Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1COL6A1Ex1NM_001848.2:c.-1C>TLRG_475t1:c.-1C>T, NM_001848.2:c.-1C>TVOUS12/30/2016
2COL6A1Ex1NM_001848.2:c.-5C>GLRG_475t1:c.-5C>G, NM_001848.2:c.-5C>GBenign05/20/2016 
3COL6A1Ex1NM_001848.2:c.9G>Tp.Ala3= | p.A3=NM_001848.2:c.9G>TVOUS01/15/2016
4COL6A1Ex1NM_001848.2:c.74C>Ap.Thr25Asn | p.T25NLRG_475t1:c.74C>A, NM_001848.2:c.74C>AVOUS06/23/2016
5COL6A1Ex1NM_001848.2:c.97+20G>ALRG_475t1:c.97+20G>A, NM_001848.2:c.97+20G>ABenign07/15/2016 
6COL6A1Ex2NM_001848.2:c.98-6G>ANM_001848.2:c.98-6G>AVOUS09/10/2015
7COL6A1Ex2NM_001848.2:c.98-3C>GLRG_475t1:c.98-3C>G, NM_001848.2:c.98-3C>GVOUS09/27/2016
8COL6A1Ex2NM_001848.2:c.98-2_103delAGACTGCCLRG_475t1:c.98-2_103delAGACTGCC, NM_001848.2:c.98-2_103delAGACTGCCPathogenic02/02/2016 
9COL6A1Ex2NM_001848.2:c.105C>Gp.Pro35= | p.P35=LRG_475t1:c.105C>G, NM_001848.2:c.105C>GLikely benign08/18/2015 
10COL6A1Ex2NM_001848.2:c.138G>Cp.Glu46Asp | p.E46DNM_001848.2:c.138G>CVOUS01/23/2016
11COL6A1Ex2NM_001848.2:c.170C>Ap.Ala57Asp | p.A57DLRG_475t1:c.170C>A, NM_001848.2:c.170C>AVOUS12/03/2018
12COL6A1Ex2NM_001848.2:c.202C>Tp.Arg68Cys | p.R68CLRG_475t1:c.202C>T, NM_001848.2:c.202C>TVOUS02/13/2018
13COL6A1Ex2NM_001848.2:c.226A>Cp.Arg76= | p.R76=LRG_475t1:c.226A>C, NM_001848.2:c.226A>CVOUS06/08/2016
14COL6A1Ex3NM_001848.2:c.247A>Gp.Asn83Asp | p.N83DLRG_475t1:c.247A>G, NM_001848.2:c.247A>GVOUS10/19/2016
15COL6A1Ex3NM_001848.2:c.261C>Tp.Asn87= | p.N87=NM_001848.2:c.261C>TVOUS02/16/2016
16COL6A1Ex3NM_001848.2:c.278A>Tp.Tyr93Phe | p.Y93FLRG_475t1:c.278A>T, NM_001848.2:c.278A>TVOUS07/10/2017
17COL6A1Ex3NM_001848.2:c.285C>Gp.Asp95Glu | p.D95ELRG_475t1:c.285C>G, NM_001848.2:c.285C>GVOUS11/27/2017
18COL6A1Ex3NM_001848.2:c.311C>Tp.Thr104Met | p.T104MNM_001848.2:c.311C>TVOUS12/01/2015
19COL6A1Ex3NM_001848.2:c.315_349delCATGCCTGGCGGCCGCGACGCACTCAAAAGCAGCGp.Met106Glyfs*34 | p.M106GfsX34LRG_475t1:c.315_349delCATGCCTGGCGGCCGCGACGCACTCAAAAGCAGCG, NM_001848.2:c.315_349delCATGCCTGGCGGCCGCGACGCACTCAAAAGCAGCGPathogenic01/08/2016 
20COL6A1Ex3NM_001848.2:c.316A>Gp.Met106Val | p.M106VLRG_475t1:c.316A>G, NM_001848.2:c.316A>GVOUS12/03/2018
21COL6A1Ex3NM_001848.2:c.324C>Tp.Gly108= | p.G108=LRG_475t1:c.324C>T, NM_001848.2:c.324C>TBenign06/27/2016 
22COL6A1Ex3NM_001848.2:c.325G>Ap.Gly109Ser | p.G109SLRG_475t1:c.325G>A, NM_001848.2:c.325G>AVOUS05/23/2017
23COL6A1Ex3NM_001848.2:c.347G>Ap.Ser116Asn | p.S116NBenign08/28/2012 
24COL6A1Ex3NM_001848.2:c.348C>Tp.Ser116= | p.S116=NM_001848.2:c.348C>TVOUS01/21/2016
25COL6A1Ex3NM_001848.2:c.349G>Ap.Val117Met | p.V117MLRG_475t1:c.349G>A, NM_001848.2:c.349G>ALikely benign09/22/2015 
26COL6A1Ex3NM_001848.2:c.350T>Cp.Val117Ala | p.V117ALRG_475t1:c.350T>C, NM_001848.2:c.350T>CVOUS01/03/2017
27COL6A1Ex3NM_001848.2:c.352G>Ap.Asp118Asn | p.D118NLRG_475t1:c.352G>A, NM_001848.2:c.352G>AVOUS02/21/2018
28COL6A1Ex3NM_001848.2:c.355G>Ap.Ala119Thr | p.A119TLRG_475t1:c.355G>A, NM_001848.2:c.355G>AVOUS08/24/2018
29COL6A1Ex3NM_001848.2:c.356C>Tp.Ala119Val | p.A119VLRG_475t1:c.356C>T, NM_001848.2:c.356C>TVOUS08/25/2016
30COL6A1Ex3NM_001848.2:c.357G>Ap.Ala119= | p.A119=LRG_475t1:c.357G>A, NM_001848.2:c.357G>AVOUS04/13/2018
31COL6A1Ex3NM_001848.2:c.362A>Gp.Lys121Arg | p.K121RLRG_475t1:c.362A>G, NM_001848.2:c.362A>GPathogenic11/27/2017 
32COL6A1Ex3NM_001848.2:c.366C>Tp.Tyr122= | p.Y122=LRG_475t1:c.366C>T, NM_001848.2:c.366C>TVOUS01/20/2017
33COL6A1Ex3NM_001848.2:c.376G>Ap.Gly126Ser | p.G126SLRG_475t1:c.376G>A, NM_001848.2:c.376G>AVOUS05/25/2016
34COL6A1Ex3NM_001848.2:c.377G>Tp.Gly126Val | p.G126VLRG_475t1:c.377G>T, NM_001848.2:c.377G>TVOUS06/01/2018
35COL6A1Ex3NM_001848.2:c.379A>Gp.Thr127Ala | p.T127ALRG_475t1:c.379A>G, NM_001848.2:c.379A>GVOUS06/07/2016
36COL6A1Ex3NM_001848.2:c.381C>Tp.Thr127= | p.T127=LRG_475t1:c.381C>T, NM_001848.2:c.381C>TVOUS10/26/2016
37COL6A1Ex3NM_001848.2:c.388G>Ap.Asp130Asn | p.D130NLRG_475t1:c.388G>A, NM_001848.2:c.388G>AVOUS03/08/2018
38COL6A1Ex3NM_001848.2:c.409C>Gp.Leu137Val | p.L137VNM_001848.2:c.409C>GVOUS01/22/2016
39COL6A1Ex3NM_001848.2:c.414G>Ap.Glu138= | p.E138=LRG_475t1:c.414G>A, NM_001848.2:c.414G>AVOUS01/19/2017
40COL6A1Ex3NM_001848.2:c.423C>Tp.Leu141= | p.L141=LRG_475t1:c.423C>T, NM_001848.2:c.423C>TVOUS09/07/2016
41COL6A1Ex3NM_001848.2:c.424G>Cp.Val142Leu | p.V142LNM_001848.2:c.424G>CVOUS01/22/2016
42COL6A1Ex3NM_001848.2:c.428+14A>GLRG_475t1:c.428+14A>G, NM_001848.2:c.428+14A>GBenign10/14/2014 
43COL6A1Ex3NM_001848.2:c.428+39C>GBenign09/05/2012 
44COL6A1Ex3NM_001848.2:c.428+40G>ABenign08/28/2012 
45COL6A1Ex4NM_001848.2:c.429-19G>ABenign07/09/2012 
46COL6A1Ex4NM_001848.2:c.429-8C>TLRG_475t1:c.429-8C>T, NM_001848.2:c.429-8C>TVOUS09/19/2017
47COL6A1Ex4NM_001848.2:c.434C>Tp.Ser145Phe | p.S145FLRG_475t1:c.434C>T, NM_001848.2:c.434C>TVOUS08/10/2018
48COL6A1Ex4NM_001848.2:c.434C>Gp.Ser145Cys | p.S145CLRG_475t1:c.434C>G, NM_001848.2:c.434C>GVOUS07/03/2018
49COL6A1Ex4NM_001848.2:c.519G>Ap.Glu173= | p.E173=LRG_475t1:c.519G>A, NM_001848.2:c.519G>AVOUS07/10/2017
50COL6A1Ex4NM_001848.2:c.525T>Ap.Ala175= | p.A175=LRG_475t1:c.525T>A, NM_001848.2:c.525T>AVOUS10/24/2016
51COL6A1Ex4NM_001848.2:c.531C>Tp.Asn177= | p.N177=LRG_475t1:c.531C>T, NM_001848.2:c.531C>TVOUS10/19/2016
52COL6A1Ex4NM_001848.2:c.539A>Gp.Lys180Arg | p.K180RNM_001848.2:c.539A>GVOUS09/14/2015
53COL6A1Ex4NM_001848.2:c.541C>Tp.His181Tyr | p.H181YLRG_475t1:c.541C>T, NM_001848.2:c.541C>TVOUS08/10/2018
54COL6A1Ex4NM_001848.2:c.548G>Ap.Gly183Asp | p.G183DNM_001848.2:c.548G>AVOUS07/20/2015
55COL6A1Ex4NM_001848.2:c.549C>Tp.Gly183= | p.G183=NM_001848.2:c.549C>TVOUS08/28/2012
56COL6A1Ex4NM_001848.2:c.556G>Cp.Val186Leu | p.V186LNM_001848.2:c.556G>CVOUS09/08/2015
57COL6A1Ex4NM_001848.2:c.588+8C>GLRG_475t1:c.588+8C>G, NM_001848.2:c.588+8C>GVOUS05/23/2018
58COL6A1Ex4NM_001848.2:c.588+10G>ALRG_475t1:c.588+10G>A, NM_001848.2:c.588+10G>AVOUS10/12/2016
59COL6A1Ex4NM_001848.2:c.588+12_588+13insAVOUS08/28/2012
60COL6A1Ex4NM_001848.2:c.588+13C>ANM_001848.2:c.588+13C>ABenign10/14/2014 
61COL6A1Ex4NM_001848.2:c.588+19dupCBenign09/05/2012 
62COL6A1Ex4NM_001848.2:c.588+37A>GBenign09/05/2012 
63COL6A1Ex5NM_001848.2:c.593C>Tp.Pro198Leu | p.P198LLRG_475t1:c.593C>T, NM_001848.2:c.593C>TVOUS01/26/2017
64COL6A1Ex5NM_001848.2:c.595C>Tp.Arg199Cys | p.R199CNM_001848.2:c.595C>TVOUS05/16/2014
65COL6A1Ex5NM_001848.2:c.602G>Cp.Ser201Thr | p.S201TNM_001848.2:c.602G>CVOUS12/18/2015
66COL6A1Ex5NM_001848.2:c.607A>Gp.Ile203Val | p.I203VLRG_475t1:c.607A>G, NM_001848.2:c.607A>GVOUS08/31/2016
67COL6A1Ex5NM_001848.2:c.609C>Tp.Ile203= | p.I203=LRG_475t1:c.609C>T, NM_001848.2:c.609C>TVOUS01/22/2018
68COL6A1Ex5NM_001848.2:c.623C>Tp.Thr208Met | p.T208MLRG_475t1:c.623C>T, NM_001848.2:c.623C>TVOUS09/24/2018
69COL6A1Ex5NM_001848.2:c.624G>Ap.Thr208= | p.T208=LRG_475t1:c.624G>A, NM_001848.2:c.624G>AVOUS05/25/2018
70COL6A1Ex5NM_001848.2:c.628C>Tp.Arg210Trp | p.R210WLRG_475t1:c.628C>T, NM_001848.2:c.628C>TVOUS03/07/2017
71COL6A1Ex5NM_001848.2:c.631C>Tp.Arg211Cys | p.R211CLRG_475t1:c.631C>T, NM_001848.2:c.631C>TVOUS02/08/2019
72COL6A1Ex5NM_001848.2:c.641C>Tp.Thr214Met | p.T214MLRG_475t1:c.641C>T, NM_001848.2:c.641C>TVOUS12/28/2017
73COL6A1Ex5NM_001848.2:c.645G>Ap.Ala215= | p.A215=Benign08/28/2012 
74COL6A1Ex5NM_001848.2:c.646G>Tp.Ala216Ser | p.A216SLRG_475t1:c.646G>T, NM_001848.2:c.646G>TVOUS12/25/2016
75COL6A1Ex5NM_001848.2:c.665G>Ap.Arg222His | p.R222HLRG_475t1:c.665G>A, NM_001848.2:c.665G>AVOUS03/04/2017
76COL6A1Ex5NM_001848.2:c.666C>Tp.Arg222= | p.R222=LRG_475t1:c.666C>T, NM_001848.2:c.666C>TVOUS11/10/2017
77COL6A1Ex5NM_001848.2:c.667G>Ap.Asp223Asn | p.D223NLRG_475t1:c.667G>A, NM_001848.2:c.667G>AVOUS11/22/2016
78COL6A1Ex5NM_001848.2:c.674A>Tp.Glu225Val | p.E225VLRG_475t1:c.674A>T, NM_001848.2:c.674A>TVOUS06/07/2016
79COL6A1Ex5NM_001848.2:c.696C>Tp.Ile232= | p.I232=LRG_475t1:c.696C>T, NM_001848.2:c.696C>TVOUS09/14/2018
80COL6A1Ex5NM_001848.2:c.705C>Tp.Ile235= | p.I235=LRG_475t1:c.705C>T, NM_001848.2:c.705C>TVOUS11/03/2016
81COL6A1Ex5NM_001848.2:c.717C>Tp.Ile239= | p.I239=NM_001848.2:c.717C>TVOUS07/20/2014
82COL6A1Ex5NM_001848.2:c.717+4A>GLRG_475t1:c.717+4A>G, NM_001848.2:c.717+4A>GLikely pathogenic03/09/2018 
83COL6A1Ex5NM_001848.2:c.717+32C>TBenign08/28/2012 
84COL6A1Ex6NM_001848.2:c.726C>Tp.Asn242= | p.N242=NM_001848.2:c.726C>TVOUS02/11/2016
85COL6A1Ex6NM_001848.2:c.738+8C>GLRG_475t1:c.738+8C>G, NM_001848.2:c.738+8C>GVOUS10/17/2016
86COL6A1Ex6NM_001848.2:c.738+14C>TVOUS08/28/2012
87COL6A1Ex7NM_001848.2:c.739-51C>TLRG_475t1:c.739-51C>T, NM_001848.2:c.739-51C>TBenign12/01/2016 
88COL6A1Ex7NM_001848.2:c.739-18C>TNM_001848.2:c.739-18C>TBenign09/24/2013 
89COL6A1Ex7NM_001848.2:c.739-10C>GLRG_475t1:c.739-10C>G, NM_001848.2:c.739-10C>GVOUS07/08/2016
90COL6A1Ex7NM_001848.2:c.739-5C>TLRG_475t1:c.739-5C>T, NM_001848.2:c.739-5C>TVOUS12/01/2016
91COL6A1Ex7NM_001848.2:c.750C>Ap.Phe250Leu | p.F250LLRG_475t1:c.750C>A, NM_001848.2:c.750C>AVOUS09/15/2016
92COL6A1Ex7NM_001848.2:c.751G>Ap.Glu251Lys | p.E251KLRG_475t1:c.751G>A, NM_001848.2:c.751G>AVOUS08/31/2016
93COL6A1Ex8NM_001848.2:c.763G>Ap.Ala255Thr | p.A255TNM_001848.2:c.763G>AVOUS10/12/2015
94COL6A1Ex8NM_001848.2:c.776C>Tp.Pro259Leu | p.P259LLRG_475t1:c.776C>T, NM_001848.2:c.776C>TVOUS08/18/2016
95COL6A1Ex8NM_001848.2:c.780G>Ap.Gly260= | p.G260=LRG_475t1:c.780G>A, NM_001848.2:c.780G>AVOUS08/24/2016
96COL6A1Ex8NM_001848.2:c.782_789delTCCGGGGCp.Leu261Argfs*5 | p.L261RfsX5LRG_475t1:c.782_789delTCCGGGGC, NM_001848.2:c.782_789delTCCGGGGCPathogenic02/16/2016 
97COL6A1Ex8NM_001848.2:c.784C>Tp.Arg262Trp | p.R262WNM_001848.2:c.784C>TVOUS10/06/2015
98COL6A1Ex8NM_001848.2:c.788G>Ap.Gly263Asp | p.G263DLRG_475t1:c.788G>A, NM_001848.2:c.788G>ALikely pathogenic02/11/2016 
99COL6A1Ex8NM_001848.2:c.789C>Tp.Gly263= | p.G263=LRG_475t1:c.789C>T, NM_001848.2:c.789C>TVOUS02/28/2017
100COL6A1Ex8NM_001848.2:c.790G>Ap.Asp264Asn | p.D264NLRG_475t1:c.790G>A, NM_001848.2:c.790G>AVOUS08/10/2017
101COL6A1Ex8NM_001848.2:c.794C>Tp.Pro265Leu | p.P265LLRG_475t1:c.794C>T, NM_001848.2:c.794C>TVOUS06/16/2017
102COL6A1Ex8NM_001848.2:c.795C>Tp.Pro265= | p.P265=LRG_475t1:c.795C>T, NM_001848.2:c.795C>TVOUS10/05/2017
103COL6A1Ex9NM_001848.2:c.805-2A>GNM_001848.2:c.805-2A>GPathogenic08/28/2012 
104COL6A1Ex9NM_001848.2:c.805G>Ap.Gly269Arg | p.G269RLRG_475t1:c.805G>A, NM_001848.2:c.805G>ALikely pathogenic10/28/2015 
105COL6A1Ex9NM_001848.2:c.811C>Tp.Arg271* | p.R271XLRG_475t1:c.811C>T, NM_001848.2:c.811C>TPathogenic10/17/2016 
106COL6A1Ex9NM_001848.2:c.814G>Ap.Gly272Ser | p.G272SLRG_475t1:c.814G>A, NM_001848.2:c.814G>APathogenic02/08/2019 
107COL6A1Ex9NM_001848.2:c.821C>Tp.Pro274Leu | p.P274LLRG_475t1:c.821C>T, NM_001848.2:c.821C>TVOUS12/28/2017
108COL6A1Ex9NM_001848.2:c.822G>Ap.Pro274= | p.P274=LRG_475t1:c.822G>A, NM_001848.2:c.822G>AVOUS09/13/2016
109COL6A1Ex9NM_001848.2:c.823G>Cp.Gly275Arg | p.G275RLRG_475t1:c.823G>C, NM_001848.2:c.823G>CLikely pathogenic08/02/2018 
110COL6A1Ex9NM_001848.2:c.829C>Tp.Pro277Ser | p.P277SLRG_475t1:c.829C>T, NM_001848.2:c.829C>TVOUS07/19/2018
111COL6A1Ex9NM_001848.2:c.833G>Ap.Gly278Glu | p.G278ELRG_475t1:c.833G>A, NM_001848.2:c.833G>ALikely pathogenic08/22/2017 
112COL6A1Ex9NM_001848.2:c.842G>Ap.Gly281Glu | p.G281ELRG_475t1:c.842G>A, NM_001848.2:c.842G>ALikely pathogenic10/10/2012 
113COL6A1Ex9NM_001848.2:c.846_854delAGCCGGAGAp.Glu282_Gly284del | p.E282_G284delLRG_475t1:c.846_854delAGCCGGAGA, NM_001848.2:c.846_854delAGCCGGAGAVOUS12/21/2016
114COL6A1Ex9NM_001848.2:c.850G>Ap.Gly284Arg | p.G284RLRG_475t1:c.850G>A, NM_001848.2:c.850G>APathogenic04/26/2019 
115COL6A1Ex10NM_001848.2:c.859-22A>GVOUS08/28/2012
116COL6A1Ex10NM_001848.2:c.859-20C>TNM_001848.2:c.859-20C>TBenign05/21/2019 
117COL6A1Ex10NM_001848.2:c.859-19A>GLRG_475t1:c.859-19A>G, NM_001848.2:c.859-19A>GBenign05/21/2019 
118COL6A1Ex10NM_001848.2:c.859-18T>AVOUS08/28/2012
119COL6A1Ex10NM_001848.2:c.859-1G>CLRG_475t1:c.859-1G>C, NM_001848.2:c.859-1G>CPathogenic10/06/2016 
120COL6A1Ex10NM_001848.2:c.868G>Ap.Gly290Arg | p.G290RLRG_475t1:c.868G>A, NM_001848.2:c.868G>APathogenic03/21/2016 
121COL6A1Ex10NM_001848.2:c.877G>Ap.Gly293Arg | p.G293RNM_001848.2:c.877G>ALikely pathogenic12/30/2015 
122COL6A1Ex10NM_001848.2:c.896G>Ap.Gly299Glu | p.G299ENM_001848.2:c.896G>ALikely pathogenic12/28/2012 
123COL6A1Ex10NM_001848.2:c.903+1G>TLRG_475t1:c.903+1G>T, NM_001848.2:c.903+1G>TPathogenic02/13/2018 
124COL6A1Ex10NM_001848.2:c.903+3_903+7delACGTGinsCCTTCLRG_475t1:c.903+3_903+7delinsCCTTC, NM_001848.2:c.903+3_903+7delinsCCTTCVOUS07/14/2016
125COL6A1Ex10NM_001848.2:c.903+14C>ANM_001848.2:c.903+14C>ABenign07/09/2012 
126COL6A1Ex11NM_001848.2:c.904-10G>ANM_001848.2:c.904-10G>AVOUS02/13/2015
127COL6A1Ex11NM_001848.2:c.904-2A>GLRG_475t1:c.904-2A>G, NM_001848.2:c.904-2A>GPathogenic11/30/2017 
128COL6A1Ex11NM_001848.2:c.904-1G>TLRG_475t1:c.904-1G>T, NM_001848.2:c.904-1G>TPathogenic11/09/2018 
129COL6A1Ex11NM_001848.2:c.904G>Ap.Gly302Arg | p.G302RLRG_475t1:c.904G>A, NM_001848.2:c.904G>APathogenic04/14/2016 
130COL6A1Ex11NM_001848.2:c.904G>Cp.Gly302Arg | p.G302RLRG_475t1:c.904G>C, NM_001848.2:c.904G>CPathogenic10/23/2014 
131COL6A1Ex11NM_001848.2:c.914G>Ap.Gly305Glu | p.G305ELRG_475t1:c.914G>A, NM_001848.2:c.914G>ALikely pathogenic10/13/2015 
132COL6A1Ex11NM_001848.2:c.928_930delAAGp.Lys310del | p.K310delLRG_475t1:c.928_930delAAG, NM_001848.2:c.928_930delAAGPathogenic12/31/2015 
133COL6A1Ex11NM_001848.2:c.930+1G>ALRG_475t1:c.930+1G>A, NM_001848.2:c.930+1G>APathogenic01/30/2017 
134COL6A1Ex11NM_001848.2:c.930+10G>ALRG_475t1:c.930+10G>A, NM_001848.2:c.930+10G>AVOUS05/04/2017
135COL6A1Ex11NM_001848.2:c.930+189C>TLRG_475t1:c.930+189C>T, NM_001848.2:c.930+189C>TPathogenic02/15/2018 
136COL6A1Ex12NM_001848.2:c.931-5C>TLRG_475t1:c.931-5C>T, NM_001848.2:c.931-5C>TVOUS05/17/2016
137COL6A1Ex12NM_001848.2:c.931-3C>ANM_001848.2:c.931-3C>AVOUS09/23/2015
138COL6A1Ex12NM_001848.2:c.931-1G>ANM_001848.2:c.931-1G>APathogenic08/25/2015 
139COL6A1Ex12NM_001848.2:c.931-1G>CLRG_475t1:c.931-1G>C, NM_001848.2:c.931-1G>CPathogenic11/07/2016 
140COL6A1Ex12NM_001848.2:c.932G>Ap.Gly311Asp | p.G311DLRG_475t1:c.932G>A, NM_001848.2:c.932G>APathogenic08/15/2016 
141COL6A1Ex12NM_001848.2:c.941G>Ap.Gly314Glu | p.G314ELRG_475t1:c.941G>A, NM_001848.2:c.941G>ALikely pathogenic11/01/2018 
142COL6A1Ex12NM_001848.2:c.956A>Gp.Lys319Arg | p.K319RLRG_475t1:c.956A>G, NM_001848.2:c.956A>GVOUS01/26/2017
143COL6A1Ex12NM_001848.2:c.957G>Ap.Lys319= | p.K319=LRG_475t1:c.957G>A, NM_001848.2:c.957G>AVOUS12/25/2016
144COL6A1Ex12NM_001848.2:c.957_957+7delGGTGAGCGPathogenic12/14/2015 
145COL6A1Ex12NM_001848.2:c.957+1G>ALRG_475t1:c.957+1G>A, NM_001848.2:c.957+1G>APathogenic09/03/2016 
146COL6A1Ex12NM_001848.2:c.957+2T>CNM_001848.2:c.957+2T>CPathogenic08/06/2014 
147COL6A1Ex12NM_001848.2:c.957+6C>TLRG_475t1:c.957+6C>T, NM_001848.2:c.957+6C>TVOUS06/14/2016
148COL6A1Ex12NM_001848.2:c.957+6C>GLRG_475t1:c.957+6C>G, NM_001848.2:c.957+6C>GVOUS03/24/2016
149COL6A1Ex12NM_001848.2:c.957+7G>CNM_001848.2:c.957+7G>CVOUS10/07/2015
150COL6A1Ex12NM_001848.2:c.957+7G>ANM_001848.2:c.957+7G>AVOUS07/17/2015
151COL6A1Ex13NM_001848.2:c.958-17G>ABenign08/28/2012 
152COL6A1Ex13NM_001848.2:c.958-10C>TLRG_475t1:c.958-10C>T, NM_001848.2:c.958-10C>TVOUS04/20/2018
153COL6A1Ex13NM_001848.2:c.958-9G>ALRG_475t1:c.958-9G>A, NM_001848.2:c.958-9G>AVOUS06/08/2018
154COL6A1Ex13NM_001848.2:c.974G>Ap.Arg325His | p.R325HLRG_475t1:c.974G>A, NM_001848.2:c.974G>AVOUS04/13/2017
155COL6A1Ex13NM_001848.2:c.981C>Tp.Ile327= | p.I327=LRG_475t1:c.981C>T, NM_001848.2:c.981C>TLikely benign10/10/2017 
156COL6A1Ex13NM_001848.2:c.993C>Tp.Asp331= | p.D331=LRG_475t1:c.993C>T, NM_001848.2:c.993C>TVOUS01/04/2019
157COL6A1Ex13NM_001848.2:c.996C>Tp.Gly332= | p.G332=LRG_475t1:c.996C>T, NM_001848.2:c.996C>TVOUS12/04/2018
158COL6A1Ex13NM_001848.2:c.997G>Ap.Val333Met | p.V333MLRG_475t1:c.997G>A, NM_001848.2:c.997G>ALikely benign07/21/2015 
159COL6A1Ex13NM_001848.2:c.1002+1G>TLRG_475t1:c.1002+1G>T, NM_001848.2:c.1002+1G>TPathogenic05/06/2016 
160COL6A1Ex13NM_001848.2:c.1002+1G>ALRG_475t1:c.1002+1G>A, NM_001848.2:c.1002+1G>APathogenic05/09/2016 
161COL6A1Ex13NM_001848.2:c.1002+2T>GLRG_475t1:c.1002+2T>G, NM_001848.2:c.1002+2T>GPathogenic01/06/2017 
162COL6A1Ex13NM_001848.2:c.1002+37A>GBenign09/07/2012 
163COL6A1Ex13NM_001848.2:c.1002+42_1002+43insGACGGGGAGGGATGGGGTGGACAGTGTGAAGGTGACCGGGAGG...(con't)Benign09/07/2012 
164COL6A1Ex13NM_001848.2:c.1002+43A>GBenign09/07/2012 
165COL6A1Ex13NM_001848.2:c.1002+43_1002+52delAATGGGGCGABenign09/07/2012 
166COL6A1Ex13NM_001848.2:c.1002+43_1002+81delAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGALRG_475t1:c.1002+43_1002+81delAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGA, NM_001848.2:c.1002+43_1002+81delAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGABenign09/07/2012 
167COL6A1Ex13NM_001848.2:c.1002+45T>CBenign09/07/2012 
168COL6A1Ex13NM_001848.2:c.1002+50C>TLRG_475t1:c.1002+50C>T, NM_001848.2:c.1002+50C>TBenign09/07/2012 
169COL6A1Ex13NM_001848.2:c.1002+50C>ABenign09/07/2012 
170COL6A1Ex14NM_001848.2:c.1003-12_1006delTCCTCTTTCCAGGGGGinsGGALRG_475t1:c.1003-12_1006delinsGGA, NM_001848.2:c.1003-12_1006delinsGGAPathogenic03/16/2016 
171COL6A1Ex14NM_001848.2:c.1003-10C>TLRG_475t1:c.1003-10C>T, NM_001848.2:c.1003-10C>TVOUS11/06/2016
172COL6A1Ex14NM_001848.2:c.1003-2delALRG_475t1:c.1003-2delA, NM_001848.2:c.1003-2delAPathogenic03/20/2017 
173COL6A1Ex14NM_001848.2:c.1003-1G>ANM_001848.2:c.1003-1G>APathogenic02/08/2016 
174COL6A1Ex14NM_001848.2:c.1011G>Tp.Met337Ile | p.M337ILRG_475t1:c.1011G>T, NM_001848.2:c.1011G>TVOUS09/20/2018
175COL6A1Ex14NM_001848.2:c.1013G>Ap.Gly338Glu | p.G338ELRG_475t1:c.1013G>A, NM_001848.2:c.1013G>APathogenic06/05/2017 
176COL6A1Ex14NM_001848.2:c.1015T>Cp.Tyr339His | p.Y339HLRG_475t1:c.1015T>C, NM_001848.2:c.1015T>CVOUS04/19/2018
177COL6A1Ex14NM_001848.2:c.1021G>Tp.Gly341Cys | p.G341CLRG_475t1:c.1021G>T, NM_001848.2:c.1021G>TPathogenic02/09/2016 
178COL6A1Ex14NM_001848.2:c.1022G>Tp.Gly341Val | p.G341VLRG_475t1:c.1022G>T, NM_001848.2:c.1022G>TPathogenic11/30/2018 
179COL6A1Ex14NM_001848.2:c.1024_1032delCTGCCAGGCp.Leu342_Gly344del | p.L342_G344delLRG_475t1:c.1024_1032delCTGCCAGGC, NM_001848.2:c.1024_1032delCTGCCAGGCVOUS11/18/2017
180COL6A1Ex14NM_001848.2:c.1039_1052delGGCTCGCCCGGGTTp.Gly347* | p.G347XLRG_475t1:c.1039_1052delGGCTCGCCCGGGTT, NM_001848.2:c.1039_1052delGGCTCGCCCGGGTTPathogenic02/02/2016 
181COL6A1Ex14NM_001848.2:c.1043C>Tp.Ser348Leu | p.S348LLRG_475t1:c.1043C>T, NM_001848.2:c.1043C>TVOUS03/23/2020
182COL6A1Ex14NM_001848.2:c.1056C>Tp.Asp352= | p.D352=LRG_475t1:c.1056C>T, NM_001848.2:c.1056C>TBenign05/22/2019 
183COL6A1Ex14NM_001848.2:c.1056+1G>ALRG_475t1:c.1056+1G>A, NM_001848.2:c.1056+1G>APathogenic11/09/2018 
184COL6A1Ex14NM_001848.2:c.1056+1delGLRG_475t1:c.1056+1delG, NM_001848.2:c.1056+1delGPathogenic01/13/2017 
185COL6A1Ex14NM_001848.2:c.1056+4A>GLRG_475t1:c.1056+4A>G, NM_001848.2:c.1056+4A>GVOUS03/14/2016
186COL6A1Ex14NM_001848.2:c.1056+5G>TLRG_475t1:c.1056+5G>T, NM_001848.2:c.1056+5G>TVOUS09/02/2016
187COL6A1Ex15NM_001848.2:c.1075_1076delGGinsAAp.Gly359Asn | p.G359NLRG_475t1:c.1075_1076delinsAA, NM_001848.2:c.1075_1076delinsAALikely pathogenic09/22/2015 
188COL6A1Ex15NM_001848.2:c.1092C>Tp.Pro364= | p.P364=NM_001848.2:c.1092C>TVOUS01/25/2016
189COL6A1Ex15NM_001848.2:c.1095T>Cp.Gly365= | p.G365=NM_001848.2:c.1095T>CBenign10/14/2014 
190COL6A1Ex15NM_001848.2:c.1096G>Ap.Ala366Thr | p.A366TLRG_475t1:c.1096G>A, NM_001848.2:c.1096G>AVOUS10/01/2018
191COL6A1Ex15NM_001848.2:c.1115A>Gp.Glu372Gly | p.E372GLRG_475t1:c.1115A>G, NM_001848.2:c.1115A>GVOUS03/29/2018
192COL6A1Ex15NM_001848.2:c.1119+39C>TBenign09/05/2012 
193COL6A1Ex16NM_001848.2:c.1120-12G>ABenign08/27/2012 
194COL6A1Ex16NM_001848.2:c.1122C>Tp.Gly374= | p.G374=LRG_475t1:c.1122C>T, NM_001848.2:c.1122C>TVOUS11/29/2016
195COL6A1Ex16NM_001848.2:c.1164G>Ap.Ser388= | p.S388=LRG_475t1:c.1164G>A, NM_001848.2:c.1164G>AVOUS05/25/2016
196COL6A1Ex16NM_001848.2:c.1182+3G>ANM_001848.2:c.1182+3G>ABenign03/10/2014 
197COL6A1Ex17NM_001848.2:c.1186C>Gp.Gln396Glu | p.Q396ELRG_475t1:c.1186C>G, NM_001848.2:c.1186C>GVOUS10/22/2018
198COL6A1Ex17NM_001848.2:c.1226C>Ap.Ala409Glu | p.A409ELRG_475t1:c.1226C>A, NM_001848.2:c.1226C>AVOUS03/10/2016
199COL6A1Ex17NM_001848.2:c.1231G>Ap.Asp411Asn | p.D411NLRG_475t1:c.1231G>A, NM_001848.2:c.1231G>AVOUS04/02/2018
200COL6A1Ex17NM_001848.2:c.1233C>Tp.Asp411= | p.D411=NM_001848.2:c.1233C>TVOUS10/26/2015
201COL6A1Ex17NM_001848.2:c.1234G>Ap.Glu412Lys | p.E412KLRG_475t1:c.1234G>A, NM_001848.2:c.1234G>AVOUS08/23/2016
202COL6A1Ex17NM_001848.2:c.1236+2T>GLRG_475t1:c.1236+2T>G, NM_001848.2:c.1236+2T>GVOUS05/12/2017
203COL6A1Ex17NM_001848.2:c.1236+5G>ALRG_475t1:c.1236+5G>A, NM_001848.2:c.1236+5G>AVOUS05/10/2017
204COL6A1Ex18NM_001848.2:c.1254C>Tp.Asp418= | p.D418=LRG_475t1:c.1254C>T, NM_001848.2:c.1254C>TVOUS02/28/2017
205COL6A1Ex18NM_001848.2:c.1255G>Ap.Gly419Ser | p.G419SLRG_475t1:c.1255G>A, NM_001848.2:c.1255G>ALikely pathogenic12/31/2018 
206COL6A1Ex18NM_001848.2:c.1264G>Ap.Gly422Arg | p.G422RLRG_475t1:c.1264G>A, NM_001848.2:c.1264G>AVOUS06/25/2018
207COL6A1Ex19NM_001848.2:c.1273-8C>TNM_001848.2:c.1273-8C>TBenign08/27/2012 
208COL6A1Ex19NM_001848.2:c.1273-4T>CLRG_475t1:c.1273-4T>C, NM_001848.2:c.1273-4T>CVOUS04/12/2016
209COL6A1Ex19NM_001848.2:c.1285G>Ap.Glu429Lys | p.E429KLRG_475t1:c.1285G>A, NM_001848.2:c.1285G>AVOUS03/14/2017
210COL6A1Ex19NM_001848.2:c.1298G>Ap.Arg433Gln | p.R433QNM_001848.2:c.1298G>ABenign09/15/2015 
211COL6A1Ex19NM_001848.2:c.1314G>Ap.Thr438= | p.T438=Benign08/27/2012 
212COL6A1Ex19NM_001848.2:c.1316G>Ap.Arg439Gln | p.R439QBenign08/27/2012 
213COL6A1Ex19NM_001848.2:c.1335+20G>CNM_001848.2:c.1335+20G>CBenign04/01/2014 
214COL6A1Ex19NM_001848.2:c.1335+27A>CBenign08/27/2012 
215COL6A1Ex20NM_001848.2:c.1349C>Tp.Pro450Leu | p.P450LLRG_475t1:c.1349C>T, NM_001848.2:c.1349C>TVOUS06/03/2016
216COL6A1Ex20NM_001848.2:c.1350G>Ap.Pro450= | p.P450=LRG_475t1:c.1350G>A, NM_001848.2:c.1350G>AVOUS09/20/2018
217COL6A1Ex20NM_001848.2:c.1352A>Gp.Gln451Arg | p.Q451RLRG_475t1:c.1352A>G, NM_001848.2:c.1352A>GVOUS11/24/2015
218COL6A1Ex20NM_001848.2:c.1379T>Cp.Val460Ala | p.V460ALRG_475t1:c.1379T>C, NM_001848.2:c.1379T>CVOUS05/25/2018
219COL6A1Ex20NM_001848.2:c.1398G>Ap.Pro466= | p.P466=LRG_475t1:c.1398G>A, NM_001848.2:c.1398G>AVOUS02/04/2019
220COL6A1Ex20NM_001848.2:c.1398+10G>ALRG_475t1:c.1398+10G>A, NM_001848.2:c.1398+10G>AVOUS12/28/2017
221COL6A1Ex21NM_001848.2:c.1399-32T>CBenign08/24/2012 
222COL6A1Ex21NM_001848.2:c.1399-8C>GLRG_475t1:c.1399-8C>G, NM_001848.2:c.1399-8C>GVOUS10/28/2016
223COL6A1Ex21NM_001848.2:c.1399-3C>TLRG_475t1:c.1399-3C>T, NM_001848.2:c.1399-3C>TVOUS12/03/2018
224COL6A1Ex21NM_001848.2:c.1412C>Tp.Pro471Leu | p.P471LLRG_475t1:c.1412C>T, NM_001848.2:c.1412C>TVOUS09/14/2017
225COL6A1Ex21NM_001848.2:c.1425delAp.Gly476Alafs*29 | p.G476AfsX29LRG_475t1:c.1425delA, NM_001848.2:c.1425delAPathogenic01/16/2019 
226COL6A1Ex21NM_001848.2:c.1437C>Tp.Gly479= | p.G479=NM_001848.2:c.1437C>TVOUS10/26/2015
227COL6A1Ex21NM_001848.2:c.1443G>Ap.Glu481= | p.E481=Benign07/17/2012 
228COL6A1Ex21NM_001848.2:c.1451C>Tp.Pro484Leu | p.P484LLRG_475t1:c.1451C>T, NM_001848.2:c.1451C>TVOUS07/12/2018
229COL6A1Ex21NM_001848.2:c.1461G>Cp.Glu487Asp | p.E487DLRG_475t1:c.1461G>C, NM_001848.2:c.1461G>CVOUS03/09/2017
230COL6A1Ex21NM_001848.2:c.1461+7C>TLRG_475t1:c.1461+7C>T, NM_001848.2:c.1461+7C>TVOUS06/11/2018
231COL6A1Ex21NM_001848.2:c.1461+18C>ANM_001848.2:c.1461+18C>ABenign10/14/2014 
232COL6A1Ex21NM_001848.2:c.1461+41dupGBenign08/24/2012 
233COL6A1Ex22NM_001848.2:c.1462-36A>GBenign08/24/2012 
234COL6A1Ex22NM_001848.2:c.1477C>Ap.Pro493Thr | p.P493TNM_001848.2:c.1477C>AVOUS10/06/2015
235COL6A1Ex22NM_001848.2:c.1505C>Tp.Pro502Leu | p.P502LVOUS09/05/2012
236COL6A1Ex22NM_001848.2:c.1509G>Ap.Gly503= | p.G503=LRG_475t1:c.1509G>A, NM_001848.2:c.1509G>AVOUS11/11/2016
237COL6A1Ex22NM_001848.2:c.1518T>Cp.Gly506= | p.G506=Benign08/24/2012 
238COL6A1Ex22NM_001848.2:c.1524+15G>ABenign08/24/2012 
239COL6A1Ex22NM_001848.2:c.1524+19G>CBenign07/31/2012 
240COL6A1Ex23NM_001848.2:c.1525-60A>GBenign08/24/2012 
241COL6A1Ex23NM_001848.2:c.1525-9C>TLRG_475t1:c.1525-9C>T, NM_001848.2:c.1525-9C>TVOUS02/14/2018
242COL6A1Ex23NM_001848.2:c.1532A>Gp.Asp511Gly | p.D511GLRG_475t1:c.1532A>G, NM_001848.2:c.1532A>GVOUS08/10/2016
243COL6A1Ex23NM_001848.2:c.1539C>Tp.Pro513= | p.P513=LRG_475t1:c.1539C>T, NM_001848.2:c.1539C>TVOUS02/18/2016
244COL6A1Ex23NM_001848.2:c.1540G>Ap.Ala514Thr | p.A514TLRG_475t1:c.1540G>A, NM_001848.2:c.1540G>AVOUS09/30/2016
245COL6A1Ex23NM_001848.2:c.1553C>Ap.Thr518Asn | p.T518NLRG_475t1:c.1553C>A, NM_001848.2:c.1553C>AVOUS08/22/2016
246COL6A1Ex23NM_001848.2:c.1554C>Tp.Thr518= | p.T518=LRG_475t1:c.1554C>T, NM_001848.2:c.1554C>TVOUS02/09/2017
247COL6A1Ex23NM_001848.2:c.1555G>Ap.Glu519Lys | p.E519KLRG_475t1:c.1555G>A, NM_001848.2:c.1555G>AVOUS07/09/2015
248COL6A1Ex23NM_001848.2:c.1566C>Tp.Pro522= | p.P522=LRG_475t1:c.1566C>T, NM_001848.2:c.1566C>TVOUS05/25/2017
249COL6A1Ex23NM_001848.2:c.1567G>Ap.Gly523Ser | p.G523SLRG_475t1:c.1567G>A, NM_001848.2:c.1567G>AVOUS**
250COL6A1Ex23NM_001848.2:c.1575C>Tp.Pro525= | p.P525=LRG_475t1:c.1575C>T, NM_001848.2:c.1575C>TVOUS02/28/2018
251COL6A1Ex24NM_001848.2:c.1584G>Ap.Pro528= | p.P528=LRG_475t1:c.1584G>A, NM_001848.2:c.1584G>AVOUS10/25/2016
252COL6A1Ex24NM_001848.2:c.1602C>Tp.Pro534= | p.P534=LRG_475t1:c.1602C>T, NM_001848.2:c.1602C>TVOUS01/08/2019
253COL6A1Ex24NM_001848.2:c.1603G>Ap.Gly535Arg | p.G535RLRG_475t1:c.1603G>A, NM_001848.2:c.1603G>ALikely pathogenic11/16/2017 
254COL6A1Ex24NM_001848.2:c.1611C>Ap.Asn537Lys | p.N537KNM_001848.2:c.1611C>AVOUS02/09/2015
255COL6A1Ex24NM_001848.2:c.1611C>Tp.Asn537= | p.N537=LRG_475t1:c.1611C>T, NM_001848.2:c.1611C>TLikely benign09/01/2017 
256COL6A1Ex24NM_001848.2:c.1611+1G>ANM_001848.2:c.1611+1G>APathogenic10/14/2015 
257COL6A1Ex24NM_001848.2:c.1611+8C>TLRG_475t1:c.1611+8C>T, NM_001848.2:c.1611+8C>TVOUS07/14/2017
258COL6A1Ex25NM_001848.2:c.1612-10G>ANM_001848.2:c.1612-10G>ABenign05/22/2019 
259COL6A1Ex25NM_001848.2:c.1612-6C>TNM_001848.2:c.1612-6C>TBenign10/10/2012 
260COL6A1Ex25NM_001848.2:c.1612-5T>CLRG_475t1:c.1612-5T>C, NM_001848.2:c.1612-5T>CVOUS01/04/2019
261COL6A1Ex25NM_001848.2:c.1612-5T>ALRG_475t1:c.1612-5T>A, NM_001848.2:c.1612-5T>AVOUS02/08/2019
262COL6A1Ex25NM_001848.2:c.1641_1642delGGp.Asp548Argfs*11 | p.D548RfsX11LRG_475t1:c.1641_1642delGG, NM_001848.2:c.1641_1642delGGPathogenic12/19/2017 
263COL6A1Ex25NM_001848.2:c.1644C>Tp.Asp548= | p.D548=LRG_475t1:c.1644C>T, NM_001848.2:c.1644C>TLikely benign01/08/2017 
264COL6A1Ex25NM_001848.2:c.1656C>Tp.Ala552= | p.A552=NM_001848.2:c.1656C>TVOUS02/09/2016
265COL6A1Ex25NM_001848.2:c.1659G>Ap.Gly553= | p.G553=LRG_475t1:c.1659G>A, NM_001848.2:c.1659G>AVOUS05/25/2018
266COL6A1Ex25NM_001848.2:c.1665C>Tp.Pro555= | p.P555=LRG_475t1:c.1665C>T, NM_001848.2:c.1665C>TVOUS04/27/2018
267COL6A1Ex25NM_001848.2:c.1666G>Ap.Gly556Arg | p.G556RLRG_475t1:c.1666G>A, NM_001848.2:c.1666G>ALikely pathogenic03/23/2016 
268COL6A1Ex25NM_001848.2:c.1671C>Tp.Asp557= | p.D557=LRG_475t1:c.1671C>T, NM_001848.2:c.1671C>T, XR_132677.1:n.*4999G>AVOUS07/30/2018
269COL6A1Ex26NM_001848.2:c.1675-55C>TBenign08/24/2012 
270COL6A1Ex26NM_001848.2:c.1684A>Gp.Ile562Val | p.I562VLRG_475t1:c.1684A>G, NM_001848.2:c.1684A>G, XR_132677.1:n.*4793T>CVOUS08/03/2016
271COL6A1Ex26NM_001848.2:c.1693C>Tp.Arg565* | p.R565XLRG_475t1:c.1693C>T, NM_001848.2:c.1693C>T, XR_132677.1:n.*4784G>APathogenic04/04/2018 
272COL6A1Ex26NM_001848.2:c.1708G>Ap.Ala570Thr | p.A570TNM_001848.2:c.1708G>A, XR_132677.1:n.*4769C>TVOUS11/30/2015
273COL6A1Ex26NM_001848.2:c.1710A>Cp.Ala570= | p.A570=LRG_475t1:c.1710A>C, NM_001848.2:c.1710A>C, XR_132677.1:n.*4767T>GVOUS05/16/2018
274COL6A1Ex26NM_001848.2:c.1712A>Cp.Lys571Thr | p.K571TLRG_475t1:c.1712A>C, NM_001848.2:c.1712A>C, XR_132677.1:n.*4765T>GVOUS09/14/2017
275COL6A1Ex26NM_001848.2:c.1740+50C>TBenign09/07/2012 
276COL6A1Ex27NM_001848.2:c.1741-6G>ALRG_475t1:c.1741-6G>A, NM_001848.2:c.1741-6G>A, XR_132677.1:n.*4304C>TVOUS06/15/2017
277COL6A1Ex27NM_001848.2:c.1763C>Tp.Pro588Leu | p.P588LLRG_475t1:c.1763C>T, NM_001848.2:c.1763C>T, XR_132677.1:n.*4276G>AVOUS10/04/2017
278COL6A1Ex27NM_001848.2:c.1773G>Ap.Pro591= | p.P591=NM_001848.2:c.1773G>A, XR_132677.1:n.*4266C>TBenign08/24/2012 
279COL6A1Ex27NM_001848.2:c.1776C>Tp.Asp592= | p.D592=LRG_475t1:c.1776C>T, NM_001848.2:c.1776C>T, XR_132677.1:n.*4263G>ALikely benign01/03/2016 
280COL6A1Ex28NM_001848.2:c.1777-3C>TLRG_475t1:c.1777-3C>T, NM_001848.2:c.1777-3C>T, XR_132677.1:n.*3627G>AVOUS10/03/2018
281COL6A1Ex28NM_001848.2:c.1782C>Tp.Cys594= | p.C594=LRG_475t1:c.1782C>T, NM_001848.2:c.1782C>T, XR_132677.1:n.*3619G>AVOUS06/20/2017
282COL6A1Ex28NM_001848.2:c.1783G>Ap.Glu595Lys | p.E595KLRG_475t1:c.1783G>A, NM_001848.2:c.1783G>A, XR_132677.1:n.*3618C>TVOUS08/31/2016
283COL6A1Ex28NM_001848.2:c.1813+25T>GBenign09/07/2012 
284COL6A1Ex29NM_001848.2:c.1814-8C>TNM_001848.2:c.1814-8C>T, XR_132677.1:n.*3204G>AVOUS11/18/2015
285COL6A1Ex29NM_001848.2:c.1814-6C>GNM_001848.2:c.1814-6C>G, XR_132677.1:n.*3202G>CBenign08/24/2012 
286COL6A1Ex29NM_001848.2:c.1817G>Tp.Cys606Phe | p.C606FLRG_475t1:c.1817G>T, NM_001848.2:c.1817G>T, XR_132677.1:n.*3193C>AVOUS05/31/2016
287COL6A1Ex29NM_001848.2:c.1820G>Ap.Cys607Tyr | p.C607YNM_001848.2:c.1820G>A, XR_132677.1:n.*3190C>TVOUS09/03/2015
288COL6A1Ex29NM_001848.2:c.1822+42G>CBenign08/24/2012 
289COL6A1Ex29NM_001848.2:c.1822+45C>GBenign08/24/2012 
290COL6A1Ex29NM_001848.2:c.1822+45C>TLRG_475t1:c.1822+45C>T, NM_001848.2:c.1822+45C>T, XR_132677.1:n.*3143G>ABenign02/10/2017 
291COL6A1Ex29NM_001848.2:c.1822+80G>ABenign08/24/2012 
292COL6A1Ex29NM_001848.2:c.1822+88A>GBenign08/24/2012 
293COL6A1Ex30NM_001848.2:c.1823-31C>TBenign09/05/2012 
294COL6A1Ex30NM_001848.2:c.1823-9C>TNM_001848.2:c.1823-9C>T, XR_132677.1:n.*2711G>AVOUS10/17/2013
295COL6A1Ex30NM_001848.2:c.1823-8G>TLRG_475t1:c.1823-8G>T, NM_001848.2:c.1823-8G>T, XR_132677.1:n.*2710C>AVOUS02/13/2017
296COL6A1Ex30NM_001848.2:c.1823-8G>ALRG_475t1:c.1823-8G>A, NM_001848.2:c.1823-8G>A, XR_132677.1:n.*2710C>TBenign02/27/2015 
297COL6A1Ex30NM_001848.2:c.1825T>Cp.Cys609Arg | p.C609RLRG_475t1:c.1825T>C, NM_001848.2:c.1825T>C, XR_132677.1:n.*2700A>GVOUS11/17/2017
298COL6A1Ex30NM_001848.2:c.1829A>Cp.Lys610Thr | p.K610TNM_001848.2:c.1829A>C, XR_132677.1:n.*2696T>GVOUS08/14/2015
299COL6A1Ex30NM_001848.2:c.1830G>Tp.Lys610Asn | p.K610NLRG_475t1:c.1830G>T, NM_001848.2:c.1830G>T, XR_132677.1:n.*2695C>AVOUS05/05/2017
300COL6A1Ex30NM_001848.2:c.1833C>Tp.Cys611= | p.C611=Benign09/07/2012 
301COL6A1Ex30NM_001848.2:c.1837C>Ap.Pro613Thr | p.P613TLRG_475t1:c.1837C>A, NM_001848.2:c.1837C>A, XR_132677.1:n.*2688G>TVOUS03/08/2018
302COL6A1Ex30NM_001848.2:c.1848_1850delCCTp.Leu617del | p.L617delLRG_475t1:c.1848_1850delCCT, NM_001848.2:c.1848_1850delCCT, XR_132677.1:n.*2675_*2677delAGGVOUS10/23/2017
303COL6A1Ex30NM_001848.2:c.1898T>Cp.Ile633Thr | p.I633TLRG_475t1:c.1898T>C, NM_001848.2:c.1898T>C, XR_132677.1:n.*2627A>GVOUS01/17/2018
304COL6A1Ex30NM_001848.2:c.1906G>Ap.Asp636Asn | p.D636NLRG_475t1:c.1906G>A, NM_001848.2:c.1906G>A, XR_132677.1:n.*2619C>TVOUS02/11/2018
305COL6A1Ex30NM_001848.2:c.1908C>Gp.Asp636Glu | p.D636ELRG_475t1:c.1908C>G, NM_001848.2:c.1908C>G, XR_132677.1:n.*2617G>CVOUS08/22/2016
306COL6A1Ex30NM_001848.2:c.1911C>Tp.Phe637= | p.F637=LRG_475t1:c.1911C>T, NM_001848.2:c.1911C>T, XR_132677.1:n.*2614G>AVOUS04/21/2016
307COL6A1Ex30NM_001848.2:c.1931G>Ap.Arg644Gln | p.R644QLRG_475t1:c.1931G>A, NM_001848.2:c.1931G>A, XR_132677.1:n.*2594C>TVOUS04/20/2018
308COL6A1Ex30NM_001848.2:c.1956+15C>TNM_001848.2:c.1956+15C>T, XR_132677.1:n.*2554G>ABenign10/14/2014 
309COL6A1Ex31NM_001848.2:c.1957-11C>TNM_001848.2:c.1957-11C>T, XR_132677.1:n.*2005G>ABenign10/14/2014 
310COL6A1Ex31NM_001848.2:c.1957-5C>TNM_001848.2:c.1957-5C>T, XR_132677.1:n.*1999G>ABenign10/14/2014 
311COL6A1Ex31NM_001848.2:c.1957-4A>GNM_001848.2:c.1957-4A>G, XR_132677.1:n.*1998T>CVOUS01/03/2016
312COL6A1Ex31NM_001848.2:c.1959C>Tp.Phe653= | p.F653=LRG_475t1:c.1959C>T, NM_001848.2:c.1959C>T, XR_132677.1:n.*1992G>AVOUS12/04/2018
313COL6A1Ex31NM_001848.2:c.1973C>Tp.Ser658Leu | p.S658LLRG_475t1:c.1973C>T, NM_001848.2:c.1973C>T, XR_132677.1:n.*1978G>AVOUS01/06/2017
314COL6A1Ex31NM_001848.2:c.1980G>Ap.Ala660= | p.A660=LRG_475t1:c.1980G>A, NM_001848.2:c.1980G>A, XR_132677.1:n.*1971C>TVOUS07/13/2018
315COL6A1Ex31NM_001848.2:c.2029C>Tp.Arg677Cys | p.R677CLRG_475t1:c.2029C>T, NM_001848.2:c.2029C>T, XR_132677.1:n.*1922G>AVOUS08/23/2018
316COL6A1Ex31NM_001848.2:c.2034C>Tp.Ser678= | p.S678=LRG_475t1:c.2034C>T, NM_001848.2:c.2034C>T, XR_132677.1:n.*1917G>AVOUS06/16/2016
317COL6A1Ex31NM_001848.2:c.2035C>Tp.Pro679Ser | p.P679SLRG_475t1:c.2035C>T, NM_001848.2:c.2035C>T, XR_132677.1:n.*1916G>AVOUS10/17/2016
318COL6A1Ex31NM_001848.2:c.2042T>Cp.Ile681Thr | p.I681TBenign08/24/2012 
319COL6A1Ex31NM_001848.2:c.2044C>Tp.Arg682Trp | p.R682WLRG_475t1:c.2044C>T, NM_001848.2:c.2044C>T, XR_132677.1:n.*1907G>AVOUS11/29/2016
320COL6A1Ex31NM_001848.2:c.2045G>Ap.Arg682Gln | p.R682QLRG_475t1:c.2045G>A, NM_001848.2:c.2045G>A, XR_132677.1:n.*1906C>TVOUS08/17/2018
321COL6A1Ex31NM_001848.2:c.2049C>Tp.Asn683= | p.N683=LRG_475t1:c.2049C>T, NM_001848.2:c.2049C>T, XR_132677.1:n.*1902G>ALikely benign01/06/2017 
322COL6A1Ex31NM_001848.2:c.2050G>Ap.Val684Met | p.V684MLRG_475t1:c.2050G>A, NM_001848.2:c.2050G>A, XR_132677.1:n.*1901C>TVOUS03/22/2018
323COL6A1Ex31NM_001848.2:c.2050G>Tp.Val684Leu | p.V684LLRG_475t1:c.2050G>T, NM_001848.2:c.2050G>T, XR_132677.1:n.*1901C>AVOUS01/11/2017
324COL6A1Ex31NM_001848.2:c.2061C>ABenign08/24/2012 
325COL6A1Ex32NM_001848.2:c.2067-10T>CBenign09/07/2012 
326COL6A1Ex32NM_001848.2:c.2091G>Ap.Met697Ile | p.M697IVOUS08/23/2012
327COL6A1Ex32NM_001848.2:c.2097C>Tp.Gly699= | p.G699=LRG_475t1:c.2097C>T, NM_001848.2:c.2097C>T, XR_132677.1:n.*1707G>AVOUS05/16/2018
328COL6A1Ex32NM_001848.2:c.2109G>Ap.Thr703= | p.T703=LRG_475t1:c.2109G>A, NM_001848.2:c.2109G>A, XR_132677.1:n.*1695C>TVOUS05/18/2016
329COL6A1Ex32NM_001848.2:c.2122C>Tp.Gln708* | p.Q708XLRG_475t1:c.2122C>T, NM_001848.2:c.2122C>T, XR_132677.1:n.*1682G>APathogenic06/22/2018 
330COL6A1Ex32NM_001848.2:c.2129C>Tp.Thr710Met | p.T710MLRG_475t1:c.2129C>T, NM_001848.2:c.2129C>T, XR_132677.1:n.*1675G>AVOUS11/16/2017
331COL6A1Ex32NM_001848.2:c.2130G>Ap.Thr710= | p.T710=Benign09/13/2012 
332COL6A1Ex32NM_001848.2:c.2132G>Ap.Arg711Gln | p.R711QLRG_475t1:c.2132G>A, NM_001848.2:c.2132G>A, XR_132677.1:n.*1672C>TVOUS12/15/2015
333COL6A1Ex32NM_001848.2:c.2147C>Tp.Pro716Leu | p.P716LLRG_475t1:c.2147C>T, NM_001848.2:c.2147C>T, XR_132677.1:n.*1657G>AVOUS06/14/2017
334COL6A1Ex32NM_001848.2:c.2148G>Ap.Pro716= | p.P716=NM_001848.2:c.2148G>A, XR_132677.1:n.*1656C>TVOUS01/23/2016
335COL6A1Ex32NM_001848.2:c.2151C>Tp.Pro717= | p.P717=NM_001848.2:c.2151C>T, XR_132677.1:n.*1653G>AVOUS12/08/2015
336COL6A1Ex32NM_001848.2:c.2156C>Tp.Pro719Leu | p.P719LNM_001848.2:c.2156C>T, XR_132677.1:n.*1648G>AVOUS09/17/2015
337COL6A1Ex32NM_001848.2:c.2160dupCp.Asn721Glnfs*9 | p.N721QfsX9LRG_475t1:c.2160_2161insC, LRG_475t1:c.2160dupC, NM_001848.2:c.2160_2161insC, NM_001848.2:c.2160dupC, XR_132677.1:n.*1643_*1644insG, XR_132677.1:n.*1644dupGPathogenic02/23/2017 
338COL6A1Ex32NM_001848.2:c.2165G>Ap.Arg722His | p.R722HLRG_475t1:c.2165G>A, NM_001848.2:c.2165G>A, XR_132677.1:n.*1639C>TVOUS02/02/2016
339COL6A1Ex32NM_001848.2:c.2187C>Tp.Asp729= | p.D729=LRG_475t1:c.2187C>T, NM_001848.2:c.2187C>T, XR_132677.1:n.*1617G>AVOUS10/04/2018
340COL6A1Ex32NM_001848.2:c.2190G>Ap.Gly730= | p.G730=LRG_475t1:c.2190G>A, NM_001848.2:c.2190G>A, XR_132677.1:n.*1614C>TVOUS08/11/2017
341COL6A1Ex32NM_001848.2:c.2191C>Tp.Arg731Cys | p.R731CLRG_475t1:c.2191C>T, NM_001848.2:c.2191C>T, XR_132677.1:n.*1613G>AVOUS05/14/2018
342COL6A1Ex32NM_001848.2:c.2195C>Tp.Ser732Leu | p.S732LLRG_475t1:c.2195C>T, NM_001848.2:c.2195C>T, XR_132677.1:n.*1609G>AVOUS09/28/2016
343COL6A1Ex32NM_001848.2:c.2200A>Gp.Thr734Ala | p.T734ALRG_475t1:c.2200A>G, NM_001848.2:c.2200A>G, XR_132677.1:n.*1604T>CVOUS06/13/2018
344COL6A1Ex32NM_001848.2:c.2220G>Tp.Pro740= | p.P740=LRG_475t1:c.2220G>T, NM_001848.2:c.2220G>T, XR_132677.1:n.*1584C>AVOUS03/22/2017
345COL6A1Ex32NM_001848.2:c.2220G>Ap.Pro740= | p.P740=NM_001848.2:c.2220G>A, XR_132677.1:n.*1584C>TLikely benign05/04/2015 
346COL6A1Ex32NM_001848.2:c.2227G>Ap.Val743Met | p.V743MLRG_475t1:c.2227G>A, NM_001848.2:c.2227G>A, XR_132677.1:n.*1577C>TVOUS04/09/2021
347COL6A1Ex32NM_001848.2:c.2250+6G>CNM_001848.2:c.2250+6G>C, XR_132677.1:n.*1548C>GBenign12/09/2015 
348COL6A1Ex33NM_001848.2:c.2251-29C>TBenign08/23/2012 
349COL6A1Ex33NM_001848.2:c.2251-6C>TLRG_475t1:c.2251-6C>T, NM_001848.2:c.2251-6C>T, XR_132677.1:n.*1434G>AVOUS01/13/2017
350COL6A1Ex33NM_001848.2:c.2263G>Ap.Gly755Ser | p.G755SLRG_475t1:c.2263G>A, NM_001848.2:c.2263G>A, XR_132677.1:n.*1416C>TVOUS03/16/2016
351COL6A1Ex33NM_001848.2:c.2285T>Cp.Phe762Ser | p.F762SLRG_475t1:c.2285T>C, NM_001848.2:c.2285T>C, XR_132677.1:n.*1394A>GVOUS03/29/2021
352COL6A1Ex33NM_001848.2:c.2304G>Cp.Gln768His | p.Q768HLRG_475t1:c.2304G>C, NM_001848.2:c.2304G>C, XR_132677.1:n.*1375C>GVOUS08/31/2017
353COL6A1Ex33NM_001848.2:c.2309A>Gp.Asn770Ser | p.N770SLRG_475t1:c.2309A>G, NM_001848.2:c.2309A>G, XR_132677.1:n.*1370T>CVOUS12/04/2015
354COL6A1Ex33NM_001848.2:c.2348G>Ap.Arg783Gln | p.R783QLRG_475t1:c.2348G>A, NM_001848.2:c.2348G>A, XR_132677.1:n.*1331C>TLikely benign09/22/2016 
355COL6A1Ex33NM_001848.2:c.2349G>Tp.Arg783= | p.R783=LRG_475t1:c.2349G>T, NM_001848.2:c.2349G>T, XR_132677.1:n.*1330C>AVOUS09/14/2016
356COL6A1Ex33NM_001848.2:c.2355C>Ap.Gly785= | p.G785=LRG_475t1:c.2355C>A, NM_001848.2:c.2355C>A, XR_132677.1:n.*1324G>TVOUS07/03/2017
357COL6A1Ex33NM_001848.2:c.2358C>Tp.Leu786= | p.L786=NM_001848.2:c.2358C>T, XR_132677.1:n.*1321G>AVOUS08/06/2015
358COL6A1Ex33NM_001848.2:c.2360C>Tp.Ser787Leu | p.S787LLRG_475t1:c.2360C>T, NM_001848.2:c.2360C>T, XR_132677.1:n.*1319G>AVOUS01/03/2017
359COL6A1Ex33NM_001848.2:c.2413G>Ap.Val805Ile | p.V805ILRG_475t1:c.2413G>A, NM_001848.2:c.2413G>A, XR_132677.1:n.*1266C>TVOUS03/01/2016
360COL6A1Ex33NM_001848.2:c.2418C>Tp.Thr806= | p.T806=NM_001848.2:c.2418C>T, XR_132677.1:n.*1261G>AVOUS07/29/2015
361COL6A1Ex33NM_001848.2:c.2424G>Tp.Gln808His | p.Q808HNM_001848.2:c.2424G>T, XR_132677.1:n.*1255C>ABenign11/04/2013 
362COL6A1Ex33NM_001848.2:c.2434+15A>GLRG_475t1:c.2434+15A>G, NM_001848.2:c.2434+15A>G, XR_132677.1:n.*1230T>CBenign12/09/2015 
363COL6A1Ex33NM_001848.2:c.2434+20G>ALRG_475t1:c.2434+20G>A, NM_001848.2:c.2434+20G>A, XR_132677.1:n.*1225C>TBenign12/09/2015 
364COL6A1Ex33NM_001848.2:c.2434+55G>ABenign08/23/2012 
365COL6A1Ex34NM_001848.2:c.2435-36A>CVOUS08/23/2012
366COL6A1Ex34NM_001848.2:c.2435-19C>TLRG_475t1:c.2435-19C>T, NM_001848.2:c.2435-19C>T, XR_132677.1:n.*854G>ABenign08/23/2012 
367COL6A1Ex34NM_001848.2:c.2435-2A>GLRG_475t1:c.2435-2A>G, NM_001848.2:c.2435-2A>G, XR_132677.1:n.*837T>CPathogenic03/02/2017 
368COL6A1Ex34NM_001848.2:c.2441A>Gp.Lys814Arg | p.K814RNM_001848.2:c.2441A>G, XR_132677.1:n.*829T>CBenign12/19/2013 
369COL6A1Ex34NM_001848.2:c.2442G>Ap.Lys814= | p.K814=LRG_475t1:c.2442G>A, NM_001848.2:c.2442G>A, XR_132677.1:n.*828C>TVOUS04/19/2018
370COL6A1Ex34NM_001848.2:c.2464+9C>TLRG_475t1:c.2464+9C>T, NM_001848.2:c.2464+9C>T, XR_132677.1:n.*797G>AVOUS09/26/2018
371COL6A1Ex35NM_001848.2:c.*8T>GNM_001848.2:c.*8T>G, XR_132677.1:n.618A>CVOUS09/03/2015
372COL6A1Ex35NM_001848.2:c.2465-7C>TLRG_475t1:c.2465-7C>T, NM_001848.2:c.2465-7C>T, XR_132677.1:n.*571G>AVOUS07/27/2017
373COL6A1Ex35NM_001848.2:c.2468C>Tp.Thr823Met | p.T823MLRG_475t1:c.2468C>T, NM_001848.2:c.2468C>T, XR_132677.1:n.*561G>AVOUS06/22/2016
374COL6A1Ex35NM_001848.2:c.2469G>Ap.Thr823= | p.T823=LRG_475t1:c.2469G>A, NM_001848.2:c.2469G>A, XR_132677.1:n.*560C>TLikely benign06/20/2018 
375COL6A1Ex35NM_001848.2:c.2507G>Ap.Gly836Asp | p.G836DLRG_475t1:c.2507G>A, NM_001848.2:c.2507G>A, XR_132677.1:n.*522C>TVOUS09/16/2014
376COL6A1Ex35NM_001848.2:c.2517C>Tp.Ser839= | p.S839=NM_001848.2:c.2517C>T, XR_132677.1:n.*512G>ABenign10/10/2012 
377COL6A1Ex35NM_001848.2:c.2549G>Ap.Arg850His | p.R850HLRG_475t1:c.2549G>A, NM_001848.2:c.2549G>A, XR_132677.1:n.*480C>TBenign07/17/2012 
378COL6A1Ex35NM_001848.2:c.2553C>Tp.Phe851= | p.F851=NM_001848.2:c.2553C>T, XR_132677.1:n.*476G>AVOUS02/01/2016
379COL6A1Ex35NM_001848.2:c.2554G>Cp.Ala852Pro | p.A852PNM_001848.2:c.2554G>C, XR_132677.1:n.*475C>GVOUS01/25/2016
380COL6A1Ex35NM_001848.2:c.2561G>Ap.Arg854His | p.R854HLRG_475t1:c.2561G>A, NM_001848.2:c.2561G>A, XR_132677.1:n.*468C>TVOUS12/13/2016
381COL6A1Ex35NM_001848.2:c.2585C>Tp.Ala862Val | p.A862VLRG_475t1:c.2585C>T, NM_001848.2:c.2585C>T, XR_132677.1:n.*444G>AVOUS02/16/2017
382COL6A1Ex35NM_001848.2:c.2592G>Ap.Arg864= | p.R864=LRG_475t1:c.2592G>A, NM_001848.2:c.2592G>A, XR_132677.1:n.*437C>TVOUS01/05/2017
383COL6A1Ex35NM_001848.2:c.2595G>Cp.Thr865= | p.T865=LRG_475t1:c.2595G>C, NM_001848.2:c.2595G>C, XR_132677.1:n.*434C>GVOUS03/17/2016
384COL6A1Ex35NM_001848.2:c.2595G>Ap.Thr865= | p.T865=LRG_475t1:c.2595G>A, NM_001848.2:c.2595G>A, XR_132677.1:n.*434C>TVOUS09/03/2015
385COL6A1Ex35NM_001848.2:c.2601C>Tp.Pro867= | p.P867=LRG_475t1:c.2601C>T, NM_001848.2:c.2601C>T, XR_132677.1:n.*428G>AVOUS12/11/2017
386COL6A1Ex35NM_001848.2:c.2607C>Gp.His869Gln | p.H869QNM_001848.2:c.2607C>G, XR_132677.1:n.*422G>CVOUS12/08/2015
387COL6A1Ex35NM_001848.2:c.2610C>Tp.Asp870= | p.D870=LRG_475t1:c.2610C>T, NM_001848.2:c.2610C>T, XR_132677.1:n.*419G>AVOUS05/12/2016
388COL6A1Ex35NM_001848.2:c.2611G>Ap.Val871Met | p.V871MLRG_475t1:c.2611G>A, NM_001848.2:c.2611G>A, XR_132677.1:n.*418C>TVOUS09/14/2018
389COL6A1Ex35NM_001848.2:c.2614C>Tp.Arg872Trp | p.R872WLRG_475t1:c.2614C>T, NM_001848.2:c.2614C>T, XR_132677.1:n.*415G>AVOUS11/09/2018
390COL6A1Ex35NM_001848.2:c.2622G>Ap.Ala874= | p.A874=NM_001848.2:c.2622G>A, XR_132677.1:n.*407C>TLikely benign09/15/2015 
391COL6A1Ex35NM_001848.2:c.2626G>Ap.Val876Met | p.V876MLRG_475t1:c.2626G>A, NM_001848.2:c.2626G>A, XR_132677.1:n.*403C>TVOUS06/14/2018
392COL6A1Ex35NM_001848.2:c.2635A>Gp.Ser879Gly | p.S879GLRG_475t1:c.2635A>G, NM_001848.2:c.2635A>G, XR_132677.1:n.*394T>CBenign08/02/2016 
393COL6A1Ex35NM_001848.2:c.2637C>Tp.Ser879= | p.S879=LRG_475t1:c.2637C>T, NM_001848.2:c.2637C>T, XR_132677.1:n.*392G>AVOUS05/05/2017
394COL6A1Ex35NM_001848.2:c.2642C>Tp.Thr881Met | p.T881MLRG_475t1:c.2642C>T, NM_001848.2:c.2642C>T, XR_132677.1:n.*387G>ALikely benign10/26/2016 
395COL6A1Ex35NM_001848.2:c.2643G>Ap.Thr881= | p.T881=LRG_475t1:c.2643G>A, NM_001848.2:c.2643G>A, XR_132677.1:n.*386C>TVOUS10/02/2017
396COL6A1Ex35NM_001848.2:c.2653C>Tp.Arg885Cys | p.R885CLRG_475t1:c.2653C>T, NM_001848.2:c.2653C>T, XR_132677.1:n.*376G>AVOUS09/27/2017
397COL6A1Ex35NM_001848.2:c.2660A>Gp.Glu887Gly | p.E887GNM_001848.2:c.2660A>G, XR_132677.1:n.*369T>CVOUS11/20/2014
398COL6A1Ex35NM_001848.2:c.2662C>Tp.Arg888Trp | p.R888WLRG_475t1:c.2662C>T, NM_001848.2:c.2662C>T, XR_132677.1:n.*367G>AVOUS03/10/2020
399COL6A1Ex35NM_001848.2:c.2667G>Ap.Ala889= | p.A889=LRG_475t1:c.2667G>A, NM_001848.2:c.2667G>A, XR_132677.1:n.*362C>TBenign08/23/2012 
400COL6A1Ex35NM_001848.2:c.2669C>Tp.Ser890Leu | p.S890LLRG_475t1:c.2669C>T, NM_001848.2:c.2669C>T, XR_132677.1:n.*360G>ABenign10/14/2014 
401COL6A1Ex35NM_001848.2:c.2670G>Ap.Ser890= | p.S890=LRG_475t1:c.2670G>A, NM_001848.2:c.2670G>A, XR_132677.1:n.*359C>TVOUS12/19/2017
402COL6A1Ex35NM_001848.2:c.2694G>Ap.Thr898= | p.T898=LRG_475t1:c.2694G>A, NM_001848.2:c.2694G>A, XR_132677.1:n.*335C>TVOUS03/14/2018
403COL6A1Ex35NM_001848.2:c.2697C>Ap.Ala899= | p.A899=LRG_475t1:c.2697C>A, NM_001848.2:c.2697C>A, XR_132677.1:n.*332G>TVOUS07/19/2018
404COL6A1Ex35NM_001848.2:c.2709C>Tp.Ala903= | p.A903=LRG_475t1:c.2709C>T, NM_001848.2:c.2709C>T, XR_132677.1:n.*320G>AVOUS06/13/2016
405COL6A1Ex35NM_001848.2:c.2712C>Tp.Val904= | p.V904=LRG_475t1:c.2712C>T, NM_001848.2:c.2712C>T, XR_132677.1:n.*317G>AVOUS06/07/2018
406COL6A1Ex35NM_001848.2:c.2713G>Ap.Asp905Asn | p.D905NLRG_475t1:c.2713G>A, NM_001848.2:c.2713G>A, XR_132677.1:n.*316C>TVOUS07/12/2018
407COL6A1Ex35NM_001848.2:c.2733C>Tp.Asn911= | p.N911=LRG_475t1:c.2733C>T, NM_001848.2:c.2733C>T, XR_132677.1:n.*296G>AVOUS02/23/2016
408COL6A1Ex35NM_001848.2:c.2736C>Tp.Asp912= | p.D912=Benign08/23/2012 
409COL6A1Ex35NM_001848.2:c.2742C>Tp.Thr914= | p.T914=NM_001848.2:c.2742C>T, XR_132677.1:n.*287G>ABenign02/20/2015 
410COL6A1Ex35NM_001848.2:c.2746G>Ap.Val916Ile | p.V916ILRG_475t1:c.2746G>A, NM_001848.2:c.2746G>A, XR_132677.1:n.*283C>TVOUS07/12/2018
411COL6A1Ex35NM_001848.2:c.2752G>Ap.Asp918Asn | p.D918NLRG_475t1:c.2752G>A, NM_001848.2:c.2752G>A, XR_132677.1:n.*277C>TVOUS02/03/2017
412COL6A1Ex35NM_001848.2:c.2758C>Tp.Leu920= | p.L920=LRG_475t1:c.2758C>T, NM_001848.2:c.2758C>T, XR_132677.1:n.*271G>ALikely benign12/05/2016 
413COL6A1Ex35NM_001848.2:c.2765A>Gp.Tyr922Cys | p.Y922CNM_001848.2:c.2765A>G, XR_132677.1:n.*264T>CVOUS12/10/2015
414COL6A1Ex35NM_001848.2:c.2781C>Tp.Tyr927= | p.Y927=LRG_475t1:c.2781C>T, NM_001848.2:c.2781C>T, XR_132677.1:n.*248G>ABenign08/23/2012 
415COL6A1Ex35NM_001848.2:c.2783G>Ap.Arg928His | p.R928HBenign08/23/2012 
416COL6A1Ex35NM_001848.2:c.2783G>Tp.Arg928Leu | p.R928LLRG_475t1:c.2783G>T, NM_001848.2:c.2783G>T, XR_132677.1:n.*246C>AVOUS04/04/2018
417COL6A1Ex35NM_001848.2:c.2785G>Ap.Glu929Lys | p.E929KLRG_475t1:c.2785G>A, NM_001848.2:c.2785G>A, XR_132677.1:n.*244C>TVOUS06/01/2018
418COL6A1Ex35NM_001848.2:c.2793G>Ap.Ser931= | p.S931=LRG_475t1:c.2793G>A, NM_001848.2:c.2793G>A, XR_132677.1:n.*236C>TVOUS08/11/2016
419COL6A1Ex35NM_001848.2:c.2796C>Tp.Ser932= | p.S932=LRG_475t1:c.2796C>T, NM_001848.2:c.2796C>T, XR_132677.1:n.*233G>ABenign07/17/2012 
420COL6A1Ex35NM_001848.2:c.2797G>Ap.Gly933Ser | p.G933SLRG_475t1:c.2797G>A, NM_001848.2:c.2797G>A, XR_132677.1:n.*232C>TVOUS09/19/2017
421COL6A1Ex35NM_001848.2:c.2800G>Ap.Ala934Thr | p.A934TNM_001848.2:c.2800G>A, XR_132677.1:n.*229C>TVOUS01/08/2016
422COL6A1Ex35NM_001848.2:c.2803G>Ap.Ala935Thr | p.A935TLRG_475t1:c.2803G>A, NM_001848.2:c.2803G>A, XR_132677.1:n.*226C>TVOUS05/06/2016
423COL6A1Ex35NM_001848.2:c.2809A>Gp.Lys937Glu | p.K937ELRG_475t1:c.2809A>G, NM_001848.2:c.2809A>G, XR_132677.1:n.*220T>CVOUS07/19/2018
424COL6A1Ex35NM_001848.2:c.2810_2812delAGAp.Lys937del | p.K937delLRG_475t1:c.2810_2812delAGA, NM_001848.2:c.2810_2812delAGA, XR_132677.1:n.*217_*219delTCTVOUS03/17/2016
425COL6A1Ex35NM_001848.2:c.2820G>Ap.Leu940= | p.L940=LRG_475t1:c.2820G>A, NM_001848.2:c.2820G>A, XR_132677.1:n.*209C>TVOUS06/02/2017
426COL6A1Ex35NM_001848.2:c.2821C>Tp.Leu941Phe | p.L941FLRG_475t1:c.2821C>T, NM_001848.2:c.2821C>T, XR_132677.1:n.*208G>AVOUS05/04/2017
427COL6A1Ex35NM_001848.2:c.2848G>Ap.Ala950Thr | p.A950TLRG_475t1:c.2848G>A, NM_001848.2:c.2848G>A, XR_132677.1:n.*181C>TVOUS12/28/2016
428COL6A1Ex35NM_001848.2:c.2853G>Ap.Thr951= | p.T951=LRG_475t1:c.2853G>A, NM_001848.2:c.2853G>A, XR_132677.1:n.*176C>TVOUS10/31/2016
429COL6A1Ex35NM_001848.2:c.2855C>Tp.Pro952Leu | p.P952LLRG_475t1:c.2855C>T, NM_001848.2:c.2855C>T, XR_132677.1:n.*174G>AVOUS06/02/2017
430COL6A1Ex35NM_001848.2:c.2856C>Tp.Pro952= | p.P952=LRG_475t1:c.2856C>T, NM_001848.2:c.2856C>T, XR_132677.1:n.*173G>AVOUS10/13/2017
431COL6A1Ex35NM_001848.2:c.2857G>Ap.Ala953Thr | p.A953TLRG_475t1:c.2857G>A, NM_001848.2:c.2857G>A, XR_132677.1:n.*172C>TVOUS08/02/2018
432COL6A1Ex35NM_001848.2:c.2863A>Gp.Ile955Val | p.I955VLRG_475t1:c.2863A>G, NM_001848.2:c.2863A>G, XR_132677.1:n.*166T>CVOUS02/07/2017
433COL6A1Ex35NM_001848.2:c.2865C>Tp.Ile955= | p.I955=LRG_475t1:c.2865C>T, NM_001848.2:c.2865C>T, XR_132677.1:n.*164G>ABenign05/16/2017 
434COL6A1Ex35NM_001848.2:c.2866G>Ap.Glu956Lys | p.E956KNM_001848.2:c.2866G>A, XR_132677.1:n.*163C>TBenign08/19/2015 
435COL6A1Ex35NM_001848.2:c.2873C>Ap.Ala958Asp | p.A958DLRG_475t1:c.2873C>A, NM_001848.2:c.2873C>A, XR_132677.1:n.*156G>TVOUS12/25/2016
436COL6A1Ex35NM_001848.2:c.2875G>Ap.Val959Met | p.V959MLRG_475t1:c.2875G>A, NM_001848.2:c.2875G>A, XR_132677.1:n.*154C>TVOUS11/29/2018
437COL6A1Ex35NM_001848.2:c.2876T>Cp.Val959Ala | p.V959ALRG_475t1:c.2876T>C, NM_001848.2:c.2876T>C, XR_132677.1:n.*153A>GVOUS10/27/2017
438COL6A1Ex35NM_001848.2:c.2890C>Tp.Arg964Trp | p.R964WLRG_475t1:c.2890C>T, NM_001848.2:c.2890C>T, XR_132677.1:n.*139G>AVOUS02/09/2018
439COL6A1Ex35NM_001848.2:c.2891G>Ap.Arg964Gln | p.R964QNM_001848.2:c.2891G>A, XR_132677.1:n.*138C>TVOUS04/01/2015
440COL6A1Ex35NM_001848.2:c.2899A>Gp.Ile967Val | p.I967VLRG_475t1:c.2899A>G, NM_001848.2:c.2899A>G, XR_132677.1:n.*130T>CVOUS04/06/2017
441COL6A1Ex35NM_001848.2:c.2910C>Tp.Phe970= | p.F970=NM_001848.2:c.2910C>T, XR_132677.1:n.*119G>AVOUS09/22/2015
442COL6A1Ex35NM_001848.2:c.2914G>Ap.Val972Met | p.V972MLRG_475t1:c.2914G>A, NM_001848.2:c.2914G>A, XR_132677.1:n.*115C>TVOUS03/12/2018
443COL6A1Ex35NM_001848.2:c.2920G>Ap.Val974Met | p.V974MLRG_475t1:c.2920G>A, NM_001848.2:c.2920G>A, XR_132677.1:n.*109C>TVOUS11/15/2017
444COL6A1Ex35NM_001848.2:c.2953G>Ap.Val985Ile | p.V985ILRG_475t1:c.2953G>A, NM_001848.2:c.2953G>A, XR_132677.1:n.*76C>TVOUS07/26/2016
445COL6A1Ex35NM_001848.2:c.2968A>Cp.Lys990Gln | p.K990QLRG_475t1:c.2968A>C, NM_001848.2:c.2968A>C, XR_132677.1:n.*61T>GVOUS10/26/2017
446COL6A1Ex35NM_001848.2:c.2983G>Ap.Asp995Asn | p.D995NLRG_475t1:c.2983G>A, NM_001848.2:c.2983G>A, XR_132677.1:n.*46C>TVOUS06/27/2016
447COL6A1Ex35NM_001848.2:c.2986G>Ap.Val996Met | p.V996MNM_001848.2:c.2986G>A, XR_132677.1:n.*43C>TVOUS10/04/2015
448COL6A1Ex35NM_001848.2:c.2998G>Tp.Glu1000* | p.E1000XLRG_475t1:c.2998G>T, NM_001848.2:c.2998G>T, XR_132677.1:n.*31C>AVOUS11/16/2017
449COL6A1Ex35NM_001848.2:c.3009G>Ap.Leu1003= | p.L1003=NM_001848.2:c.3009G>A, XR_132677.1:n.*20C>TVOUS12/08/2015
450COL6A1Ex35NM_001848.2:c.3029A>Gp.Gln1010Arg | p.Q1010RLRG_475t1:c.3029A>G, NM_001848.2:c.3029A>G, XR_132677.1:n.684T>CLikely benign05/04/2017 
451COL6A1Ex35NM_001848.2:c.3054C>Tp.His1018= | p.H1018=LRG_475t1:c.3054C>T, NM_001848.2:c.3054C>T, XR_132677.1:n.659G>ABenign01/25/2018 
452COL6A1Ex35NM_001848.2:c.3056A>Gp.Gln1019Arg | p.Q1019RLRG_475t1:c.3056A>G, NM_001848.2:c.3056A>G, XR_132677.1:n.657T>CVOUS03/10/2016
453COL6A1Ex35NM_001848.2:c.3078G>Ap.Ala1026= | p.A1026=LRG_475t1:c.3078G>A, NM_001848.2:c.3078G>A, XR_132677.1:n.635C>TLikely benign06/14/2018 

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.