>T, NM_057167.3:c.5220+1G>T, XM_005246065.1:c.5238+1G>T, XM_005246066.1:c.4617+1G>T, XM_005246067.1:c.4017+1G>TPathogenic03/20/2018 
448COL6A3Ex12NM_004369.3:c.5838+5G>ALRG_473t1:c.5838+5G>A, NM_004369.3:c.5838+5G>A, NM_057164.3:c.5337+5G>A, NM_057165.3:c.5238+5G>A, NM_057166.3:c.5235+5G>A, NM_057166.4:c.4017+5G>A, NM_057167.3:c.5220+5G>A, XM_005246065.1:c.5238+5G>A, XM_005246066.1:c.4617+5G>A, XM_005246067.1:c.4017+5G>AVOUS12/29/2016
449COL6A3Ex13NM_004369.3:c.5839-3C>TLRG_473t1:c.5839-3C>T, NM_004369.3:c.5839-3C>T, NM_057164.3:c.5338-3C>T, NM_057165.3:c.5239-3C>T, NM_057166.3:c.5236-3C>T, NM_057166.4:c.4018-3C>T, NM_057167.3:c.5221-3C>T, XM_005246065.1:c.5239-3C>T, XM_005246066.1:c.4618-3C>T, XM_005246067.1:c.4018-3C>TVOUS12/06/2018
450COL6A3Ex13NM_004369.3:c.5893G>Cp.Ala1965Pro | p.A1965PLRG_473t1:c.5893G>C, NM_004369.3:c.5893G>C, NM_057164.3:c.5392G>C, NM_057165.3:c.5293G>C, NM_057166.3:c.5290G>C, NM_057166.4:c.4072G>C, NM_057167.3:c.5275G>C, XM_005246065.1:c.5293G>C, XM_005246066.1:c.4672G>C, XM_005246067.1:c.4072G>CVOUS01/31/2018
451COL6A3Ex13NM_004369.3:c.5908C>Tp.Arg1970Cys | p.R1970CNM_004369.3:c.5908C>T, NM_057164.3:c.5407C>T, NM_057165.3:c.5308C>T, NM_057166.3:c.5305C>T, NM_057166.4:c.4087C>T, NM_057167.3:c.5290C>T, XM_005246065.1:c.5308C>T, XM_005246066.1:c.4687C>T, XM_005246067.1:c.4087C>TVOUS08/07/2015
452COL6A3Ex13NM_004369.3:c.5910C>Tp.Arg1970= | p.R1970=LRG_473t1:c.5910C>T, NM_004369.3:c.5910C>T, NM_057164.3:c.5409C>T, NM_057165.3:c.5310C>T, NM_057166.3:c.5307C>T, NM_057166.4:c.4089C>T, NM_057167.3:c.5292C>T, XM_005246065.1:c.5310C>T, XM_005246066.1:c.4689C>T, XM_005246067.1:c.4089C>TVOUS08/22/2019
453COL6A3Ex13NM_004369.3:c.5917+28G>CBenign11/05/2012 
454COL6A3Ex14NM_004369.3:c.5953G>Ap.Val1985Met | p.V1985MLRG_473t1:c.5953G>A, NM_004369.3:c.5953G>A, NM_057164.3:c.5452G>A, NM_057165.3:c.5353G>A, NM_057166.3:c.5350G>A, NM_057166.4:c.4132G>A, NM_057167.3:c.5335G>A, XM_005246065.1:c.5353G>A, XM_005246066.1:c.4732G>A, XM_005246067.1:c.4132G>AVOUS10/24/2016
455COL6A3Ex14NM_004369.3:c.5968C>Tp.Arg1990Trp | p.R1990WNM_004369.3:c.5968C>T, NM_057164.3:c.5467C>T, NM_057165.3:c.5368C>T, NM_057166.3:c.5365C>T, NM_057166.4:c.4147C>T, NM_057167.3:c.5350C>T, XM_005246065.1:c.5368C>T, XM_005246066.1:c.4747C>T, XM_005246067.1:c.4147C>TLikely benign01/29/2016 
456COL6A3Ex14NM_004369.3:c.5969G>Ap.Arg1990Gln | p.R1990QLRG_473t1:c.5969G>A, NM_004369.3:c.5969G>A, NM_057164.3:c.5468G>A, NM_057165.3:c.5369G>A, NM_057166.3:c.5366G>A, NM_057166.4:c.4148G>A, NM_057167.3:c.5351G>A, XM_005246065.1:c.5369G>A, XM_005246066.1:c.4748G>A, XM_005246067.1:c.4148G>AVOUS09/21/2016
457COL6A3Ex14NM_004369.3:c.5975T>Cp.Met1992Thr | p.M1992TLRG_473t1:c.5975T>C, NM_004369.3:c.5975T>C, NM_057164.3:c.5474T>C, NM_057165.3:c.5375T>C, NM_057166.3:c.5372T>C, NM_057166.4:c.4154T>C, NM_057167.3:c.5357T>C, XM_005246065.1:c.5375T>C, XM_005246066.1:c.4754T>C, XM_005246067.1:c.4154T>CVOUS12/17/2018
458COL6A3Ex14NM_004369.3:c.5993G>Ap.Arg1998Gln | p.R1998QNM_004369.3:c.5993G>A, NM_057164.3:c.5492G>A, NM_057165.3:c.5393G>A, NM_057166.3:c.5390G>A, NM_057166.4:c.4172G>A, NM_057167.3:c.5375G>A, XM_005246065.1:c.5393G>A, XM_005246066.1:c.4772G>A, XM_005246067.1:c.4172G>AVOUS10/28/2015
459COL6A3Ex14NM_004369.3:c.5994A>Cp.Arg1998= | p.R1998=LRG_473t1:c.5994A>C, NM_004369.3:c.5994A>C, NM_057164.3:c.5493A>C, NM_057165.3:c.5394A>C, NM_057166.3:c.5391A>C, NM_057166.4:c.4173A>C, NM_057167.3:c.5376A>C, XM_005246065.1:c.5394A>C, XM_005246066.1:c.4773A>C, XM_005246067.1:c.4173A>CVOUS12/07/2018
460COL6A3Ex14NM_004369.3:c.6040G>Tp.Asp2014Tyr | p.D2014YLRG_473t1:c.6040G>T, NM_004369.3:c.6040G>T, NM_057164.3:c.5539G>T, NM_057165.3:c.5440G>T, NM_057166.3:c.5437G>T, NM_057166.4:c.4219G>T, NM_057167.3:c.5422G>T, XM_005246065.1:c.5440G>T, XM_005246066.1:c.4819G>T, XM_005246067.1:c.4219G>TVOUS09/17/2016
461COL6A3Ex14NM_004369.3:c.6045T>Cp.Tyr2015= | p.Y2015=LRG_473t1:c.6045T>C, NM_004369.3:c.6045T>C, NM_057164.3:c.5544T>C, NM_057165.3:c.5445T>C, NM_057166.3:c.5442T>C, NM_057166.4:c.4224T>C, NM_057167.3:c.5427T>C, XM_005246065.1:c.5445T>C, XM_005246066.1:c.4824T>C, XM_005246067.1:c.4224T>CVOUS12/28/2016
462COL6A3Ex14NM_004369.3:c.6053C>Tp.Ala2018Val | p.A2018VLRG_473t1:c.6053C>T, NM_004369.3:c.6053C>T, NM_057164.3:c.5552C>T, NM_057165.3:c.5453C>T, NM_057166.3:c.5450C>T, NM_057166.4:c.4232C>T, NM_057167.3:c.5435C>T, XM_005246065.1:c.5453C>T, XM_005246066.1:c.4832C>T, XM_005246067.1:c.4232C>TBenign11/03/2016 
463COL6A3Ex14NM_004369.3:c.6063+8T>GLRG_473t1:c.6063+8T>G, NM_004369.3:c.6063+8T>G, NM_057164.3:c.5562+8T>G, NM_057165.3:c.5463+8T>G, NM_057166.3:c.5460+8T>G, NM_057166.4:c.4242+8T>G, NM_057167.3:c.5445+8T>G, XM_005246065.1:c.5463+8T>G, XM_005246066.1:c.4842+8T>G, XM_005246067.1:c.4242+8T>GVOUS01/17/2019
464COL6A3Ex14NM_004369.3:c.6063+13dupTBenign11/05/2012 
465COL6A3Ex15NM_004369.3:c.6064-6C>TNM_004369.3:c.6064-6C>T, NM_057164.3:c.5563-6C>T, NM_057165.3:c.5464-6C>T, NM_057166.3:c.5461-6C>T, NM_057166.4:c.4243-6C>T, NM_057167.3:c.5446-6C>T, XM_005246065.1:c.5464-6C>T, XM_005246066.1:c.4843-6C>T, XM_005246067.1:c.4243-6C>TBenign12/07/2015 
466COL6A3Ex15NM_004369.3:c.6064-2A>GLRG_473t1:c.6064-2A>G, NM_004369.3:c.6064-2A>G, NM_057164.3:c.5563-2A>G, NM_057165.3:c.5464-2A>G, NM_057166.3:c.5461-2A>G, NM_057166.4:c.4243-2A>G, NM_057167.3:c.5446-2A>G, XM_005246065.1:c.5464-2A>G, XM_005246066.1:c.4843-2A>G, XM_005246067.1:c.4243-2A>GPathogenic04/04/2017 
467COL6A3Ex15NM_004369.3:c.6066C>Tp.Asp2022= | p.D2022=LRG_473t1:c.6066C>T, NM_004369.3:c.6066C>T, NM_057164.3:c.5565C>T, NM_057165.3:c.5466C>T, NM_057166.3:c.5463C>T, NM_057166.4:c.4245C>T, NM_057167.3:c.5448C>T, XM_005246065.1:c.5466C>T, XM_005246066.1:c.4845C>T, XM_005246067.1:c.4245C>TVOUS07/27/2016
468COL6A3Ex15NM_004369.3:c.6132G>Tp.Gly2044= | p.G2044=NM_004369.3:c.6132G>T, NM_057164.3:c.5631G>T, NM_057165.3:c.5532G>T, NM_057166.3:c.5529G>T, NM_057166.4:c.4311G>T, NM_057167.3:c.5514G>T, XM_005246065.1:c.5532G>T, XM_005246066.1:c.4911G>T, XM_005246067.1:c.4311G>TVOUS02/05/2016
469COL6A3Ex15NM_004369.3:c.6138C>Tp.Ile2046= | p.I2046=LRG_473t1:c.6138C>T, NM_004369.3:c.6138C>T, NM_057164.3:c.5637C>T, NM_057165.3:c.5538C>T, NM_057166.3:c.5535C>T, NM_057166.4:c.4317C>T, NM_057167.3:c.5520C>T, XM_005246065.1:c.5538C>T, XM_005246066.1:c.4917C>T, XM_005246067.1:c.4317C>TVOUS05/22/2019
470COL6A3Ex15NM_004369.3:c.6156G>Cp.Lys2052Asn | p.K2052NNM_004369.3:c.6156G>C, NM_057164.3:c.5655G>C, NM_057165.3:c.5556G>C, NM_057166.3:c.5553G>C, NM_057166.4:c.4335G>C, NM_057167.3:c.5538G>CVOUS11/19/2013
471COL6A3Ex15NM_004369.3:c.6156+1G>ALRG_473t1:c.6156+1G>A, NM_004369.3:c.6156+1G>A, NM_057164.3:c.5655+1G>A, NM_057165.3:c.5556+1G>A, NM_057166.3:c.5553+1G>A, NM_057166.4:c.4335+1G>A, NM_057167.3:c.5538+1G>A, XM_005246065.1:c.5556+1G>A, XM_005246066.1:c.4935+1G>A, XM_005246067.1:c.4335+1G>APathogenic10/04/2018 
472COL6A3Ex15NM_004369.3:c.6156+4C>TBenign07/13/2012 
473COL6A3Ex15NM_004369.3:c.6156+5G>AVOUS11/02/2012
474COL6A3Ex16NM_004369.3:c.6157-16G>ANM_004369.3:c.6157-16G>A, NM_057164.3:c.5656-16G>A, NM_057165.3:c.5557-16G>A, NM_057166.3:c.5554-16G>A, NM_057166.4:c.4336-16G>A, NM_057167.3:c.5539-16G>ABenign08/12/2013 
475COL6A3Ex16NM_004369.3:c.6157-4T>GLRG_473t1:c.6157-4T>G, NM_004369.3:c.6157-4T>G, NM_057164.3:c.5656-4T>G, NM_057165.3:c.5557-4T>G, NM_057166.3:c.5554-4T>G, NM_057166.4:c.4336-4T>G, NM_057167.3:c.5539-4T>GVOUS07/08/2016
476COL6A3Ex16NM_004369.3:c.6157-2A>CLRG_473t1:c.6157-2A>C, NM_004369.3:c.6157-2A>C, NM_057164.3:c.5656-2A>C, NM_057165.3:c.5557-2A>C, NM_057166.3:c.5554-2A>C, NM_057166.4:c.4336-2A>C, NM_057167.3:c.5539-2A>C, XM_005246065.1:c.5557-2A>C, XM_005246066.1:c.4936-2A>C, XM_005246067.1:c.4336-2A>CPathogenic05/18/2016 
477COL6A3Ex16NM_004369.3:c.6157G>Tp.Gly2053Cys | p.G2053CLRG_473t1:c.6157G>T, NM_004369.3:c.6157G>T, NM_057164.3:c.5656G>T, NM_057165.3:c.5557G>T, NM_057166.3:c.5554G>T, NM_057166.4:c.4336G>T, NM_057167.3:c.5539G>T, XM_005246065.1:c.5557G>T, XM_005246066.1:c.4936G>T, XM_005246067.1:c.4336G>TPathogenic02/02/2018 
478COL6A3Ex16NM_004369.3:c.6159T>Cp.Gly2053= | p.G2053=LRG_473t1:c.6159T>C, NM_004369.3:c.6159T>C, NM_057164.3:c.5658T>C, NM_057165.3:c.5559T>C, NM_057166.3:c.5556T>C, NM_057166.4:c.4338T>C, NM_057167.3:c.5541T>C, XM_005246065.1:c.5559T>C, XM_005246066.1:c.4938T>C, XM_005246067.1:c.4338T>CVOUS04/27/2018
479COL6A3Ex16NM_004369.3:c.6167G>Ap.Gly2056Glu | p.G2056ELRG_473t1:c.6167G>A, NM_004369.3:c.6167G>A, NM_057164.3:c.5666G>A, NM_057165.3:c.5567G>A, NM_057166.3:c.5564G>A, NM_057166.4:c.4346G>A, NM_057167.3:c.5549G>A, XM_005246065.1:c.5567G>A, XM_005246066.1:c.4946G>A, XM_005246067.1:c.4346G>ALikely pathogenic05/23/2017 
480COL6A3Ex16NM_004369.3:c.6175G>Tp.Gly2059Cys | p.G2059CLRG_473t1:c.6175G>T, NM_004369.3:c.6175G>T, NM_057164.3:c.5674G>T, NM_057165.3:c.5575G>T, NM_057166.3:c.5572G>T, NM_057166.4:c.4354G>T, NM_057167.3:c.5557G>T, XM_005246065.1:c.5575G>T, XM_005246066.1:c.4954G>T, XM_005246067.1:c.4354G>TPathogenic11/03/2015 
481COL6A3Ex16NM_004369.3:c.6180C>Tp.Tyr2060= | p.Y2060=LRG_473t1:c.6180C>T, NM_004369.3:c.6180C>T, NM_057164.3:c.5679C>T, NM_057165.3:c.5580C>T, NM_057166.3:c.5577C>T, NM_057166.4:c.4359C>T, NM_057167.3:c.5562C>T, XM_005246065.1:c.5580C>T, XM_005246066.1:c.4959C>T, XM_005246067.1:c.4359C>TVOUS12/27/2016
482COL6A3Ex16NM_004369.3:c.6193G>Cp.Gly2065Arg | p.G2065RNM_004369.3:c.6193G>C, NM_057164.3:c.5692G>C, NM_057165.3:c.5593G>C, NM_057166.3:c.5590G>C, NM_057166.4:c.4372G>C, NM_057167.3:c.5575G>C, XM_005246065.1:c.5593G>C, XM_005246066.1:c.4972G>C, XM_005246067.1:c.4372G>CLikely pathogenic12/11/2015 
483COL6A3Ex16NM_004369.3:c.6193G>Ap.Gly2065Ser | p.G2065SLRG_473t1:c.6193G>A, NM_004369.3:c.6193G>A, NM_057164.3:c.5692G>A, NM_057165.3:c.5593G>A, NM_057166.3:c.5590G>A, NM_057166.4:c.4372G>A, NM_057167.3:c.5575G>ALikely pathogenic05/03/2016 
484COL6A3Ex16NM_004369.3:c.6199G>Ap.Glu2067Lys | p.E2067KLRG_473t1:c.6199G>A, NM_004369.3:c.6199G>A, NM_057164.3:c.5698G>A, NM_057165.3:c.5599G>A, NM_057166.3:c.5596G>A, NM_057166.4:c.4378G>A, NM_057167.3:c.5581G>A, XM_005246065.1:c.5599G>A, XM_005246066.1:c.4978G>A, XM_005246067.1:c.4378G>AVOUS03/12/2019
485COL6A3Ex16NM_004369.3:c.6210+1G>ALRG_473t1:c.6210+1G>A, NM_004369.3:c.6210+1G>A, NM_057164.3:c.5709+1G>A, NM_057165.3:c.5610+1G>A, NM_057166.3:c.5607+1G>A, NM_057166.4:c.4389+1G>A, NM_057167.3:c.5592+1G>A, XM_005246065.1:c.5610+1G>A, XM_005246066.1:c.4989+1G>A, XM_005246067.1:c.4389+1G>APathogenic01/27/2015 
486COL6A3Ex16NM_004369.3:c.6210+5G>TLRG_473t1:c.6210+5G>T, NM_004369.3:c.6210+5G>T, NM_057164.3:c.5709+5G>T, NM_057165.3:c.5610+5G>T, NM_057166.3:c.5607+5G>T, NM_057166.4:c.4389+5G>T, NM_057167.3:c.5592+5G>T, XM_005246065.1:c.5610+5G>T, XM_005246066.1:c.4989+5G>T, XM_005246067.1:c.4389+5G>TVOUS08/26/2016
487COL6A3Ex17NM_004369.3:c.6211-4A>GLRG_473t1:c.6211-4A>G, NM_004369.3:c.6211-4A>G, NM_057164.3:c.5710-4A>G, NM_057165.3:c.5611-4A>G, NM_057166.3:c.5608-4A>G, NM_057166.4:c.4390-4A>G, NM_057167.3:c.5593-4A>G, XM_005246065.1:c.5611-4A>G, XM_005246066.1:c.4990-4A>G, XM_005246067.1:c.4390-4A>GVOUS06/07/2017
488COL6A3Ex17NM_004369.3:c.6211-3C>TBenign11/05/2012 
489COL6A3Ex17NM_004369.3:c.6212G>Ap.Gly2071Asp | p.G2071DLRG_473t1:c.6212G>A, NM_004369.3:c.6212G>A, NM_057164.3:c.5711G>A, NM_057165.3:c.5612G>A, NM_057166.3:c.5609G>A, NM_057166.4:c.4391G>A, NM_057167.3:c.5594G>A, XM_005246065.1:c.5612G>A, XM_005246066.1:c.4991G>A, XM_005246067.1:c.4391G>ALikely pathogenic03/21/2017 
490COL6A3Ex17NM_004369.3:c.6220G>Ap.Gly2074Ser | p.G2074SLRG_473t1:c.6220G>A, NM_004369.3:c.6220G>A, NM_057164.3:c.5719G>A, NM_057165.3:c.5620G>A, NM_057166.3:c.5617G>A, NM_057166.4:c.4399G>A, NM_057167.3:c.5602G>A, XM_005246065.1:c.5620G>A, XM_005246066.1:c.4999G>A, XM_005246067.1:c.4399G>APathogenic07/03/2018 
491COL6A3Ex17NM_004369.3:c.6230G>Ap.Gly2077Asp | p.G2077DLRG_473t1:c.6230G>A, NM_004369.3:c.6230G>A, NM_057164.3:c.5729G>A, NM_057165.3:c.5630G>A, NM_057166.3:c.5627G>A, NM_057166.4:c.4409G>A, NM_057167.3:c.5612G>A, XM_005246065.1:c.5630G>A, XM_005246066.1:c.5009G>A, XM_005246067.1:c.4409G>APathogenic03/27/2017 
492COL6A3Ex17NM_004369.3:c.6237C>Tp.Asn2079= | p.N2079=LRG_473t1:c.6237C>T, NM_004369.3:c.6237C>T, NM_057164.3:c.5736C>T, NM_057165.3:c.5637C>T, NM_057166.3:c.5634C>T, NM_057166.4:c.4416C>T, NM_057167.3:c.5619C>T, XM_005246065.1:c.5637C>T, XM_005246066.1:c.5016C>T, XM_005246067.1:c.4416C>TVOUS12/04/2018
493COL6A3Ex17NM_004369.3:c.6238G>Ap.Gly2080Ser | p.G2080SLRG_473t1:c.6238G>A, NM_004369.3:c.6238G>A, NM_057164.3:c.5737G>A, NM_057165.3:c.5638G>A, NM_057166.3:c.5635G>A, NM_057166.4:c.4417G>A, NM_057167.3:c.5620G>A, XM_005246065.1:c.5638G>A, XM_005246066.1:c.5017G>A, XM_005246067.1:c.4417G>ALikely pathogenic06/16/2017 
494COL6A3Ex17NM_004369.3:c.6239G>Ap.Gly2080Asp | p.G2080DNM_004369.3:c.6239G>A, NM_057164.3:c.5738G>A, NM_057165.3:c.5639G>A, NM_057166.3:c.5636G>A, NM_057166.4:c.4418G>A, NM_057167.3:c.5621G>A, XM_005246065.1:c.5639G>A, XM_005246066.1:c.5018G>A, XM_005246067.1:c.4418G>APathogenic04/16/2015 
495COL6A3Ex17NM_004369.3:c.6248G>Ap.Gly2083Asp | p.G2083DLRG_473t1:c.6248G>A, NM_004369.3:c.6248G>A, NM_057164.3:c.5747G>A, NM_057165.3:c.5648G>A, NM_057166.3:c.5645G>A, NM_057166.4:c.4427G>A, NM_057167.3:c.5630G>A, XM_005246065.1:c.5648G>A, XM_005246066.1:c.5027G>A, XM_005246067.1:c.4427G>AVOUS**
496COL6A3Ex17NM_004369.3:c.6255G>Ap.Gln2085= | p.Q2085=LRG_473t1:c.6255G>A, NM_004369.3:c.6255G>A, NM_057164.3:c.5754G>A, NM_057165.3:c.5655G>A, NM_057166.3:c.5652G>A, NM_057166.4:c.4434G>A, NM_057167.3:c.5637G>A, XM_005246065.1:c.5655G>A, XM_005246066.1:c.5034G>A, XM_005246067.1:c.4434G>AVOUS07/08/2016
497COL6A3Ex17NM_004369.3:c.6282+1G>ALRG_473t1:c.6282+1G>A, NM_004369.3:c.6282+1G>A, NM_057164.3:c.5781+1G>A, NM_057165.3:c.5682+1G>A, NM_057166.3:c.5679+1G>A, NM_057166.4:c.4461+1G>A, NM_057167.3:c.5664+1G>A, XM_005246065.1:c.5682+1G>A, XM_005246066.1:c.5061+1G>A, XM_005246067.1:c.4461+1G>APathogenic08/11/2016 
498COL6A3Ex17NM_004369.3:c.6282+50C>TBenign11/05/2012 
499COL6A3Ex18NM_004369.3:c.6289C>Tp.Arg2097Trp | p.R2097WLRG_473t1:c.6289C>T, NM_004369.3:c.6289C>T, NM_057164.3:c.5788C>T, NM_057165.3:c.5689C>T, NM_057166.3:c.5686C>T, NM_057166.4:c.4468C>T, NM_057167.3:c.5671C>T, XM_005246065.1:c.5689C>T, XM_005246066.1:c.5068C>T, XM_005246067.1:c.4468C>TVOUS06/23/2016
500COL6A3Ex18NM_004369.3:c.6290G>Ap.Arg2097Gln | p.R2097QLRG_473t1:c.6290G>A, NM_004369.3:c.6290G>A, NM_057164.3:c.5789G>A, NM_057165.3:c.5690G>A, NM_057166.3:c.5687G>A, NM_057166.4:c.4469G>A, NM_057167.3:c.5672G>A, XM_005246065.1:c.5690G>A, XM_005246066.1:c.5069G>A, XM_005246067.1:c.4469G>AVOUS01/11/2018
501COL6A3Ex18NM_004369.3:c.6293G>Tp.Gly2098Val | p.G2098VNM_004369.3:c.6293G>T, NM_057164.3:c.5792G>T, NM_057165.3:c.5693G>T, NM_057166.3:c.5690G>T, NM_057166.4:c.4472G>T, NM_057167.3:c.5675G>T, XM_005246065.1:c.5693G>T, XM_005246066.1:c.5072G>T, XM_005246067.1:c.4472G>TPathogenic09/18/2014 
502COL6A3Ex18NM_004369.3:c.6309+1G>TLRG_473t1:c.6309+1G>T, NM_004369.3:c.6309+1G>T, NM_057164.3:c.5808+1G>T, NM_057165.3:c.5709+1G>T, NM_057166.3:c.5706+1G>T, NM_057166.4:c.4488+1G>T, NM_057167.3:c.5691+1G>T, XM_005246065.1:c.5709+1G>T, XM_005246066.1:c.5088+1G>T, XM_005246067.1:c.4488+1G>TLikely pathogenic06/06/2016 
503COL6A3Ex18NM_004369.3:c.6309+40C>TLRG_473t1:c.6309+40C>T, NM_004369.3:c.6309+40C>T, NM_057164.3:c.5808+40C>T, NM_057165.3:c.5709+40C>T, NM_057166.3:c.5706+40C>T, NM_057166.4:c.4488+40C>T, NM_057167.3:c.5691+40C>T, XM_005246065.1:c.5709+40C>T, XM_005246066.1:c.5088+40C>T, XM_005246067.1:c.4488+40C>TVOUS11/05/2012
504COL6A3Ex19NM_004369.3:c.6310-28_6325delCTTACCTGTCCGCCTTATTCCCTCTTAGGGCGAAGTAGGAGAAAPathogenic11/30/2016 
505COL6A3Ex19NM_004369.3:c.6312C>Tp.Gly2104= | p.G2104=LRG_473t1:c.6312C>T, NM_004369.3:c.6312C>T, NM_057164.3:c.5811C>T, NM_057165.3:c.5712C>T, NM_057166.3:c.5709C>T, NM_057166.4:c.4491C>T, NM_057167.3:c.5694C>T, XM_005246065.1:c.5712C>T, XM_005246066.1:c.5091C>T, XM_005246067.1:c.4491C>TVOUS04/06/2017
506COL6A3Ex19NM_004369.3:c.6342G>Ap.Leu2114= | p.L2114=NM_004369.3:c.6342G>A, NM_057164.3:c.5841G>A, NM_057165.3:c.5742G>A, NM_057166.3:c.5739G>A, NM_057166.4:c.4521G>A, NM_057167.3:c.5724G>A, XM_005246065.1:c.5742G>A, XM_005246066.1:c.5121G>A, XM_005246067.1:c.4521G>AVOUS02/16/2016
507COL6A3Ex19NM_004369.3:c.6354+1G>ALRG_473t1:c.6354+1G>A, NM_004369.3:c.6354+1G>A, NM_057164.3:c.5853+1G>A, NM_057165.3:c.5754+1G>A, NM_057166.3:c.5751+1G>A, NM_057166.4:c.4533+1G>A, NM_057167.3:c.5736+1G>A, XM_005246065.1:c.5754+1G>A, XM_005246066.1:c.5133+1G>A, XM_005246067.1:c.4533+1G>APathogenic01/08/2018 
508COL6A3Ex19NM_004369.3:c.6354+1G>TLRG_473t1:c.6354+1G>T, NM_004369.3:c.6354+1G>T, NM_057164.3:c.5853+1G>T, NM_057165.3:c.5754+1G>T, NM_057166.3:c.5751+1G>T, NM_057166.4:c.4533+1G>T, NM_057167.3:c.5736+1G>T, XM_005246065.1:c.5754+1G>T, XM_005246066.1:c.5133+1G>T, XM_005246067.1:c.4533+1G>TPathogenic05/10/2017 
509COL6A3Ex20NM_004369.3:c.6355-1G>ALRG_473t1:c.6355-1G>A, NM_004369.3:c.6355-1G>A, NM_057164.3:c.5854-1G>A, NM_057165.3:c.5755-1G>A, NM_057166.3:c.5752-1G>A, NM_057166.4:c.4534-1G>A, NM_057167.3:c.5737-1G>A, XM_005246065.1:c.5755-1G>A, XM_005246066.1:c.5134-1G>A, XM_005246067.1:c.4534-1G>ALikely pathogenic07/26/2016 
510COL6A3Ex20NM_004369.3:c.6369G>Ap.Leu2123= | p.L2123=Benign07/31/2012 
511COL6A3Ex20NM_004369.3:c.6372T>Cp.Pro2124= | p.P2124=LRG_473t1:c.6372T>C, NM_004369.3:c.6372T>C, NM_057164.3:c.5871T>C, NM_057165.3:c.5772T>C, NM_057166.3:c.5769T>C, NM_057166.4:c.4551T>C, NM_057167.3:c.5754T>C, XM_005246065.1:c.5772T>C, XM_005246066.1:c.5151T>C, XM_005246067.1:c.4551T>CVOUS06/25/2018
512COL6A3Ex20NM_004369.3:c.6408G>Cp.Arg2136Ser | p.R2136SLRG_473t1:c.6408G>C, NM_004369.3:c.6408G>C, NM_057164.3:c.5907G>C, NM_057165.3:c.5808G>C, NM_057166.3:c.5805G>C, NM_057166.4:c.4587G>C, NM_057167.3:c.5790G>C, XM_005246065.1:c.5808G>C, XM_005246066.1:c.5187G>C, XM_005246067.1:c.4587G>CVOUS12/27/2016
513COL6A3Ex20NM_004369.3:c.6408+44A>GBenign11/05/2012 
514COL6A3Ex21NM_004369.3:c.6425G>Ap.Arg2142Gln | p.R2142QLRG_473t1:c.6425G>A, NM_004369.3:c.6425G>A, NM_057164.3:c.5924G>A, NM_057165.3:c.5825G>A, NM_057166.3:c.5822G>A, NM_057166.4:c.4604G>A, NM_057167.3:c.5807G>A, XM_005246065.1:c.5825G>A, XM_005246066.1:c.5204G>A, XM_005246067.1:c.4604G>AVOUS12/06/2018
515COL6A3Ex21NM_004369.3:c.6451G>Cp.Val2151Leu | p.V2151LLRG_473t1:c.6451G>C, NM_004369.3:c.6451G>C, NM_057164.3:c.5950G>C, NM_057165.3:c.5851G>C, NM_057166.3:c.5848G>C, NM_057166.4:c.4630G>C, NM_057167.3:c.5833G>C, XM_005246065.1:c.5851G>C, XM_005246066.1:c.5230G>C, XM_005246067.1:c.4630G>CVOUS07/27/2017
516COL6A3Ex22NM_004369.3:c.6519C>Tp.Thr2173= | p.T2173=NM_004369.3:c.6519C>T, NM_057164.3:c.6018C>T, NM_057165.3:c.5919C>T, NM_057166.3:c.5916C>T, NM_057166.4:c.4698C>T, NM_057167.3:c.5901C>T, XM_005246065.1:c.5919C>T, XM_005246066.1:c.5298C>T, XM_005246067.1:c.4698C>TVOUS02/11/2016
517COL6A3Ex22NM_004369.3:c.6533C>Gp.Pro2178Arg | p.P2178RNM_004369.3:c.6533C>G, NM_057164.3:c.6032C>G, NM_057165.3:c.5933C>G, NM_057166.3:c.5930C>G, NM_057166.4:c.4712C>G, NM_057167.3:c.5915C>G, XM_005246065.1:c.5933C>G, XM_005246066.1:c.5312C>G, XM_005246067.1:c.4712C>GVOUS07/30/2015
518COL6A3Ex23NM_004369.3:c.6538-4C>TLRG_473t1:c.6538-4C>T, NM_004369.3:c.6538-4C>T, NM_057164.3:c.6037-4C>T, NM_057165.3:c.5938-4C>T, NM_057166.3:c.5935-4C>T, NM_057166.4:c.4717-4C>T, NM_057167.3:c.5920-4C>T, XM_005246065.1:c.5938-4C>T, XM_005246066.1:c.5317-4C>T, XM_005246067.1:c.4717-4C>TVOUS08/23/2016
519COL6A3Ex24NM_004369.3:c.6592-27delCBenign11/05/2012 
520COL6A3Ex24NM_004369.3:c.6618C>Tp.Pro2206= | p.P2206=NM_004369.3:c.6618C>T, NM_057164.3:c.6117C>T, NM_057165.3:c.6018C>T, NM_057166.3:c.6015C>T, NM_057166.4:c.4797C>T, NM_057167.3:c.6000C>T, XM_005246065.1:c.6018C>T, XM_005246066.1:c.5397C>T, XM_005246067.1:c.4797C>TBenign07/01/2015 
521COL6A3Ex24NM_004369.3:c.6622G>Tp.Ala2208Ser | p.A2208SVOUS11/05/2012
522COL6A3Ex25NM_004369.3:c.6628-47G>CVOUS11/05/2012
523COL6A3Ex25NM_004369.3:c.6639C>Tp.Gly2213= | p.G2213=LRG_473t1:c.6639C>T, NM_004369.3:c.6639C>T, NM_057164.3:c.6138C>T, NM_057165.3:c.6039C>T, NM_057166.3:c.6036C>T, NM_057166.4:c.4818C>T, NM_057167.3:c.6021C>T, XM_005246065.1:c.6039C>T, XM_005246066.1:c.5418C>T, XM_005246067.1:c.4818C>TVOUS04/19/2017
524COL6A3Ex25NM_004369.3:c.6639C>Ap.Gly2213= | p.G2213=LRG_473t1:c.6639C>A, NM_004369.3:c.6639C>A, NM_057164.3:c.6138C>A, NM_057165.3:c.6039C>A, NM_057166.3:c.6036C>A, NM_057166.4:c.4818C>A, NM_057167.3:c.6021C>A, XM_005246065.1:c.6039C>A, XM_005246066.1:c.5418C>A, XM_005246067.1:c.4818C>AVOUS07/27/2018
525COL6A3Ex25NM_004369.3:c.6640G>Ap.Gly2214Ser | p.G2214SLRG_473t1:c.6640G>A, NM_004369.3:c.6640G>A, NM_057164.3:c.6139G>A, NM_057165.3:c.6040G>A, NM_057166.3:c.6037G>A, NM_057166.4:c.4819G>A, NM_057167.3:c.6022G>A, XM_005246065.1:c.6040G>A, XM_005246066.1:c.5419G>A, XM_005246067.1:c.4819G>AVOUS06/27/2016
526COL6A3Ex25NM_004369.3:c.6653C>Tp.Pro2218Leu | p.P2218LBenign07/17/2012 
527COL6A3Ex25NM_004369.3:c.6654G>Ap.Pro2218= | p.P2218=NM_004369.3:c.6654G>A, NM_057164.3:c.6153G>A, NM_057165.3:c.6054G>A, NM_057166.3:c.6051G>A, NM_057166.4:c.4833G>A, NM_057167.3:c.6036G>A, XM_005246065.1:c.6054G>A, XM_005246066.1:c.5433G>A, XM_005246067.1:c.4833G>AVOUS08/18/2015
528COL6A3Ex25NM_004369.3:c.6677C>Tp.Thr2226Ile | p.T2226ILRG_473t1:c.6677C>T, NM_004369.3:c.6677C>T, NM_057164.3:c.6176C>T, NM_057165.3:c.6077C>T, NM_057166.3:c.6074C>T, NM_057166.4:c.4856C>T, NM_057167.3:c.6059C>T, XM_005246065.1:c.6077C>T, XM_005246066.1:c.5456C>T, XM_005246067.1:c.4856C>TVOUS05/31/2018
529COL6A3Ex26NM_004369.3:c.6749C>Tp.Pro2250Leu | p.P2250LLRG_473t1:c.6749C>T, NM_004369.3:c.6749C>T, NM_057164.3:c.6248C>T, NM_057165.3:c.6149C>T, NM_057166.3:c.6146C>T, NM_057166.4:c.4928C>T, NM_057167.3:c.6131C>T, XM_005246065.1:c.6149C>T, XM_005246066.1:c.5528C>T, XM_005246067.1:c.4928C>TVOUS02/03/2017
530COL6A3Ex26NM_004369.3:c.6751C>Tp.Arg2251Trp | p.R2251WLRG_473t1:c.6751C>T, NM_004369.3:c.6751C>T, NM_057164.3:c.6250C>T, NM_057165.3:c.6151C>T, NM_057166.3:c.6148C>T, NM_057166.4:c.4930C>T, NM_057167.3:c.6133C>TBenign07/15/2016 
531COL6A3Ex27NM_004369.3:c.6754-9C>GLRG_473t1:c.6754-9C>G, NM_004369.3:c.6754-9C>G, NM_057164.3:c.6253-9C>G, NM_057165.3:c.6154-9C>G, NM_057166.3:c.6151-9C>G, NM_057166.4:c.4933-9C>G, NM_057167.3:c.6136-9C>G, XM_005246065.1:c.6154-9C>G, XM_005246066.1:c.5533-9C>G, XM_005246067.1:c.4933-9C>GVOUS12/27/2016
532COL6A3Ex27NM_004369.3:c.6768C>Tp.Ala2256= | p.A2256=NM_004369.3:c.6768C>T, NM_057164.3:c.6267C>T, NM_057165.3:c.6168C>T, NM_057166.3:c.6165C>T, NM_057166.4:c.4947C>T, NM_057167.3:c.6150C>T, XM_005246065.1:c.6168C>T, XM_005246066.1:c.5547C>T, XM_005246067.1:c.4947C>TVOUS01/04/2016
533COL6A3Ex27NM_004369.3:c.6769G>Ap.Ala2257Thr | p.A2257TLRG_473t1:c.6769G>A, NM_004369.3:c.6769G>A, NM_057164.3:c.6268G>A, NM_057165.3:c.6169G>A, NM_057166.3:c.6166G>A, NM_057166.4:c.4948G>A, NM_057167.3:c.6151G>A, XM_005246065.1:c.6169G>A, XM_005246066.1:c.5548G>A, XM_005246067.1:c.4948G>AVOUS02/06/2017
534COL6A3Ex27NM_004369.3:c.6796A>Gp.Thr2266Ala | p.T2266ALRG_473t1:c.6796A>G, NM_004369.3:c.6796A>G, NM_057164.3:c.6295A>G, NM_057165.3:c.6196A>G, NM_057166.3:c.6193A>G, NM_057166.4:c.4975A>G, NM_057167.3:c.6178A>G, XM_005246065.1:c.6196A>G, XM_005246066.1:c.5575A>G, XM_005246067.1:c.4975A>GVOUS04/17/2017
535COL6A3Ex27NM_004369.3:c.6798C>Gp.Thr2266= | p.T2266=LRG_473t1:c.6798C>G, NM_004369.3:c.6798C>G, NM_057164.3:c.6297C>G, NM_057165.3:c.6198C>G, NM_057166.3:c.6195C>G, NM_057166.4:c.4977C>G, NM_057167.3:c.6180C>G, XM_005246065.1:c.6198C>G, XM_005246066.1:c.5577C>G, XM_005246067.1:c.4977C>GVOUS05/07/2018
536COL6A3Ex27NM_004369.3:c.6798C>Tp.Thr2266= | p.T2266=LRG_473t1:c.6798C>T, NM_004369.3:c.6798C>T, NM_057164.3:c.6297C>T, NM_057165.3:c.6198C>T, NM_057166.3:c.6195C>T, NM_057166.4:c.4977C>T, NM_057167.3:c.6180C>T, XM_005246065.1:c.6198C>T, XM_005246066.1:c.5577C>T, XM_005246067.1:c.4977C>TVOUS05/09/2017
537COL6A3Ex27NM_004369.3:c.6799G>Ap.Gly2267Ser | p.G2267SLRG_473t1:c.6799G>A, NM_004369.3:c.6799G>A, NM_057164.3:c.6298G>A, NM_057165.3:c.6199G>A, NM_057166.3:c.6196G>A, NM_057166.4:c.4978G>A, NM_057167.3:c.6181G>A, XM_005246065.1:c.6199G>A, XM_005246066.1:c.5578G>A, XM_005246067.1:c.4978G>ALikely pathogenic11/03/2016 
538COL6A3Ex28NM_004369.3:c.6817-6G>ANM_004369.3:c.6817-6G>A, NM_057164.3:c.6316-6G>A, NM_057165.3:c.6217-6G>A, NM_057166.3:c.6214-6G>A, NM_057166.4:c.4996-6G>A, NM_057167.3:c.6199-6G>A, XM_005246065.1:c.6217-6G>A, XM_005246066.1:c.5596-6G>A, XM_005246067.1:c.4996-6G>AVOUS11/11/2015
539COL6A3Ex28NM_004369.3:c.6817-5T>CNM_004369.3:c.6817-5T>C, NM_057164.3:c.6316-5T>C, NM_057165.3:c.6217-5T>C, NM_057166.3:c.6214-5T>C, NM_057166.4:c.4996-5T>C, NM_057167.3:c.6199-5T>C, XM_005246065.1:c.6217-5T>C, XM_005246066.1:c.5596-5T>C, XM_005246067.1:c.4996-5T>CVOUS06/03/2015
540COL6A3Ex28NM_004369.3:c.6852C>Tp.Ile2284= | p.I2284=LRG_473t1:c.6852C>T, NM_004369.3:c.6852C>T, NM_057164.3:c.6351C>T, NM_057165.3:c.6252C>T, NM_057166.3:c.6249C>T, NM_057166.4:c.5031C>T, NM_057167.3:c.6234C>T, XM_005246065.1:c.6252C>T, XM_005246066.1:c.5631C>T, XM_005246067.1:c.5031C>TVOUS02/15/2018
541COL6A3Ex28NM_004369.3:c.6855G>Cp.Gly2285= | p.G2285=LRG_473t1:c.6855G>C, NM_004369.3:c.6855G>C, NM_057164.3:c.6354G>C, NM_057165.3:c.6255G>C, NM_057166.3:c.6252G>C, NM_057166.4:c.5034G>C, NM_057167.3:c.6237G>CBenign04/27/2018 
542COL6A3Ex28NM_004369.3:c.6868C>Tp.Arg2290Cys | p.R2290CLRG_473t1:c.6868C>T, NM_004369.3:c.6868C>T, NM_057164.3:c.6367C>T, NM_057165.3:c.6268C>T, NM_057166.3:c.6265C>T, NM_057166.4:c.5047C>T, NM_057167.3:c.6250C>T, XM_005246065.1:c.6268C>T, XM_005246066.1:c.5647C>T, XM_005246067.1:c.5047C>TVOUS04/27/2018
543COL6A3Ex28NM_004369.3:c.6869G>Ap.Arg2290His | p.R2290HLRG_473t1:c.6869G>A, NM_004369.3:c.6869G>A, NM_057164.3:c.6368G>A, NM_057165.3:c.6269G>A, NM_057166.3:c.6266G>A, NM_057166.4:c.5048G>A, NM_057167.3:c.6251G>A, XM_005246065.1:c.6269G>A, XM_005246066.1:c.5648G>A, XM_005246067.1:c.5048G>AVOUS04/23/2018
544COL6A3Ex28NM_004369.3:c.6869G>Tp.Arg2290Leu | p.R2290LNM_004369.3:c.6869G>T, NM_057164.3:c.6368G>T, NM_057165.3:c.6269G>T, NM_057166.3:c.6266G>T, NM_057166.4:c.5048G>T, NM_057167.3:c.6251G>TVOUS10/07/2013
545COL6A3Ex28NM_004369.3:c.6871G>Tp.Gly2291Trp | p.G2291WLRG_473t1:c.6871G>T, NM_004369.3:c.6871G>T, NM_057164.3:c.6370G>T, NM_057165.3:c.6271G>T, NM_057166.3:c.6268G>T, NM_057166.4:c.5050G>T, NM_057167.3:c.6253G>T, XM_005246065.1:c.6271G>T, XM_005246066.1:c.5650G>T, XM_005246067.1:c.5050G>TVOUS06/13/2016
546COL6A3Ex28NM_004369.3:c.6879G>Ap.Thr2293= | p.T2293=LRG_473t1:c.6879G>A, NM_004369.3:c.6879G>A, NM_057164.3:c.6378G>A, NM_057165.3:c.6279G>A, NM_057166.3:c.6276G>A, NM_057166.4:c.5058G>A, NM_057167.3:c.6261G>A, XM_005246065.1:c.6279G>A, XM_005246066.1:c.5658G>A, XM_005246067.1:c.5058G>AVOUS02/15/2018
547COL6A3Ex28NM_004369.3:c.6879+49G>AVOUS11/05/2012
548COL6A3Ex29NM_004369.3:c.6880-47T>CBenign11/05/2012 
549COL6A3Ex29NM_004369.3:c.6890G>Cp.Gly2297Ala | p.G2297ALRG_473t1:c.6890G>C, NM_004369.3:c.6890G>C, NM_057164.3:c.6389G>C, NM_057165.3:c.6290G>C, NM_057166.3:c.6287G>C, NM_057166.4:c.5069G>C, NM_057167.3:c.6272G>C, XM_002342304.1:c.*4063C>G, XM_005246065.1:c.6290G>C, XM_005246066.1:c.5669G>C, XM_005246067.1:c.5069G>CLikely pathogenic03/29/2016 
550COL6A3Ex29NM_004369.3:c.6897C>Tp.Asp2299= | p.D2299=NM_004369.3:c.6897C>T, NM_057164.3:c.6396C>T, NM_057165.3:c.6297C>T, NM_057166.3:c.6294C>T, NM_057166.4:c.5076C>T, NM_057167.3:c.6279C>T, XM_002342304.1:c.*4056G>A, XM_005246065.1:c.6297C>T, XM_005246066.1:c.5676C>T, XM_005246067.1:c.5076C>TVOUS11/13/2015
551COL6A3Ex29NM_004369.3:c.6898G>Ap.Gly2300Arg | p.G2300RLRG_473t1:c.6898G>A, NM_004369.3:c.6898G>A, NM_057164.3:c.6397G>A, NM_057165.3:c.6298G>A, NM_057166.3:c.6295G>A, NM_057166.4:c.5077G>A, NM_057167.3:c.6280G>A, XM_002342304.1:c.*4055C>T, XM_005246065.1:c.6298G>A, XM_005246066.1:c.5677G>A, XM_005246067.1:c.5077G>AVOUS11/17/2015
552COL6A3Ex29NM_004369.3:c.6899G>Ap.Gly2300Glu | p.G2300ELRG_473t1:c.6899G>A, NM_004369.3:c.6899G>A, NM_057164.3:c.6398G>A, NM_057165.3:c.6299G>A, NM_057166.3:c.6296G>A, NM_057166.4:c.5078G>A, NM_057167.3:c.6281G>A, XM_002342304.1:c.*4054C>T, XM_005246065.1:c.6299G>A, XM_005246066.1:c.5678G>A, XM_005246067.1:c.5078G>AVOUS08/18/2016
553COL6A3Ex29NM_004369.3:c.6902T>Cp.Val2301Ala | p.V2301ALRG_473t1:c.6902T>C, NM_004369.3:c.6902T>C, NM_057164.3:c.6401T>C, NM_057165.3:c.6302T>C, NM_057166.3:c.6299T>C, NM_057166.4:c.5081T>C, NM_057167.3:c.6284T>C, XM_002342304.1:c.*4051A>G, XM_005246065.1:c.6302T>C, XM_005246066.1:c.5681T>C, XM_005246067.1:c.5081T>CVOUS11/07/2017
554COL6A3Ex29NM_004369.3:c.6930+4C>TLRG_473t1:c.6930+4C>T, NM_004369.3:c.6930+4C>T, NM_057164.3:c.6429+4C>T, NM_057165.3:c.6330+4C>T, NM_057166.3:c.6327+4C>T, NM_057166.4:c.5109+4C>T, NM_057167.3:c.6312+4C>T, XM_002342304.1:c.*4019G>A, XM_005246065.1:c.6330+4C>T, XM_005246066.1:c.5709+4C>T, XM_005246067.1:c.5109+4C>TVOUS09/01/2015
555COL6A3Ex29NM_004369.3:c.6930+28C>TBenign11/05/2012 
556COL6A3Ex29NM_004369.3:c.6930+43G>CBenign11/05/2012 
557COL6A3Ex30NM_004369.3:c.6945C>Tp.Phe2315= | p.F2315=LRG_473t1:c.6945C>T, NM_004369.3:c.6945C>T, NM_057164.3:c.6444C>T, NM_057165.3:c.6345C>T, NM_057166.3:c.6342C>T, NM_057166.4:c.5124C>T, NM_057167.3:c.6327C>T, XM_002342304.1:c.*3780G>A, XM_005246065.1:c.6345C>T, XM_005246066.1:c.5724C>T, XM_005246067.1:c.5124C>TBenign07/31/2012 
558COL6A3Ex30NM_004369.3:c.6957A>Gp.Pro2319= | p.P2319=LRG_473t1:c.6957A>G, NM_004369.3:c.6957A>G, NM_057164.3:c.6456A>G, NM_057165.3:c.6357A>G, NM_057166.3:c.6354A>G, NM_057166.4:c.5136A>G, NM_057167.3:c.6339A>G, XM_002342304.1:c.*3768T>C, XM_005246065.1:c.6357A>G, XM_005246066.1:c.5736A>G, XM_005246067.1:c.5136A>GVOUS04/28/2017
559COL6A3Ex30NM_004369.3:c.6966+4A>CLRG_473t1:c.6966+4A>C, NM_004369.3:c.6966+4A>C, NM_057164.3:c.6465+4A>C, NM_057165.3:c.6366+4A>C, NM_057166.3:c.6363+4A>C, NM_057166.4:c.5145+4A>C, NM_057167.3:c.6348+4A>C, XM_002342304.1:c.*3755T>G, XM_005246065.1:c.6366+4A>C, XM_005246066.1:c.5745+4A>C, XM_005246067.1:c.5145+4A>CVOUS08/18/2016
560COL6A3Ex30NM_004369.3:c.6966+10C>GLRG_473t1:c.6966+10C>G, NM_004369.3:c.6966+10C>G, NM_057164.3:c.6465+10C>G, NM_057165.3:c.6366+10C>G, NM_057166.3:c.6363+10C>G, NM_057166.4:c.5145+10C>G, NM_057167.3:c.6348+10C>G, XM_002342304.1:c.*3749G>C, XM_005246065.1:c.6366+10C>G, XM_005246066.1:c.5745+10C>G, XM_005246067.1:c.5145+10C>GVOUS10/26/2017
561COL6A3Ex31NM_004369.3:c.6972C>Ap.Asn2324Lys | p.N2324KLRG_473t1:c.6972C>A, NM_004369.3:c.6972C>A, NM_057164.3:c.6471C>A, NM_057165.3:c.6372C>A, NM_057166.3:c.6369C>A, NM_057166.4:c.5151C>A, NM_057167.3:c.6354C>A, XM_002342304.1:c.*3274G>T, XM_005246065.1:c.6372C>A, XM_005246066.1:c.5751C>A, XM_005246067.1:c.5151C>AVOUS05/04/2018
562COL6A3Ex31NM_004369.3:c.6972C>Tp.Asn2324= | p.N2324=Benign10/16/2012 
563COL6A3Ex31NM_004369.3:c.6973C>Ap.Pro2325Thr | p.P2325TLRG_473t1:c.6973C>A, NM_004369.3:c.6973C>A, NM_057164.3:c.6472C>A, NM_057165.3:c.6373C>A, NM_057166.3:c.6370C>A, NM_057166.4:c.5152C>A, NM_057167.3:c.6355C>A, XM_002342304.1:c.*3273G>T, XM_005246065.1:c.6373C>A, XM_005246066.1:c.5752C>A, XM_005246067.1:c.5152C>AVOUS08/08/2016
564COL6A3Ex31NM_004369.3:c.6981A>Gp.Glu2327= | p.E2327=Benign07/17/2012 
565COL6A3Ex31NM_004369.3:c.7007C>Tp.Pro2336Leu | p.P2336LNM_004369.3:c.7007C>T, NM_057164.3:c.6506C>T, NM_057165.3:c.6407C>T, NM_057166.3:c.6404C>T, NM_057166.4:c.5186C>T, NM_057167.3:c.6389C>T, XM_002342304.1:c.*3239G>ALikely benign07/28/2015 
566COL6A3Ex31NM_004369.3:c.7024C>Tp.Arg2342* | p.R2342XLRG_473t1:c.7024C>T, NM_004369.3:c.7024C>T, NM_057164.3:c.6523C>T, NM_057165.3:c.6424C>T, NM_057166.3:c.6421C>T, NM_057166.4:c.5203C>T, NM_057167.3:c.6406C>T, XM_002342304.1:c.*3222G>A, XM_005246065.1:c.6424C>T, XM_005246066.1:c.5803C>T, XM_005246067.1:c.5203C>TPathogenic01/29/2016 
567COL6A3Ex31NM_004369.3:c.7029+3A>GLRG_473t1:c.7029+3A>G, NM_004369.3:c.7029+3A>G, NM_057164.3:c.6528+3A>G, NM_057165.3:c.6429+3A>G, NM_057166.3:c.6426+3A>G, NM_057166.4:c.5208+3A>G, NM_057167.3:c.6411+3A>G, XM_002342304.1:c.*3214T>C, XM_005246065.1:c.6429+3A>G, XM_005246066.1:c.5808+3A>G, XM_005246067.1:c.5208+3A>GVOUS08/25/2016
568COL6A3Ex31NM_004369.3:c.7029+10C>TLRG_473t1:c.7029+10C>T, NM_004369.3:c.7029+10C>T, NM_057164.3:c.6528+10C>T, NM_057165.3:c.6429+10C>T, NM_057166.3:c.6426+10C>T, NM_057166.4:c.5208+10C>T, NM_057167.3:c.6411+10C>T, XM_002342304.1:c.*3207G>A, XM_005246065.1:c.6429+10C>T, XM_005246066.1:c.5808+10C>T, XM_005246067.1:c.5208+10C>TVOUS10/18/2017
569COL6A3Ex32NM_004369.3:c.7030-4C>GNM_004369.3:c.7030-4C>G, NM_057164.3:c.6529-4C>G, NM_057165.3:c.6430-4C>G, NM_057166.3:c.6427-4C>G, NM_057166.4:c.5209-4C>G, NM_057167.3:c.6412-4C>G, XM_002342304.1:c.*1979G>C, XM_005246065.1:c.6430-4C>G, XM_005246066.1:c.5809-4C>G, XM_005246067.1:c.5209-4C>GVOUS08/26/2015
570COL6A3Ex32NM_004369.3:c.7031G>Ap.Gly2344Glu | p.G2344ELRG_473t1:c.7031G>A, NM_004369.3:c.7031G>A, NM_057164.3:c.6530G>A, NM_057165.3:c.6431G>A, NM_057166.3:c.6428G>A, NM_057166.4:c.5210G>A, NM_057167.3:c.6413G>A, XM_002342304.1:c.*1974C>T, XM_005246065.1:c.6431G>A, XM_005246066.1:c.5810G>A, XM_005246067.1:c.5210G>AVOUS10/23/2017
571COL6A3Ex32NM_004369.3:c.7045C>Tp.Pro2349Ser | p.P2349SLRG_473t1:c.7045C>T, NM_004369.3:c.7045C>T, NM_057164.3:c.6544C>T, NM_057165.3:c.6445C>T, NM_057166.3:c.6442C>T, NM_057166.4:c.5224C>T, NM_057167.3:c.6427C>T, XM_002342304.1:c.*1960G>A, XM_005246065.1:c.6445C>T, XM_005246066.1:c.5824C>T, XM_005246067.1:c.5224C>TVOUS08/30/2016
572COL6A3Ex32NM_004369.3:c.7086A>Cp.Gly2362= | p.G2362=Benign07/17/2012 
573COL6A3Ex32NM_004369.3:c.7092+26G>ABenign11/05/2012 
574COL6A3Ex33NM_004369.3:c.7113C>Tp.Gly2371= | p.G2371=LRG_473t1:c.7113C>T, NM_004369.3:c.7113C>T, NM_057164.3:c.6612C>T, NM_057165.3:c.6513C>T, NM_057166.3:c.6510C>T, NM_057166.4:c.5292C>T, NM_057167.3:c.6495C>T, XM_002342304.1:c.*603G>A, XM_005246065.1:c.6513C>T, XM_005246066.1:c.5892C>T, XM_005246067.1:c.5292C>TVOUS06/15/2017
575COL6A3Ex33NM_004369.3:c.7114G>Ap.Asp2372Asn | p.D2372NLRG_473t1:c.7114G>A, NM_004369.3:c.7114G>A, NM_057164.3:c.6613G>A, NM_057165.3:c.6514G>A, NM_057166.3:c.6511G>A, NM_057166.4:c.5293G>A, NM_057167.3:c.6496G>A, XM_002342304.1:c.*602C>T, XM_005246065.1:c.6514G>A, XM_005246066.1:c.5893G>A, XM_005246067.1:c.5293G>AVOUS02/07/2017
576COL6A3Ex33NM_004369.3:c.7123G>Ap.Asp2375Asn | p.D2375NNM_004369.3:c.7123G>A, NM_057164.3:c.6622G>A, NM_057165.3:c.6523G>A, NM_057166.3:c.6520G>A, NM_057166.4:c.5302G>A, NM_057167.3:c.6505G>A, XM_002342304.1:c.*593C>T, XM_005246065.1:c.6523G>A, XM_005246066.1:c.5902G>A, XM_005246067.1:c.5302G>AVOUS10/30/2015
577COL6A3Ex34NM_004369.3:c.7158A>Gp.Lys2386= | p.K2386=LRG_473t1:c.7158A>G, NM_004369.3:c.7158A>G, NM_057164.3:c.6657A>G, NM_057165.3:c.6558A>G, NM_057166.3:c.6555A>G, NM_057166.4:c.5337A>G, NM_057167.3:c.6540A>G, XM_002342304.1:c.*472T>C, XM_005246065.1:c.6558A>G, XM_005246066.1:c.5937A>G, XM_005246067.1:c.5337A>GVOUS04/12/2021
578COL6A3Ex34NM_004369.3:c.7162+48G>ABenign11/05/2012 
579COL6A3Ex35NM_004369.3:c.7173C>Tp.Tyr2391= | p.Y2391=LRG_473t1:c.7173C>T, NM_004369.3:c.7173C>T, NM_057164.3:c.6672C>T, NM_057165.3:c.6573C>T, NM_057166.3:c.6570C>T, NM_057166.4:c.5352C>T, NM_057167.3:c.6555C>T, XM_002342304.1:c.*352G>A, XM_005246065.1:c.6573C>T, XM_005246066.1:c.5952C>T, XM_005246067.1:c.5352C>TVOUS02/06/2018
580COL6A3Ex35NM_004369.3:c.7174G>Ap.Gly2392Arg | p.G2392RLRG_473t1:c.7174G>A, NM_004369.3:c.7174G>A, NM_057164.3:c.6673G>A, NM_057165.3:c.6574G>A, NM_057166.3:c.6571G>A, NM_057166.4:c.5353G>A, NM_057167.3:c.6556G>A, XM_002342304.1:c.*351C>T, XM_005246065.1:c.6574G>A, XM_005246066.1:c.5953G>A, XM_005246067.1:c.5353G>AVOUS12/31/2015
581COL6A3Ex35NM_004369.3:c.7174+4A>CVOUS02/06/2013
582COL6A3Ex36NM_004369.3:c.7175-32G>ABenign11/05/2012 
583COL6A3Ex36NM_004369.3:c.7175-6C>GLRG_473t1:c.7175-6C>G, NM_004369.3:c.7175-6C>G, NM_057164.3:c.6674-6C>G, NM_057165.3:c.6575-6C>G, NM_057166.3:c.6572-6C>G, NM_057166.4:c.5354-6C>G, NM_057167.3:c.6557-6C>G, XM_002342304.1:c.*259G>C, XM_005246065.1:c.6575-6C>G, XM_005246066.1:c.5954-6C>G, XM_005246067.1:c.5354-6C>GVOUS12/25/2016
584COL6A3Ex36NM_004369.3:c.7175-6C>ANM_004369.3:c.7175-6C>A, NM_057164.3:c.6674-6C>A, NM_057165.3:c.6575-6C>A, NM_057166.3:c.6572-6C>A, NM_057166.4:c.5354-6C>A, NM_057167.3:c.6557-6C>A, XM_002342304.1:c.*259G>T, XM_005246065.1:c.6575-6C>A, XM_005246066.1:c.5954-6C>A, XM_005246067.1:c.5354-6C>AVOUS01/08/2016
585COL6A3Ex36NM_004369.3:c.7224C>Gp.Asp2408Glu | p.D2408ENM_004369.3:c.7224C>G, NM_057164.3:c.6723C>G, NM_057165.3:c.6624C>G, NM_057166.3:c.6621C>G, NM_057166.4:c.5403C>G, NM_057167.3:c.6606C>G, XM_002342304.1:c.*204G>C, XM_005246065.1:c.6624C>G, XM_005246066.1:c.6003C>G, XM_005246067.1:c.5403C>GVOUS10/17/2014
586COL6A3Ex36NM_004369.3:c.7255G>Ap.Gly2419Ser | p.G2419SLRG_473t1:c.7255G>A, NM_004369.3:c.7255G>A, NM_057164.3:c.6754G>A, NM_057165.3:c.6655G>A, NM_057166.3:c.6652G>A, NM_057166.4:c.5434G>A, NM_057167.3:c.6637G>A, XM_002342304.1:c.*173C>T, XM_005246065.1:c.6655G>A, XM_005246066.1:c.6034G>A, XM_005246067.1:c.5434G>AVOUS10/05/2018
587COL6A3Ex36NM_004369.3:c.7258C>Tp.Arg2420Trp | p.R2420WLRG_473t1:c.7258C>T, NM_004369.3:c.7258C>T, NM_057164.3:c.6757C>T, NM_057165.3:c.6658C>T, NM_057166.3:c.6655C>T, NM_057166.4:c.5437C>T, NM_057167.3:c.6640C>T, XM_002342304.1:c.*170G>A, XM_005246065.1:c.6658C>T, XM_005246066.1:c.6037C>T, XM_005246067.1:c.5437C>TVOUS11/06/2018
588COL6A3Ex36NM_004369.3:c.7264C>Gp.Arg2422Gly | p.R2422GLRG_473t1:c.7264C>G, NM_004369.3:c.7264C>G, NM_057164.3:c.6763C>G, NM_057165.3:c.6664C>G, NM_057166.3:c.6661C>G, NM_057166.4:c.5443C>G, NM_057167.3:c.6646C>G, XM_002342304.1:c.*164G>C, XM_005246065.1:c.6664C>G, XM_005246066.1:c.6043C>G, XM_005246067.1:c.5443C>GVOUS08/31/2016
589COL6A3Ex36NM_004369.3:c.7265G>Ap.Arg2422Gln | p.R2422QLRG_473t1:c.7265G>A, NM_004369.3:c.7265G>A, NM_057164.3:c.6764G>A, NM_057165.3:c.6665G>A, NM_057166.3:c.6662G>A, NM_057166.4:c.5444G>A, NM_057167.3:c.6647G>A, XM_002342304.1:c.*163C>T, XM_005246065.1:c.6665G>A, XM_005246066.1:c.6044G>A, XM_005246067.1:c.5444G>AVOUS04/04/2017
590COL6A3Ex36NM_004369.3:c.7329C>Tp.Ala2443= | p.A2443=NM_004369.3:c.7329C>T, NM_057164.3:c.6828C>T, NM_057165.3:c.6729C>T, NM_057166.3:c.6726C>T, NM_057166.4:c.5508C>T, NM_057167.3:c.6711C>T, XM_002342304.1:c.*99G>ABenign07/17/2012 
591COL6A3Ex36NM_004369.3:c.7342G>Tp.Val2448Phe | p.V2448FLRG_473t1:c.7342G>T, NM_004369.3:c.7342G>T, NM_057164.3:c.6841G>T, NM_057165.3:c.6742G>T, NM_057166.3:c.6739G>T, NM_057166.4:c.5521G>T, NM_057167.3:c.6724G>T, XM_002342304.1:c.*86C>A, XM_005246065.1:c.6742G>T, XM_005246066.1:c.6121G>T, XM_005246067.1:c.5521G>TVOUS03/14/2017
592COL6A3Ex36NM_004369.3:c.7357G>Ap.Glu2453Lys | p.E2453KLRG_473t1:c.7357G>A, NM_004369.3:c.7357G>A, NM_057164.3:c.6856G>A, NM_057165.3:c.6757G>A, NM_057166.3:c.6754G>A, NM_057166.4:c.5536G>A, NM_057167.3:c.6739G>A, XM_002342304.1:c.*71C>T, XM_005246065.1:c.6757G>A, XM_005246066.1:c.6136G>A, XM_005246067.1:c.5536G>AVOUS08/08/2016
593COL6A3Ex36NM_004369.3:c.7359G>Ap.Glu2453= | p.E2453=LRG_473t1:c.7359G>A, NM_004369.3:c.7359G>A, NM_057164.3:c.6858G>A, NM_057165.3:c.6759G>A, NM_057166.3:c.6756G>A, NM_057166.4:c.5538G>A, NM_057167.3:c.6741G>A, XM_002342304.1:c.*69C>T, XM_005246065.1:c.6759G>A, XM_005246066.1:c.6138G>A, XM_005246067.1:c.5538G>ABenign06/16/2016 
594COL6A3Ex36NM_004369.3:c.7368G>Ap.Thr2456= | p.T2456=LRG_473t1:c.7368G>A, NM_004369.3:c.7368G>A, NM_057164.3:c.6867G>A, NM_057165.3:c.6768G>A, NM_057166.3:c.6765G>A, NM_057166.4:c.5547G>A, NM_057167.3:c.6750G>A, XM_002342304.1:c.*60C>T, XM_005246065.1:c.6768G>A, XM_005246066.1:c.6147G>A, XM_005246067.1:c.5547G>AVOUS07/27/2016
595COL6A3Ex36NM_004369.3:c.7375C>Tp.Arg2459Trp | p.R2459WLRG_473t1:c.7375C>T, NM_004369.3:c.7375C>T, NM_057164.3:c.6874C>T, NM_057165.3:c.6775C>T, NM_057166.3:c.6772C>T, NM_057166.4:c.5554C>T, NM_057167.3:c.6757C>T, XM_002342304.1:c.*53G>A, XM_005246065.1:c.6775C>T, XM_005246066.1:c.6154C>T, XM_005246067.1:c.5554C>TVOUS08/25/2017
596COL6A3Ex36NM_004369.3:c.7376G>Ap.Arg2459Gln | p.R2459QLRG_473t1:c.7376G>A, NM_004369.3:c.7376G>A, NM_057164.3:c.6875G>A, NM_057165.3:c.6776G>A, NM_057166.3:c.6773G>A, NM_057166.4:c.5555G>A, NM_057167.3:c.6758G>A, XM_002342304.1:c.*52C>T, XM_005246065.1:c.6776G>A, XM_005246066.1:c.6155G>A, XM_005246067.1:c.5555G>AVOUS01/16/2017
597COL6A3Ex36NM_004369.3:c.7398G>Ap.Lys2466= | p.K2466=LRG_473t1:c.7398G>A, NM_004369.3:c.7398G>A, NM_057164.3:c.6897G>A, NM_057165.3:c.6798G>A, NM_057166.3:c.6795G>A, NM_057166.4:c.5577G>A, NM_057167.3:c.6780G>A, XM_002342304.1:c.*30C>T, XM_005246065.1:c.6798G>A, XM_005246066.1:c.6177G>A, XM_005246067.1:c.5577G>AVOUS05/11/2016
598COL6A3Ex36NM_004369.3:c.7400C>Tp.Ser2467Leu | p.S2467LBenign11/05/2012 
599COL6A3Ex36NM_004369.3:c.7401G>Ap.Ser2467= | p.S2467=LRG_473t1:c.7401G>A, NM_004369.3:c.7401G>A, NM_057164.3:c.6900G>A, NM_057165.3:c.6801G>A, NM_057166.3:c.6798G>A, NM_057166.4:c.5580G>A, NM_057167.3:c.6783G>A, XM_002342304.1:c.*27C>TVOUS02/11/2016
600COL6A3Ex36NM_004369.3:c.7425C>Ap.Asn2475Lys | p.N2475KLRG_473t1:c.7425C>A, NM_004369.3:c.7425C>A, NM_057164.3:c.6924C>A, NM_057165.3:c.6825C>A, NM_057166.3:c.6822C>A, NM_057166.4:c.5604C>A, NM_057167.3:c.6807C>A, XM_002342304.1:c.*3G>T, XM_005246065.1:c.6825C>A, XM_005246066.1:c.6204C>A, XM_005246067.1:c.5604C>AVOUS10/18/2016
601COL6A3Ex36NM_004369.3:c.7441A>Gp.Thr2481Ala | p.T2481ALRG_473t1:c.7441A>G, NM_004369.3:c.7441A>G, NM_057164.3:c.6940A>G, NM_057165.3:c.6841A>G, NM_057166.3:c.6838A>G, NM_057166.4:c.5620A>G, NM_057167.3:c.6823A>G, XM_002342304.1:c.320T>C, XM_005246065.1:c.6841A>G, XM_005246066.1:c.6220A>G, XM_005246067.1:c.5620A>GVOUS05/14/2018
602COL6A3Ex36NM_004369.3:c.7446C>Gp.Ser2482= | p.S2482=LRG_473t1:c.7446C>G, NM_004369.3:c.7446C>G, NM_057164.3:c.6945C>G, NM_057165.3:c.6846C>G, NM_057166.3:c.6843C>G, NM_057166.4:c.5625C>G, NM_057167.3:c.6828C>G, XM_002342304.1:c.315G>C, XM_005246065.1:c.6846C>G, XM_005246066.1:c.6225C>G, XM_005246067.1:c.5625C>GVOUS06/13/2017
603COL6A3Ex36NM_004369.3:c.7447A>Gp.Lys2483Glu | p.K2483ELRG_473t1:c.7447A>G, NM_004369.3:c.7447A>G, NM_057164.3:c.6946A>G, NM_057165.3:c.6847A>G, NM_057166.3:c.6844A>G, NM_057166.4:c.5626A>G, NM_057167.3:c.6829A>G, XM_002342304.1:c.314T>C, XM_005246065.1:c.6847A>G, XM_005246066.1:c.6226A>G, XM_005246067.1:c.5626A>GPathogenic03/21/2018 
604COL6A3Ex36NM_004369.3:c.7461G>Ap.Leu2487= | p.L2487=LRG_473t1:c.7461G>A, NM_004369.3:c.7461G>A, NM_057164.3:c.6960G>A, NM_057165.3:c.6861G>A, NM_057166.3:c.6858G>A, NM_057166.4:c.5640G>A, NM_057167.3:c.6843G>A, XM_002342304.1:c.300C>T, XM_005246065.1:c.6861G>A, XM_005246066.1:c.6240G>A, XM_005246067.1:c.5640G>AVOUS08/08/2016
605COL6A3Ex36NM_004369.3:c.7480G>Tp.Val2494Leu | p.V2494LLRG_473t1:c.7480G>T, NM_004369.3:c.7480G>T, NM_057164.3:c.6979G>T, NM_057165.3:c.6880G>T, NM_057166.3:c.6877G>T, NM_057166.4:c.5659G>T, NM_057167.3:c.6862G>T, XM_002342304.1:c.281C>A, XM_005246065.1:c.6880G>T, XM_005246066.1:c.6259G>T, XM_005246067.1:c.5659G>TVOUS07/06/2016
606COL6A3Ex36NM_004369.3:c.7509G>Ap.Arg2503= | p.R2503=Benign09/19/2012 
607COL6A3Ex36NM_004369.3:c.7512C>Tp.Asn2504= | p.N2504=NM_004369.3:c.7512C>T, NM_057164.3:c.7011C>T, NM_057165.3:c.6912C>T, NM_057166.3:c.6909C>T, NM_057166.4:c.5691C>T, NM_057167.3:c.6894C>T, XM_002342304.1:c.249G>A, XM_005246065.1:c.6912C>T, XM_005246066.1:c.6291C>T, XM_005246067.1:c.5691C>TBenign07/31/2012 
608COL6A3Ex36NM_004369.3:c.7513G>Ap.Gly2505Arg | p.G2505RLRG_473t1:c.7513G>A, NM_004369.3:c.7513G>A, NM_057164.3:c.7012G>A, NM_057165.3:c.6913G>A, NM_057166.3:c.6910G>A, NM_057166.4:c.5692G>A, NM_057167.3:c.6895G>A, XM_002342304.1:c.248C>T, XM_005246065.1:c.6913G>A, XM_005246066.1:c.6292G>A, XM_005246067.1:c.5692G>AVOUS09/23/2016
609COL6A3Ex36NM_004369.3:c.7514G>Tp.Gly2505Val | p.G2505VLRG_473t1:c.7514G>T, NM_004369.3:c.7514G>T, NM_057164.3:c.7013G>T, NM_057165.3:c.6914G>T, NM_057166.3:c.6911G>T, NM_057166.4:c.5693G>T, NM_057167.3:c.6896G>T, XM_002342304.1:c.247C>A, XM_005246065.1:c.6914G>T, XM_005246066.1:c.6293G>T, XM_005246067.1:c.5693G>TVOUS05/18/2016
610COL6A3Ex36NM_004369.3:c.7542delCLRG_473t1:c.7542delC, NM_004369.3:c.7542delC, NM_057164.3:c.7041delC, NM_057165.3:c.6942delC, NM_057166.3:c.6939delC, NM_057166.4:c.5721delC, NM_057167.3:c.6924delC, XM_002342304.1:c.219delG, XM_005246065.1:c.6942delC, XM_005246066.1:c.6321delC, XM_005246067.1:c.5721delCPathogenic03/18/2016 
611COL6A3Ex36NM_004369.3:c.7551C>Tp.Asn2517= | p.N2517=NM_004369.3:c.7551C>T, NM_057164.3:c.7050C>T, NM_057165.3:c.6951C>T, NM_057166.3:c.6948C>T, NM_057166.4:c.5730C>T, NM_057167.3:c.6933C>T, XM_002342304.1:c.210G>A, XM_005246065.1:c.6951C>T, XM_005246066.1:c.6330C>T, XM_005246067.1:c.5730C>TVOUS02/10/2016
612COL6A3Ex36NM_004369.3:c.7558A>Tp.Thr2520Ser | p.T2520SLRG_473t1:c.7558A>T, NM_004369.3:c.7558A>T, NM_057164.3:c.7057A>T, NM_057165.3:c.6958A>T, NM_057166.3:c.6955A>T, NM_057166.4:c.5737A>T, NM_057167.3:c.6940A>T, XM_002342304.1:c.203T>A, XM_005246065.1:c.6958A>T, XM_005246066.1:c.6337A>T, XM_005246067.1:c.5737A>TVOUS05/24/2016
613COL6A3Ex36NM_004369.3:c.7575G>Ap.Gln2525= | p.Q2525=LRG_473t1:c.7575G>A, NM_004369.3:c.7575G>A, NM_057164.3:c.7074G>A, NM_057165.3:c.6975G>A, NM_057166.3:c.6972G>A, NM_057166.4:c.5754G>A, NM_057167.3:c.6957G>A, XM_002342304.1:c.186C>T, XM_005246065.1:c.6975G>A, XM_005246066.1:c.6354G>A, XM_005246067.1:c.5754G>AVOUS06/20/2016
614COL6A3Ex36NM_004369.3:c.7587T>Cp.Ala2529= | p.A2529=LRG_473t1:c.7587T>C, NM_004369.3:c.7587T>C, NM_057164.3:c.7086T>C, NM_057165.3:c.6987T>C, NM_057166.3:c.6984T>C, NM_057166.4:c.5766T>C, NM_057167.3:c.6969T>C, XM_002342304.1:c.174A>G, XM_005246065.1:c.6987T>C, XM_005246066.1:c.6366T>C, XM_005246067.1:c.5766T>CVOUS01/25/2018
615COL6A3Ex36NM_004369.3:c.7590G>Ap.Val2530= | p.V2530=LRG_473t1:c.7590G>A, NM_004369.3:c.7590G>A, NM_057164.3:c.7089G>A, NM_057165.3:c.6990G>A, NM_057166.3:c.6987G>A, NM_057166.4:c.5769G>A, NM_057167.3:c.6972G>A, XM_002342304.1:c.171C>T, XM_005246065.1:c.6990G>A, XM_005246066.1:c.6369G>A, XM_005246067.1:c.5769G>AVOUS02/13/2018
616COL6A3Ex36NM_004369.3:c.7596G>Ap.Lys2532= | p.K2532=LRG_473t1:c.7596G>A, NM_004369.3:c.7596G>A, NM_057164.3:c.7095G>A, NM_057165.3:c.6996G>A, NM_057166.3:c.6993G>A, NM_057166.4:c.5775G>A, NM_057167.3:c.6978G>A, XM_002342304.1:c.165C>TBenign08/07/2012 
617COL6A3Ex36NM_004369.3:c.7607C>Tp.Ala2536Val | p.A2536VLRG_473t1:c.7607C>T, NM_004369.3:c.7607C>T, NM_057164.3:c.7106C>T, NM_057165.3:c.7007C>T, NM_057166.3:c.7004C>T, NM_057166.4:c.5786C>T, NM_057167.3:c.6989C>T, XM_002342304.1:c.154G>A, XM_005246065.1:c.7007C>T, XM_005246066.1:c.6386C>T, XM_005246067.1:c.5786C>TVOUS01/06/2017
618COL6A3Ex36NM_004369.3:c.7645C>Ap.Arg2549= | p.R2549=LRG_473t1:c.7645C>A, NM_004369.3:c.7645C>A, NM_057164.3:c.7144C>A, NM_057165.3:c.7045C>A, NM_057166.3:c.7042C>A, NM_057166.4:c.5824C>A, NM_057167.3:c.7027C>A, XM_002342304.1:c.116G>T, XM_005246065.1:c.7045C>A, XM_005246066.1:c.6424C>A, XM_005246067.1:c.5824C>AVOUS10/29/2015
619COL6A3Ex36NM_004369.3:c.7645C>Tp.Arg2549Trp | p.R2549WNM_004369.3:c.7645C>T, NM_057164.3:c.7144C>T, NM_057165.3:c.7045C>T, NM_057166.3:c.7042C>T, NM_057166.4:c.5824C>T, NM_057167.3:c.7027C>T, XM_002342304.1:c.116G>ABenign12/11/2014 
620COL6A3Ex36NM_004369.3:c.7668+21G>CBenign11/02/2012 
621COL6A3Ex37NM_004369.3:c.7669-35C>TBenign11/05/2012 
622COL6A3Ex37NM_004369.3:c.7669-2delALikely pathogenic05/24/2021 
623COL6A3Ex37NM_004369.3:c.7685T>Cp.Val2562Ala | p.V2562ALRG_473t1:c.7685T>C, NM_004369.3:c.7685T>C, NM_057164.3:c.7184T>C, NM_057165.3:c.7085T>C, NM_057166.3:c.7082T>C, NM_057166.4:c.5864T>C, NM_057167.3:c.7067T>C, XM_002342304.1:c.71A>G, XM_005246065.1:c.7085T>C, XM_005246066.1:c.6464T>C, XM_005246067.1:c.5864T>CVOUS08/31/2018
624COL6A3Ex37NM_004369.3:c.7687G>Cp.Gly2563Arg | p.G2563RLRG_473t1:c.7687G>C, NM_004369.3:c.7687G>C, NM_057164.3:c.7186G>C, NM_057165.3:c.7087G>C, NM_057166.3:c.7084G>C, NM_057166.4:c.5866G>C, NM_057167.3:c.7069G>C, XM_002342304.1:c.69C>G, XM_005246065.1:c.7087G>C, XM_005246066.1:c.6466G>C, XM_005246067.1:c.5866G>CVOUS05/23/2017
625COL6A3Ex37NM_004369.3:c.7695G>Tp.Ala2565= | p.A2565=LRG_473t1:c.7695G>T, NM_004369.3:c.7695G>T, NM_057164.3:c.7194G>T, NM_057165.3:c.7095G>T, NM_057166.3:c.7092G>T, NM_057166.4:c.5874G>T, NM_057167.3:c.7077G>T, XM_002342304.1:c.61C>A, XM_005246065.1:c.7095G>T, XM_005246066.1:c.6474G>T, XM_005246067.1:c.5874G>TVOUS03/01/2018
626COL6A3Ex37NM_004369.3:c.7702C>Tp.Leu2568= | p.L2568=LRG_473t1:c.7702C>T, NM_004369.3:c.7702C>T, NM_057164.3:c.7201C>T, NM_057165.3:c.7102C>T, NM_057166.3:c.7099C>T, NM_057166.4:c.5881C>T, NM_057167.3:c.7084C>T, XM_002342304.1:c.54G>A, XM_005246065.1:c.7102C>T, XM_005246066.1:c.6481C>T, XM_005246067.1:c.5881C>TVOUS11/10/2017
627COL6A3Ex37NM_004369.3:c.7706C>Gp.Pro2569Arg | p.P2569RNM_004369.3:c.7706C>G, NM_057164.3:c.7205C>G, NM_057165.3:c.7106C>G, NM_057166.3:c.7103C>G, NM_057166.4:c.5885C>G, NM_057167.3:c.7088C>G, XM_002342304.1:c.50G>C, XM_005246065.1:c.7106C>G, XM_005246066.1:c.6485C>G, XM_005246067.1:c.5885C>GVOUS03/09/2015
628COL6A3Ex37NM_004369.3:c.7728C>Tp.Asp2576= | p.D2576=LRG_473t1:c.7728C>T, NM_004369.3:c.7728C>T, NM_057164.3:c.7227C>T, NM_057165.3:c.7128C>T, NM_057166.3:c.7125C>T, NM_057166.4:c.5907C>T, NM_057167.3:c.7110C>T, XM_002342304.1:c.28G>A, XM_005246065.1:c.7128C>T, XM_005246066.1:c.6507C>T, XM_005246067.1:c.5907C>TVOUS06/02/2016
629COL6A3Ex37NM_004369.3:c.7749G>Ap.Thr2583= | p.T2583=LRG_473t1:c.7749G>A, NM_004369.3:c.7749G>A, NM_057164.3:c.7248G>A, NM_057165.3:c.7149G>A, NM_057166.3:c.7146G>A, NM_057166.4:c.5928G>A, NM_057167.3:c.7131G>A, XM_002342304.1:c.7C>T, XM_005246065.1:c.7149G>A, XM_005246066.1:c.6528G>A, XM_005246067.1:c.5928G>AVOUS01/19/2017
630COL6A3Ex37NM_004369.3:c.7754A>Gp.His2585Arg | p.H2585RNM_004369.3:c.7754A>G, NM_057164.3:c.7253A>G, NM_057165.3:c.7154A>G, NM_057166.3:c.7151A>G, NM_057166.4:c.5933A>G, NM_057167.3:c.7136A>G, XM_002342304.1:c.2T>C, XM_005246065.1:c.7154A>G, XM_005246066.1:c.6533A>G, XM_005246067.1:c.5933A>GVOUS12/09/2015
631COL6A3Ex37NM_004369.3:c.7755T>Cp.His2585= | p.H2585=LRG_473t1:c.7755T>C, NM_004369.3:c.7755T>C, NM_057164.3:c.7254T>C, NM_057165.3:c.7155T>C, NM_057166.3:c.7152T>C, NM_057166.4:c.5934T>C, NM_057167.3:c.7137T>C, XM_002342304.1:c.1A>G, XM_005246065.1:c.7155T>C, XM_005246066.1:c.6534T>C, XM_005246067.1:c.5934T>CVOUS01/18/2017
632COL6A3Ex38NM_004369.3:c.7768A>Gp.Ile2590Val | p.I2590VNM_004369.3:c.7768A>G, NM_057164.3:c.7267A>G, NM_057165.3:c.7168A>G, NM_057166.3:c.7165A>G, NM_057166.4:c.5947A>G, NM_057167.3:c.7150A>G, XM_002342304.1:c.-16T>C, XM_005246065.1:c.7168A>G, XM_005246066.1:c.6547A>G, XM_005246067.1:c.5947A>GVOUS01/04/2016
633COL6A3Ex38NM_004369.3:c.7777A>Tp.Ile2593Phe | p.I2593FLRG_473t1:c.7777A>T, NM_004369.3:c.7777A>T, NM_057164.3:c.7276A>T, NM_057165.3:c.7177A>T, NM_057166.3:c.7174A>T, NM_057166.4:c.5956A>T, NM_057167.3:c.7159A>T, XM_002342304.1:c.-25T>A, XM_005246065.1:c.7177A>T, XM_005246066.1:c.6556A>T, XM_005246067.1:c.5956A>TVOUS05/19/2016
634COL6A3Ex38NM_004369.3:c.7779C>Tp.Ile2593= | p.I2593=LRG_473t1:c.7779C>T, NM_004369.3:c.7779C>T, NM_057164.3:c.7278C>T, NM_057165.3:c.7179C>T, NM_057166.3:c.7176C>T, NM_057166.4:c.5958C>T, NM_057167.3:c.7161C>T, XM_002342304.1:c.-27G>A, XM_005246065.1:c.7179C>T, XM_005246066.1:c.6558C>T, XM_005246067.1:c.5958C>TLikely benign09/21/2016 
635COL6A3Ex38NM_004369.3:c.7796_7797delTTp.Phe2599Trpfs*29 | p.F2599WfsX29LRG_473t1:c.7796_7797delTT, NM_004369.3:c.7796_7797delTT, NM_057164.3:c.7295_7296delTT, NM_057165.3:c.7196_7197delTT, NM_057166.3:c.7193_7194delTT, NM_057166.4:c.5975_5976delTT, NM_057167.3:c.7178_7179delTT, XM_002342304.1:c.-45_-44delAA, XM_005246065.1:c.7196_7197delTT, XM_005246066.1:c.6575_6576delTT, XM_005246067.1:c.5975_5976delTTPathogenic09/22/2015 
636COL6A3Ex38NM_004369.3:c.7832C>Tp.Ala2611Val | p.A2611VLRG_473t1:c.7832C>T, NM_004369.3:c.7832C>T, NM_057164.3:c.7331C>T, NM_057165.3:c.7232C>T, NM_057166.3:c.7229C>T, NM_057166.4:c.6011C>T, NM_057167.3:c.7214C>T, XM_002342304.1:c.-80G>A, XM_005246065.1:c.7232C>T, XM_005246066.1:c.6611C>T, XM_005246067.1:c.6011C>TVOUS11/14/2017
637COL6A3Ex38NM_004369.3:c.7842C>Tp.Ser2614= | p.S2614=Benign08/07/2012 
638COL6A3Ex38NM_004369.3:c.7843G>Ap.Asp2615Asn | p.D2615NLRG_473t1:c.7843G>A, NM_004369.3:c.7843G>A, NM_057164.3:c.7342G>A, NM_057165.3:c.7243G>A, NM_057166.3:c.7240G>A, NM_057166.4:c.6022G>A, NM_057167.3:c.7225G>A, XM_002342304.1:c.-91C>T, XM_005246065.1:c.7243G>A, XM_005246066.1:c.6622G>A, XM_005246067.1:c.6022G>AVOUS03/15/2018
639COL6A3Ex38NM_004369.3:c.7849G>Ap.Asp2617Asn | p.D2617NLRG_473t1:c.7849G>A, NM_004369.3:c.7849G>A, NM_057164.3:c.7348G>A, NM_057165.3:c.7249G>A, NM_057166.3:c.7246G>A, NM_057166.4:c.6028G>A, NM_057167.3:c.7231G>A, XM_002342304.1:c.-97C>T, XM_005246065.1:c.7249G>A, XM_005246066.1:c.6628G>A, XM_005246067.1:c.6028G>AVOUS06/26/2018
640COL6A3Ex38NM_004369.3:c.7879G>Ap.Ala2627Thr | p.A2627TLRG_473t1:c.7879G>A, NM_004369.3:c.7879G>A, NM_057164.3:c.7378G>A, NM_057165.3:c.7279G>A, NM_057166.3:c.7276G>A, NM_057166.4:c.6058G>A, NM_057167.3:c.7261G>A, XM_002342304.1:c.-127C>T, XM_005246065.1:c.7279G>A, XM_005246066.1:c.6658G>A, XM_005246067.1:c.6058G>AVOUS01/11/2017
641COL6A3Ex38NM_004369.3:c.7908T>Cp.Asn2636= | p.N2636=LRG_473t1:c.7908T>C, NM_004369.3:c.7908T>C, NM_057164.3:c.7407T>C, NM_057165.3:c.7308T>C, NM_057166.3:c.7305T>C, NM_057166.4:c.6087T>C, NM_057167.3:c.7290T>C, XM_002342304.1:c.-156A>G, XM_005246065.1:c.7308T>C, XM_005246066.1:c.6687T>C, XM_005246067.1:c.6087T>CVOUS09/21/2016
642COL6A3Ex38NM_004369.3:c.7929G>Ap.Ala2643= | p.A2643=LRG_473t1:c.7929G>A, NM_004369.3:c.7929G>A, NM_057164.3:c.7428G>A, NM_057165.3:c.7329G>A, NM_057166.3:c.7326G>A, NM_057166.4:c.6108G>A, NM_057167.3:c.7311G>A, XM_002342304.1:c.-177C>T, XM_005246065.1:c.7329G>A, XM_005246066.1:c.6708G>A, XM_005246067.1:c.6108G>ABenign07/09/2012 
643COL6A3Ex38NM_004369.3:c.7937T>Cp.Val2646Ala | p.V2646ALRG_473t1:c.7937T>C, NM_004369.3:c.7937T>C, NM_057164.3:c.7436T>C, NM_057165.3:c.7337T>C, NM_057166.3:c.7334T>C, NM_057166.4:c.6116T>C, NM_057167.3:c.7319T>C, XM_002342304.1:c.-185A>G, XM_005246065.1:c.7337T>C, XM_005246066.1:c.6716T>C, XM_005246067.1:c.6116T>CVOUS11/14/2017
644COL6A3Ex38NM_004369.3:c.7953G>Ap.Met2651Ile | p.M2651INM_004369.3:c.7953G>A, NM_057164.3:c.7452G>A, NM_057165.3:c.7353G>A, NM_057166.3:c.7350G>A, NM_057166.4:c.6132G>A, NM_057167.3:c.7335G>A, XM_002342304.1:c.-201C>T, XM_005246065.1:c.7353G>A, XM_005246066.1:c.6732G>A, XM_005246067.1:c.6132G>AVOUS09/03/2015
645COL6A3Ex38NM_004369.3:c.7976A>Gp.Gln2659Arg | p.Q2659RLRG_473t1:c.7976A>G, NM_004369.3:c.7976A>G, NM_057164.3:c.7475A>G, NM_057165.3:c.7376A>G, NM_057166.3:c.7373A>G, NM_057166.4:c.6155A>G, NM_057167.3:c.7358A>G, XM_002342304.1:c.-224T>C, XM_005246065.1:c.7376A>G, XM_005246066.1:c.6755A>G, XM_005246067.1:c.6155A>GVOUS06/23/2016
646COL6A3Ex38NM_004369.3:c.7983C>Tp.Phe2661= | p.F2661=NM_004369.3:c.7983C>T, NM_057164.3:c.7482C>T, NM_057165.3:c.7383C>T, NM_057166.3:c.7380C>T, NM_057166.4:c.6162C>T, NM_057167.3:c.7365C>T, XM_002342304.1:c.-231G>A, XM_005246065.1:c.7383C>T, XM_005246066.1:c.6762C>T, XM_005246067.1:c.6162C>TVOUS08/24/2015
647COL6A3Ex38NM_004369.3:c.7993G>Tp.Ala2665Ser | p.A2665SLRG_473t1:c.7993G>T, NM_004369.3:c.7993G>T, NM_057164.3:c.7492G>T, NM_057165.3:c.7393G>T, NM_057166.3:c.7390G>T, NM_057166.4:c.6172G>T, NM_057167.3:c.7375G>T, XM_002342304.1:c.-241C>A, XM_005246065.1:c.7393G>T, XM_005246066.1:c.6772G>T, XM_005246067.1:c.6172G>TVOUS10/10/2017
648COL6A3Ex38NM_004369.3:c.7995A>Cp.Ala2665= | p.A2665=Benign07/17/2012 
649COL6A3Ex38NM_004369.3:c.8007C>Tp.His2669= | p.H2669=NM_004369.3:c.8007C>T, NM_057164.3:c.7506C>T, NM_057165.3:c.7407C>T, NM_057166.3:c.7404C>T, NM_057166.4:c.6186C>T, NM_057167.3:c.7389C>T, XM_002342304.1:c.-255G>A, XM_005246065.1:c.7407C>T, XM_005246066.1:c.6786C>T, XM_005246067.1:c.6186C>TLikely benign01/19/2016 
650COL6A3Ex38NM_004369.3:c.8008G>Ap.Ala2670Thr | p.A2670TLRG_473t1:c.8008G>A, NM_004369.3:c.8008G>A, NM_057164.3:c.7507G>A, NM_057165.3:c.7408G>A, NM_057166.3:c.7405G>A, NM_057166.4:c.6187G>A, NM_057167.3:c.7390G>A, XM_002342304.1:c.-256C>T, XM_005246065.1:c.7408G>A, XM_005246066.1:c.6787G>A, XM_005246067.1:c.6187G>AVOUS02/06/2017
651COL6A3Ex38NM_004369.3:c.8009C>Tp.Ala2670Val | p.A2670VLRG_473t1:c.8009C>T, NM_004369.3:c.8009C>T, NM_057164.3:c.7508C>T, NM_057165.3:c.7409C>T, NM_057166.3:c.7406C>T, NM_057166.4:c.6188C>T, NM_057167.3:c.7391C>T, XM_002342304.1:c.-257G>A, XM_005246065.1:c.7409C>T, XM_005246066.1:c.6788C>T, XM_005246067.1:c.6188C>TVOUS01/20/2017
652COL6A3Ex38NM_004369.3:c.8010G>Ap.Ala2670= | p.A2670=Benign11/02/2012 
653COL6A3Ex38NM_004369.3:c.8032G>Ap.Ala2678Thr | p.A2678TLRG_473t1:c.8032G>A, NM_004369.3:c.8032G>A, NM_057164.3:c.7531G>A, NM_057165.3:c.7432G>A, NM_057166.3:c.7429G>A, NM_057166.4:c.6211G>A, NM_057167.3:c.7414G>A, XM_002342304.1:c.-280C>T, XM_005246065.1:c.7432G>A, XM_005246066.1:c.6811G>A, XM_005246067.1:c.6211G>AVOUS08/22/2016
654COL6A3Ex38NM_004369.3:c.8073C>Ap.Asp2691Glu | p.D2691ENM_004369.3:c.8073C>A, NM_057164.3:c.7572C>A, NM_057165.3:c.7473C>A, NM_057166.3:c.7470C>A, NM_057166.4:c.6252C>A, NM_057167.3:c.7455C>A, XM_002342304.1:c.-321G>T, XM_005246065.1:c.7473C>A, XM_005246066.1:c.6852C>A, XM_005246067.1:c.6252C>AVOUS11/09/2015
655COL6A3Ex38NM_004369.3:c.8097G>Ap.Val2699= | p.V2699=LRG_473t1:c.8097G>A, NM_004369.3:c.8097G>A, NM_057164.3:c.7596G>A, NM_057165.3:c.7497G>A, NM_057166.3:c.7494G>A, NM_057166.4:c.6276G>A, NM_057167.3:c.7479G>A, XM_002342304.1:c.-345C>T, XM_005246065.1:c.7497G>A, XM_005246066.1:c.6876G>A, XM_005246067.1:c.6276G>ALikely benign05/25/2017 
656COL6A3Ex38NM_004369.3:c.8140G>Tp.Ala2714Ser | p.A2714SLRG_473t1:c.8140G>T, NM_004369.3:c.8140G>T, NM_057164.3:c.7639G>T, NM_057165.3:c.7540G>T, NM_057166.3:c.7537G>T, NM_057166.4:c.6319G>T, NM_057167.3:c.7522G>T, XM_002342304.1:c.-388C>A, XM_005246065.1:c.7540G>T, XM_005246066.1:c.6919G>T, XM_005246067.1:c.6319G>TVOUS06/08/2016
657COL6A3Ex38NM_004369.3:c.8145A>Gp.Leu2715= | p.L2715=Benign07/17/2012 
658COL6A3Ex38NM_004369.3:c.8161T>Gp.Tyr2721Asp | p.Y2721DLRG_473t1:c.8161T>G, NM_004369.3:c.8161T>G, NM_057164.3:c.7660T>G, NM_057165.3:c.7561T>G, NM_057166.3:c.7558T>G, NM_057166.4:c.6340T>G, NM_057167.3:c.7543T>G, XM_002342304.1:c.-409A>C, XM_005246065.1:c.7561T>G, XM_005246066.1:c.6940T>G, XM_005246067.1:c.6340T>GVOUS08/10/2016
659COL6A3Ex38NM_004369.3:c.8189C>Ap.Ala2730Asp | p.A2730DLRG_473t1:c.8189C>A, NM_004369.3:c.8189C>A, NM_057164.3:c.7688C>A, NM_057165.3:c.7589C>A, NM_057166.3:c.7586C>A, NM_057166.4:c.6368C>A, NM_057167.3:c.7571C>A, XM_002342304.1:c.-437G>T, XM_005246065.1:c.7589C>A, XM_005246066.1:c.6968C>A, XM_005246067.1:c.6368C>AVOUS01/14/2021
660COL6A3Ex38NM_004369.3:c.8193A>Cp.Pro2731= | p.P2731=LRG_473t1:c.8193A>C, NM_004369.3:c.8193A>C, NM_057164.3:c.7692A>C, NM_057165.3:c.7593A>C, NM_057166.3:c.7590A>C, NM_057166.4:c.6372A>C, NM_057167.3:c.7575A>C, XM_002342304.1:c.-441T>G, XM_005246065.1:c.7593A>C, XM_005246066.1:c.6972A>C, XM_005246067.1:c.6372A>CVOUS07/10/2018
661COL6A3Ex38NM_004369.3:c.8236G>Ap.Glu2746Lys | p.E2746KLRG_473t1:c.8236G>A, NM_004369.3:c.8236G>A, NM_057164.3:c.7735G>A, NM_057165.3:c.7636G>A, NM_057166.3:c.7633G>A, NM_057166.4:c.6415G>A, NM_057167.3:c.7618G>A, XM_002342304.1:c.-484C>T, XM_005246065.1:c.7636G>A, XM_005246066.1:c.7015G>A, XM_005246067.1:c.6415G>AVOUS06/23/2016
662COL6A3Ex38NM_004369.3:c.8243C>Tp.Pro2748Leu | p.P2748LLRG_473t1:c.8243C>T, NM_004369.3:c.8243C>T, NM_057164.3:c.7742C>T, NM_057165.3:c.7643C>T, NM_057166.3:c.7640C>T, NM_057166.4:c.6422C>T, NM_057167.3:c.7625C>T, XM_002342304.1:c.-491G>A, XM_005246065.1:c.7643C>T, XM_005246066.1:c.7022C>T, XM_005246067.1:c.6422C>TVOUS12/18/2018
663COL6A3Ex38NM_004369.3:c.8256G>Ap.Leu2752= | p.L2752=NM_004369.3:c.8256G>A, NM_057164.3:c.7755G>A, NM_057165.3:c.7656G>A, NM_057166.3:c.7653G>A, NM_057166.4:c.6435G>A, NM_057167.3:c.7638G>A, XM_002342304.1:c.-504C>T, XM_005246065.1:c.7656G>A, XM_005246066.1:c.7035G>A, XM_005246067.1:c.6435G>AVOUS10/07/2015
664COL6A3Ex38NM_004369.3:c.8270G>Cp.Arg2757Thr | p.R2757TNM_004369.3:c.8270G>C, NM_057164.3:c.7769G>C, NM_057165.3:c.7670G>C, NM_057166.3:c.7667G>C, NM_057166.4:c.6449G>C, NM_057167.3:c.7652G>C, XM_002342304.1:c.-518C>G, XM_005246065.1:c.7670G>C, XM_005246066.1:c.7049G>C, XM_005246067.1:c.6449G>CVOUS12/14/2015
665COL6A3Ex38NM_004369.3:c.8308G>Ap.Val2770Met | p.V2770MLRG_473t1:c.8308G>A, NM_004369.3:c.8308G>A, NM_057164.3:c.7807G>A, NM_057165.3:c.7708G>A, NM_057166.3:c.7705G>A, NM_057166.4:c.6487G>A, NM_057167.3:c.7690G>A, XM_002342304.1:c.-556C>T, XM_005246065.1:c.7708G>A, XM_005246066.1:c.7087G>A, XM_005246067.1:c.6487G>AVOUS05/25/2017
666COL6A3Ex38NM_004369.3:c.8310G>Ap.Val2770= | p.V2770=LRG_473t1:c.8310G>A, NM_004369.3:c.8310G>A, NM_057164.3:c.7809G>A, NM_057165.3:c.7710G>A, NM_057166.3:c.7707G>A, NM_057166.4:c.6489G>A, NM_057167.3:c.7692G>A, XM_002342304.1:c.-558C>T, XM_005246065.1:c.7710G>A, XM_005246066.1:c.7089G>A, XM_005246067.1:c.6489G>AVOUS10/15/2018
667COL6A3Ex38NM_004369.3:c.8344G>Ap.Glu2782Lys | p.E2782KNM_004369.3:c.8344G>A, NM_057164.3:c.7843G>A, NM_057165.3:c.7744G>A, NM_057166.3:c.7741G>A, NM_057166.4:c.6523G>A, NM_057167.3:c.7726G>A, XM_002342304.1:c.-592C>T, XM_005246065.1:c.7744G>A, XM_005246066.1:c.7123G>A, XM_005246067.1:c.6523G>AVOUS04/28/2015
668COL6A3Ex38NM_004369.3:c.8346G>Ap.Glu2782= | p.E2782=NM_004369.3:c.8346G>A, NM_057164.3:c.7845G>A, NM_057165.3:c.7746G>A, NM_057166.3:c.7743G>A, NM_057166.4:c.6525G>A, NM_057167.3:c.7728G>A, XM_002342304.1:c.-594C>T, XM_005246065.1:c.7746G>A, XM_005246066.1:c.7125G>A, XM_005246067.1:c.6525G>ABenign01/15/2015 
669COL6A3Ex38NM_004369.3:c.8359G>Ap.Ala2787Thr | p.A2787TLRG_473t1:c.8359G>A, NM_004369.3:c.8359G>A, NM_057164.3:c.7858G>A, NM_057165.3:c.7759G>A, NM_057166.3:c.7756G>A, NM_057166.4:c.6538G>A, NM_057167.3:c.7741G>A, XM_002342304.1:c.-607C>T, XM_005246065.1:c.7759G>A, XM_005246066.1:c.7138G>A, XM_005246067.1:c.6538G>AVOUS11/15/2017
670COL6A3Ex38NM_004369.3:c.8375A>Gp.Asp2792Gly | p.D2792GLRG_473t1:c.8375A>G, NM_004369.3:c.8375A>G, NM_057164.3:c.7874A>G, NM_057165.3:c.7775A>G, NM_057166.3:c.7772A>G, NM_057166.4:c.6554A>G, NM_057167.3:c.7757A>G, XM_002342304.1:c.-623T>C, XM_005246065.1:c.7775A>G, XM_005246066.1:c.7154A>G, XM_005246067.1:c.6554A>GVOUS08/22/2016
671COL6A3Ex38NM_004369.3:c.8376C>Tp.Asp2792= | p.D2792=NM_004369.3:c.8376C>T, NM_057164.3:c.7875C>T, NM_057165.3:c.7776C>T, NM_057166.3:c.7773C>T, NM_057166.4:c.6555C>T, NM_057167.3:c.7758C>T, XM_002342304.1:c.-624G>A, XM_005246065.1:c.7776C>T, XM_005246066.1:c.7155C>T, XM_005246067.1:c.6555C>TVOUS11/11/2015
672COL6A3Ex38NM_004369.3:c.8377G>Ap.Val2793Ile | p.V2793ILRG_473t1:c.8377G>A, NM_004369.3:c.8377G>A, NM_057164.3:c.7876G>A, NM_057165.3:c.7777G>A, NM_057166.3:c.7774G>A, NM_057166.4:c.6556G>A, NM_057167.3:c.7759G>A, XM_002342304.1:c.-625C>T, XM_005246065.1:c.7777G>A, XM_005246066.1:c.7156G>A, XM_005246067.1:c.6556G>AVOUS02/07/2017
673COL6A3Ex38NM_004369.3:c.8392G>Ap.Val2798Met | p.V2798MLRG_473t1:c.8392G>A, NM_004369.3:c.8392G>A, NM_057164.3:c.7891G>A, NM_057165.3:c.7792G>A, NM_057166.3:c.7789G>A, NM_057166.4:c.6571G>A, NM_057167.3:c.7774G>A, XM_002342304.1:c.-640C>T, XM_005246065.1:c.7792G>A, XM_005246066.1:c.7171G>A, XM_005246067.1:c.6571G>AVOUS10/03/2018
674COL6A3Ex38NM_004369.3:c.8393T>Cp.Val2798Ala | p.V2798ALRG_473t1:c.8393T>C, NM_004369.3:c.8393T>C, NM_057164.3:c.7892T>C, NM_057165.3:c.7793T>C, NM_057166.3:c.7790T>C, NM_057166.4:c.6572T>C, NM_057167.3:c.7775T>C, XM_002342304.1:c.-641A>G, XM_005246065.1:c.7793T>C, XM_005246066.1:c.7172T>C, XM_005246067.1:c.6572T>CVOUS05/07/2018
675COL6A3Ex38NM_004369.3:c.8406C>Tp.Thr2802= | p.T2802=LRG_473t1:c.8406C>T, NM_004369.3:c.8406C>T, NM_057164.3:c.7905C>T, NM_057165.3:c.7806C>T, NM_057166.3:c.7803C>T, NM_057166.4:c.6585C>T, NM_057167.3:c.7788C>T, XM_002342304.1:c.-654G>A, XM_005246065.1:c.7806C>T, XM_005246066.1:c.7185C>T, XM_005246067.1:c.6585C>TVOUS08/10/2016
676COL6A3Ex38NM_004369.3:c.8415C>Tp.Asn2805= | p.N2805=LRG_473t1:c.8415C>T, NM_004369.3:c.8415C>T, NM_057164.3:c.7914C>T, NM_057165.3:c.7815C>T, NM_057166.3:c.7812C>T, NM_057166.4:c.6594C>T, NM_057167.3:c.7797C>T, XM_002342304.1:c.-663G>A, XM_005246065.1:c.7815C>T, XM_005246066.1:c.7194C>T, XM_005246067.1:c.6594C>TVOUS08/23/2018
677COL6A3Ex38NM_004369.3:c.8428A>Cp.Met2810Leu | p.M2810LLRG_473t1:c.8428A>C, NM_004369.3:c.8428A>C, NM_057164.3:c.7927A>C, NM_057165.3:c.7828A>C, NM_057166.3:c.7825A>C, NM_057166.4:c.6607A>C, NM_057167.3:c.7810A>C, XM_002342304.1:c.-676T>G, XM_005246065.1:c.7828A>C, XM_005246066.1:c.7207A>C, XM_005246067.1:c.6607A>CVOUS03/29/2016
678COL6A3Ex38NM_004369.3:c.8432G>Ap.Arg2811His | p.R2811HLRG_473t1:c.8432G>A, NM_004369.3:c.8432G>A, NM_057164.3:c.7931G>A, NM_057165.3:c.7832G>A, NM_057166.3:c.7829G>A, NM_057166.4:c.6611G>A, NM_057167.3:c.7814G>A, XM_002342304.1:c.-680C>T, XM_005246065.1:c.7832G>A, XM_005246066.1:c.7211G>A, XM_005246067.1:c.6611G>AVOUS06/30/2020
679COL6A3Ex38NM_004369.3:c.8436C>Tp.Phe2812= | p.F2812=LRG_473t1:c.8436C>T, NM_004369.3:c.8436C>T, NM_057164.3:c.7935C>T, NM_057165.3:c.7836C>T, NM_057166.3:c.7833C>T, NM_057166.4:c.6615C>T, NM_057167.3:c.7818C>T, XM_002342304.1:c.-684G>A, XM_005246065.1:c.7836C>T, XM_005246066.1:c.7215C>T, XM_005246067.1:c.6615C>TVOUS02/07/2017
680COL6A3Ex38NM_004369.3:c.8451A>Gp.Pro2817= | p.P2817=Benign08/07/2012 
681COL6A3Ex38NM_004369.3:c.8457C>Tp.Phe2819= | p.F2819=LRG_473t1:c.8457C>T, NM_004369.3:c.8457C>T, NM_057164.3:c.7956C>T, NM_057165.3:c.7857C>T, NM_057166.3:c.7854C>T, NM_057166.4:c.6636C>T, NM_057167.3:c.7839C>T, XM_002342304.1:c.-705G>A, XM_005246065.1:c.7857C>T, XM_005246066.1:c.7236C>T, XM_005246067.1:c.6636C>TVOUS03/16/2018
682COL6A3Ex38NM_004369.3:c.8458G>A