Loading Data . . .

EmVClass

EGL's Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by EGL Genetics for that gene.
EGL Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CFTREx1NM_000492.3:c.-2C>GLRG_663t1:c.-2C>G, NM_000492.3:c.-2C>GVOUS06/28/2019
2CFTREx1NM_000492.3:c.-4G>CLRG_663t1:c.-4G>C, NM_000492.3:c.-4G>CLikely benign05/18/2015 
3CFTREx1NM_000492.3:c.-8G>CLRG_663t1:c.-8G>C, NM_000492.3:c.-8G>CBenign07/06/2017 
4CFTREx1NM_000492.3:c.10T>Cp.Ser4Pro | p.S4PLRG_663t1:c.10T>C, NM_000492.3:c.10T>CVOUS03/05/2019
5CFTREx1NM_000492.3:c.14C>Tp.Pro5Leu | p.P5LLRG_663t1:c.14C>T, NM_000492.3:c.14C>TLikely pathogenic11/20/2017 
6CFTREx1NM_000492.3:c.19G>Tp.Glu7* | p.E7XLRG_663t1:c.19G>T, NM_000492.3:c.19G>TPathogenic05/16/2016 
7CFTREx1NM_000492.3:c.40A>Gp.Lys14Glu | p.K14ELRG_663t1:c.40A>G, NM_000492.3:c.40A>GVOUS12/28/2017
8CFTREx1NM_000492.3:c.49_50dupTTp.Trp19Alafs*7 | p.W19AfsX7LRG_663t1:c.49_50dupTT, NM_000492.3:c.49_50dupTTPathogenic04/27/2018 
9CFTREx1NM_000492.3:c.50T>Gp.Phe17Cys | p.F17CLRG_663t1:c.50T>G, NM_000492.3:c.50T>GVOUS12/03/2019
10CFTREx1NM_000492.3:c.53+9G>TVOUS10/03/2019
11CFTREx1NM_000492.3:c.53+45A>GLRG_663t1:c.53+45A>G, NM_000492.3:c.53+45A>GVOUS**
12CFTREx1NM_000492.3:c.-132-680T>GLRG_663t1:c.-812T>G, NM_000492.3:c.-812T>GLikely benign01/18/2017 
13CFTREx1NM_000492.3:c.-132-329A>GLRG_663t1:c.-461A>G, NM_000492.3:c.-461A>GVOUS12/09/2019
14CFTREx1NM_000492.3:c.-132-316A>GLRG_663t1:c.-448A>G, NM_000492.3:c.-448A>GVOUS05/24/2019
15CFTREx1NM_000492.3:c.-132-156G>CLRG_663t1:c.-288G>C, NM_000492.3:c.-288G>CLikely benign03/20/2017 
16CFTREx1NM_000492.3:c.-132-156G>AVOUS10/04/2019
17CFTREx1NM_000492.3:c.-132-94G>TLRG_663t1:c.-226G>T, NM_000492.3:c.-226G>TVOUS07/22/2019
18CFTREx1NM_000492.3:c.-132-33G>ALRG_663t1:c.-165G>A, NM_000492.3:c.-165G>AVOUS04/19/2018
19CFTREx1NM_000492.3:c.-132-20G>CLRG_663t1:c.-152G>C, NM_000492.3:c.-152G>CVOUS03/14/2019
20CFTREx1NM_000492.3:c.-132T>GLRG_663t1:c.-132T>G, NM_000492.3:c.-132T>GVOUS01/09/2017
21CFTREx2NM_000492.3:c.91C>Tp.Arg31Cys | p.R31CLRG_663t1:c.91C>T, NM_000492.3:c.91C>TVOUS11/06/2019
22CFTREx2NM_000492.3:c.92G>Tp.Arg31Leu | p.R31LLRG_663t1:c.92G>T, NM_000492.3:c.92G>TVOUS06/07/2018
23CFTREx2NM_000492.3:c.94C>Ap.Leu32Met | p.L32MLRG_663t1:c.94C>A, NM_000492.3:c.94C>AVOUS06/15/2017
24CFTREx2NM_000492.3:c.109A>Gp.Ile37Val | p.I37VLRG_663t1:c.109A>G, NM_000492.3:c.109A>GVOUS03/15/2018
25CFTREx2NM_000492.3:c.117A>Cp.Gln39His | p.Q39HLRG_663t1:c.117A>C, NM_000492.3:c.117A>CVOUS02/12/2020
26CFTREx2NM_000492.3:c.125C>Tp.Ser42Phe | p.S42FLRG_663t1:c.125C>T, NM_000492.3:c.125C>TVOUS06/29/2018
27CFTREx2NM_000492.3:c.137C>Tp.Ala46Val | p.A46VLRG_663t1:c.137C>T, NM_000492.3:c.137C>TVOUS09/04/2018
28CFTREx2NM_000492.3:c.164+9A>GLRG_663t1:c.164+9A>G, NM_000492.3:c.164+9A>GVOUS12/26/2018
29CFTREx2NM_000492.3:c.164+10delTinsATGALRG_663t1:c.164+10delinsATGA, NM_000492.3:c.164+10delinsATGAVOUS**
30CFTREx2NM_000492.3:c.164+12T>CLRG_663t1:c.164+12T>C, NM_000492.3:c.164+12T>CVOUS10/26/2018
31CFTREx2NM_000492.3:c.164+28A>GLRG_663t1:c.164+28A>G, NM_000492.3:c.164+28A>GBenign11/20/2018 
32CFTREx3NM_000492.3:c.165-3C>TLRG_663t1:c.165-3C>T, NM_000492.3:c.165-3C>TPathogenic12/31/2018 
33CFTREx3NM_000492.3:c.165-1G>ALRG_663t1:c.165-1G>A, NM_000492.3:c.165-1G>APathogenic01/19/2016 
34CFTREx3NM_000492.3:c.180G>Cp.Glu60Asp | p.E60DLRG_663t1:c.180G>C, NM_000492.3:c.180G>CVOUS01/11/2018
35CFTREx3NM_000492.3:c.181C>Tp.Leu61= | p.L61=LRG_663t1:c.181C>T, NM_000492.3:c.181C>TVOUS12/11/2018
36CFTREx3NM_000492.3:c.200C>Tp.Pro67Leu | p.P67LLRG_663t1:c.200C>TPathogenic01/13/2020 
37CFTREx3NM_000492.3:c.202A>Gp.Lys68Glu | p.K68ELRG_663t1:c.202A>G, NM_000492.3:c.202A>GVOUS08/21/2018
38CFTREx3NM_000492.3:c.204A>Tp.Lys68Asn | p.K68NLRG_663t1:c.204A>T, NM_000492.3:c.204A>TVOUS10/22/2019
39CFTREx3NM_000492.3:c.220C>Tp.Arg74Trp | p.R74WLRG_663t1:c.220C>T, NM_000492.3:c.220C>TLikely pathogenic11/12/2019 
40CFTREx3NM_000492.3:c.221G>Ap.Arg74Gln | p.R74QLRG_663t1:c.221G>A, NM_000492.3:c.221G>AVOUS12/03/2019
41CFTREx3NM_000492.3:c.224G>Ap.Arg75Gln | p.R75QLRG_663t1:c.224G>A, NM_000492.3:c.224G>ALikely benign10/20/2017 
42CFTREx3NM_000492.3:c.226T>Ap.Cys76Ser | p.C76SLRG_663t1:c.226T>A, NM_000492.3:c.226T>AVOUS09/06/2016
43CFTREx3NM_000492.3:c.233dupTp.Trp79Leufs*32 | p.W79LfsX32LRG_663t1:c.233dupT, NM_000492.3:c.233dupTPathogenic10/10/2018 
44CFTREx3NM_000492.3:c.246G>Ap.Met82Ile | p.M82ILRG_663t1:c.246G>A, NM_000492.3:c.246G>AVOUS03/22/2019
45CFTREx3NM_000492.3:c.250T>Cp.Tyr84His | p.Y84HLRG_663t1:c.250T>C, NM_000492.3:c.250T>CVOUS01/26/2017
46CFTREx3NM_000492.3:c.254G>Ap.Gly85Glu | p.G85ELRG_663t1:c.254G>A, NM_000492.3:c.254G>APathogenic02/07/2017 
47CFTREx3NM_000492.3:c.256A>Gp.Ile86Val | p.I86VLRG_663t1:c.256A>G, NM_000492.3:c.256A>GVOUS09/30/2019
48CFTREx3NM_000492.3:c.262_263delTTp.Leu88Ilefs*22 | p.L88IfsX22LRG_663t1:c.262_263delTT, NM_000492.3:c.262_263delTTPathogenic** 
49CFTREx4NM_000492.3:c.274-6T>CLRG_663t1:c.274-6T>C, NM_000492.3:c.274-6T>CVOUS04/19/2019
50CFTREx4NM_000492.3:c.274-1G>ALRG_663t1:c.274-1G>A, NM_000492.3:c.274-1G>APathogenic06/24/2014 
51CFTREx4NM_000492.3:c.290T>Cp.Val97Ala | p.V97AVOUS**
52CFTREx4NM_000492.3:c.316A>Gp.Ile106Val | p.I106VLRG_663t1:c.316A>G, NM_000492.3:c.316A>GVOUS10/05/2016
53CFTREx4NM_000492.3:c.326A>Gp.Tyr109Cys | p.Y109CLRG_663t1:c.326A>G, NM_000492.3:c.326A>GLikely pathogenic02/08/2019 
54CFTREx4NM_000492.3:c.328G>Tp.Asp110Tyr | p.D110YLRG_663t1:c.328G>T, NM_000492.3:c.328G>TPathogenic** 
55CFTREx4NM_000492.3:c.328G>Cp.Asp110His | p.D110HLRG_663t1:c.328G>C, NM_000492.3:c.328G>CPathogenic12/06/2018 
56CFTREx4NM_000492.3:c.330C>Ap.Asp110Glu | p.D110ELRG_663t1:c.330C>A, NM_000492.3:c.330C>APathogenic05/23/2017 
57CFTREx4NM_000492.3:c.332C>Tp.Pro111Leu | p.P111LLRG_663t1:c.332C>T, NM_000492.3:c.332C>TVOUS08/07/2019
58CFTREx4NM_000492.3:c.332C>Gp.Pro111Arg | p.P111RLRG_663t1:c.332C>G, NM_000492.3:c.332C>GVOUS08/02/2016
59CFTREx4NM_000492.3:c.335A>Gp.Asp112Gly | p.D112GLRG_663t1:c.335A>G, NM_000492.3:c.335A>GVOUS11/01/2019
60CFTREx4NM_000492.3:c.349C>Tp.Arg117Cys | p.R117CLRG_663t1:c.349C>T, NM_000492.3:c.349C>TPathogenic12/06/2017 
61CFTREx4NM_000492.3:c.350G>Ap.Arg117His | p.R117HLRG_663t1:c.350G>A, NM_000492.3:c.350G>APathogenic01/13/2020 
62CFTREx4NM_000492.3:c.350G>Tp.Arg117Leu | p.R117LLRG_663t1:c.350G>T, NM_000492.3:c.350G>TPathogenic** 
63CFTREx4NM_000492.3:c.358G>Ap.Ala120Thr | p.A120TLRG_663t1:c.358G>A, NM_000492.3:c.358G>AVOUS12/03/2019
64CFTREx4NM_000492.3:c.360G>Ap.Ala120= | p.A120=LRG_663t1:c.360G>A, NM_000492.3:c.360G>AVOUS08/22/2019
65CFTREx4NM_000492.3:c.374T>Cp.Ile125Thr | p.I125TLRG_663t1:c.374T>C, NM_000492.3:c.374T>CLikely benign03/13/2017 
66CFTREx4NM_000492.3:c.377G>Tp.Gly126Val | p.G126VLRG_663t1:c.377G>T, NM_000492.3:c.377G>TVOUS05/25/2018
67CFTREx4NM_000492.3:c.393T>Cp.Phe131= | p.F131=LRG_663t1:c.393T>C, NM_000492.3:c.393T>CVOUS08/30/2018
68CFTREx4NM_000492.3:c.403A>Gp.Thr135Ala | p.T135ALRG_663t1:c.403A>G, NM_000492.3:c.403A>GVOUS12/13/2017
69CFTREx4NM_000492.3:c.416A>Cp.His139Pro | p.H139PLRG_663t1:c.416A>C, NM_000492.3:c.416A>CVOUS03/30/2018
70CFTREx4NM_000492.3:c.418C>Tp.Pro140Ser | p.P140SLRG_663t1:c.418C>T, NM_000492.3:c.418C>TVOUS01/21/2019
71CFTREx4NM_000492.3:c.442delAp.Ile148Leufs*5 | p.I148LfsX5LRG_663t1:c.442delA, NM_000492.3:c.442delAPathogenic09/22/2017 
72CFTREx4NM_000492.3:c.443T>Cp.Ile148Thr | p.I148TLRG_663t1:c.443T>C, NM_000492.3:c.443T>CBenign08/06/2012 
73CFTREx4NM_000492.3:c.443T>Ap.Ile148Asn | p.I148NLRG_663t1:c.443T>A, NM_000492.3:c.443T>AVOUS02/27/2017
74CFTREx4NM_000492.3:c.451C>Ap.Gln151Lys | p.Q151KLRG_663t1:c.451C>A, NM_000492.3:c.451C>AVOUS07/14/2019
75CFTREx4NM_000492.3:c.454A>Tp.Met152Leu | p.M152LLRG_663t1:c.454A>T, NM_000492.3:c.454A>TVOUS01/09/2019
76CFTREx4NM_000492.3:c.473G>Cp.Ser158Thr | p.S158TLRG_663t1:c.473G>C, NM_000492.3:c.473G>CVOUS02/05/2020
77CFTREx4NM_000492.3:c.489+1G>T 621+1G->T, LRG_663t1:c.489+1G>T, NM_000492.3:c.489+1G>TPathogenic11/24/2018 
78CFTREx4NM_000492.3:c.489+3A>GLRG_663t1:c.489+3A>G, NM_000492.3:c.489+3A>GVOUS10/18/2019
79CFTREx4NM_000492.3:c.489+8T>GLRG_663t1:c.489+8T>G, NM_000492.3:c.489+8T>GVOUS02/20/2018
80CFTREx4NM_000492.3:c.489+87A>GLRG_663t1:c.489+87A>G, NM_000492.3:c.489+87A>GVOUS02/15/2018
81CFTREx5NM_000492.3:c.509G>Ap.Arg170His | p.R170HLRG_663t1:c.509G>A, NM_000492.3:c.509G>AVOUS08/29/2019
82CFTREx5NM_000492.3:c.530T>Cp.Ile177Thr | p.I177TLRG_663t1:c.530T>C, NM_000492.3:c.530T>CVOUS11/07/2018
83CFTREx5NM_000492.3:c.538C>Gp.Leu180Val | p.L180VLRG_663t1:c.538C>G, NM_000492.3:c.538C>GVOUS04/08/2019
84CFTREx5NM_000492.3:c.547C>Ap.Leu183Ile | p.L183ILRG_663t1:c.547C>A, NM_000492.3:c.547C>AVOUS03/26/2019
85CFTREx5NM_000492.3:c.561C>Tp.Asn187= | p.N187=LRG_663t1:c.561C>T, NM_000492.3:c.561C>TVOUS06/26/2018
86CFTREx5NM_000492.3:c.571T>Gp.Phe191Val | p.F191VLRG_663t1:c.571T>G, NM_000492.3:c.571T>GLikely pathogenic02/06/2020 
87CFTREx5NM_000492.3:c.577G>Tp.Glu193* | p.E193XNM_000492.3:c.577G>TPathogenic08/18/2014 
88CFTREx5NM_000492.3:c.579+1G>TLRG_663t1:c.579+1G>T, NM_000492.3:c.579+1G>TPathogenic05/19/2016 
89CFTREx5NM_000492.3:c.579+4delTVOUS**
90CFTREx6NM_000492.3:c.581G>Tp.Gly194Val | p.G194VLRG_663t1:c.581G>T, NM_000492.3:c.581G>TVOUS11/07/2017
91CFTREx6NM_000492.3:c.592G>Ap.Ala198Thr | p.A198TLRG_663t1:c.592G>A, NM_000492.3:c.592G>AVOUS01/27/2017
92CFTREx6NM_000492.3:c.592G>Cp.Ala198Pro | p.A198PLRG_663t1:c.592G>C, NM_000492.3:c.592G>CVOUS03/14/2016
93CFTREx6NM_000492.3:c.601G>Ap.Val201Met | p.V201MLRG_663t1:c.601G>A, NM_000492.3:c.601G>AVOUS01/22/2020
94CFTREx6NM_000492.3:c.613C>Tp.Pro205Ser | p.P205SLRG_663t1:c.613C>T, NM_000492.3:c.613C>TPathogenic03/12/2019 
95CFTREx6NM_000492.3:c.617T>Gp.Leu206Trp | p.L206WLRG_663t1:c.617T>G, NM_000492.3:c.617T>GPathogenic05/17/2019 
96CFTREx6NM_000492.3:c.648G>Tp.Trp216Cys | p.W216CLRG_663t1:c.648G>T, NM_000492.3:c.648G>TVOUS06/12/2018
97CFTREx6NM_000492.3:c.650A>Gp.Glu217Gly | p.E217GLRG_663t1:c.650A>G, NM_000492.3:c.650A>GVOUS07/10/2018
98CFTREx6NM_000492.3:c.663G>Ap.Ala221= | p.A221=LRG_663t1:c.663G>A, NM_000492.3:c.663G>AVOUS08/25/2016
99CFTREx6NM_000492.3:c.688C>Tp.Leu230= | p.L230=LRG_663t1:c.688C>T, NM_000492.3:c.688C>TVOUS04/17/2018
100CFTREx6NM_000492.3:c.695T>Ap.Val232Asp | p.V232DLRG_663t1:c.695T>A, NM_000492.3:c.695T>APathogenic04/04/2018 
101CFTREx6NM_000492.3:c.708delTPathogenic** 
102CFTREx6NM_000492.3:c.709C>Gp.Gln237Glu | p.Q237ELRG_663t1:c.709C>G, NM_000492.3:c.709C>GLikely pathogenic01/08/2019 
103CFTREx6NM_000492.3:c.710A>Tp.Gln237Leu | p.Q237LLRG_663t1:c.710A>T, NM_000492.3:c.710A>TVOUS01/08/2019
104CFTREx6NM_000492.3:c.710A>Gp.Gln237Arg | p.Q237RLRG_663t1:c.710A>G, NM_000492.3:c.710A>GVOUS01/08/2019
105CFTREx6NM_000492.3:c.711G>Cp.Gln237His | p.Q237HLRG_663t1:c.711G>C, NM_000492.3:c.711G>CVOUS01/08/2019
106CFTREx6NM_000492.3:c.711G>Tp.Gln237His | p.Q237HLRG_663t1:c.711G>T, NM_000492.3:c.711G>TVOUS12/28/2018
107CFTREx6NM_000492.3:c.715G>Ap.Gly239Arg | p.G239RLRG_663t1:c.715G>A, NM_000492.3:c.715G>AVOUS10/04/2019
108CFTREx6NM_000492.3:c.738G>Ap.Lys246= | p.K246=LRG_663t1:c.738G>A, NM_000492.3:c.738G>ALikely benign12/07/2016 
109CFTREx6NM_000492.3:c.743+1G>ALRG_663t1:c.743+1G>A, NM_000492.3:c.743+1G>APathogenic07/06/2016 
110CFTREx6NM_000492.3:c.743+40A>GNM_000492.3:c.743+40A>GBenign** 
111CFTREx7NM_000492.3:c.744-33GATT(6_9)Benign11/20/2018 
112CFTREx7NM_000492.3:c.744-9_744-6dupGATTLRG_663t1:c.744-9_744-6dupGATT, NM_000492.3:c.744-9_744-6dupGATTBenign06/23/2017 
113CFTREx7NM_000492.3:c.772A>Gp.Arg258Gly | p.R258GLRG_663t1:c.772A>G, NM_000492.3:c.772A>GVOUS10/02/2019
114CFTREx7NM_000492.3:c.794T>Gp.Met265Arg | p.M265RLRG_663t1:c.794T>G, NM_000492.3:c.794T>GVOUS02/11/2019
115CFTREx7NM_000492.3:c.803delAp.Asn268Ilefs*17 | p.N268IfsX17LRG_663t1:c.803delA, NM_000492.3:c.803delAPathogenic07/25/2019 
116CFTREx7NM_000492.3:c.806T>Cp.Ile269Thr | p.I269TLRG_663t1:c.806T>C, NM_000492.3:c.806T>CVOUS08/22/2017
117CFTREx7NM_000492.3:c.837A>Tp.Glu279Asp | p.E279DLRG_663t1:c.837A>T, NM_000492.3:c.837A>TVOUS03/27/2017
118CFTREx7NM_000492.3:c.842T>Cp.Met281Thr | p.M281TLRG_663t1:c.842T>C, NM_000492.3:c.842T>CVOUS08/19/2019
119CFTREx7NM_000492.3:c.846A>Tp.Glu282Asp | p.E282DLRG_663t1:c.846A>T, NM_000492.3:c.846A>TVOUS12/13/2019
120CFTREx7NM_000492.3:c.848_860delAAATGATTGAAAAinsTGNM_000492.3:c.848_860delinsTGPathogenic10/27/2014 
121CFTREx7NM_000492.3:c.850dupALRG_663t1:c.850_851insA, NM_000492.3:c.850_851insAPathogenic03/28/2016 
122CFTREx7NM_000492.3:c.853A>Tp.Ile285Phe | p.I285FLRG_663t1:c.853A>T, NM_000492.3:c.853A>TLikely benign06/23/2017 
123CFTREx7NM_000492.3:c.861C>Gp.Asn287Lys | p.N287KLRG_663t1:c.861C>G, NM_000492.3:c.861C>GVOUS09/25/2018
124CFTREx7NM_000492.3:c.869+1G>CLRG_663t1:c.869+1G>C, NM_000492.3:c.869+1G>CPathogenic06/14/2018 
125CFTREx7NM_000492.3:c.869+11C>TLRG_663t1:c.869+11C>T, NM_000492.3:c.869+11C>TBenign05/19/2016 
126CFTREx7NM_000492.3:c.869+40A>GNM_000492.3:c.869+40A>GBenign** 
127CFTREx8NM_000492.3:c.870-7_870-5delTTTLRG_663t1:c.870-7_870-5delTTT, NM_000492.3:c.870-7_870-5delTTTLikely benign05/30/2017 
128CFTREx8NM_000492.3:c.889C>Tp.Arg297Trp | p.R297WLRG_663t1:c.889C>T, NM_000492.3:c.889C>TVOUS03/29/2019
129CFTREx8NM_000492.3:c.890G>Ap.Arg297Gln | p.R297QLRG_663t1:c.890G>A, NM_000492.3:c.890G>ALikely benign09/26/2014 
130CFTREx8NM_000492.3:c.902A>Gp.Tyr301Cys | p.Y301CLRG_663t1:c.902A>G, NM_000492.3:c.902A>GVOUS09/03/2019
131CFTREx8NM_000492.3:c.925G>Tp.Ala309Ser | p.A309SLRG_663t1:c.925G>T, NM_000492.3:c.925G>TVOUS02/07/2019
132CFTREx8NM_000492.3:c.926C>Gp.Ala309Gly | p.A309GLRG_663t1:c.926C>G, NM_000492.3:c.926C>GVOUS11/14/2017
133CFTREx8NM_000492.3:c.935_937delTCTp.Phe312del | p.F312delLRG_663t1:c.935_937delTCT, NM_000492.3:c.935_937delTCTPathogenic11/19/2013 
134CFTREx8NM_000492.3:c.944T>Cp.Phe315Ser | p.F315SLRG_663t1:c.944T>C, NM_000492.3:c.944T>CVOUS09/15/2017
135CFTREx8NM_000492.3:c.948delTp.Phe316Leufs*12 | p.F316LfsX12LRG_663t1:c.948delT, NM_000492.3:c.948delTPathogenic08/15/2017 
136CFTREx8NM_000492.3:c.948T>Gp.Phe316Leu | p.F316LLRG_663t1:c.948T>G, NM_000492.3:c.948T>GVOUS11/09/2017
137CFTREx8NM_000492.3:c.958T>Gp.Leu320Val | p.L320VLRG_663t1:c.958T>G, NM_000492.3:c.958T>GVOUS01/16/2020
138CFTREx8NM_000492.3:c.960A>Gp.Leu320= | p.L320=LRG_663t1:c.960A>G, NM_000492.3:c.960A>GVOUS06/18/2019
139CFTREx8NM_000492.3:c.974A>Gp.Tyr325Cys | p.Y325CLRG_663t1:c.974A>G, NM_000492.3:c.974A>GVOUS09/13/2018
140CFTREx8NM_000492.3:c.1000C>Tp.Arg334Trp | p.R334WLRG_663t1:c.1000C>T, NM_000492.3:c.1000C>TPathogenic** 
141CFTREx8NM_000492.3:c.1001G>Ap.Arg334Gln | p.R334QLRG_663t1:c.1001G>A, NM_000492.3:c.1001G>AVOUS12/24/2018
142CFTREx8NM_000492.3:c.1007T>Ap.Ile336Lys | p.I336KLRG_663t1:c.1007T>A, NM_000492.3:c.1007T>APathogenic03/15/2017 
143CFTREx8NM_000492.3:c.1021T>Cp.Ser341Pro | p.S341PLRG_663t1:c.1021T>C, NM_000492.3:c.1021T>CPathogenic10/10/2016 
144CFTREx8NM_000492.3:c.1022_1023insTC1157InsTC, NM_000492.3:c.1022_1023insTCPathogenic07/10/2014 
145CFTREx8NM_000492.3:c.1039C>Tp.Arg347Cys | p.R347CLRG_663t1:c.1039C>T, NM_000492.3:c.1039C>TVOUS09/27/2017
146CFTREx8NM_000492.3:c.1040G>Cp.Arg347Pro | p.R347PLRG_663t1:c.1040G>C, NM_000492.3:c.1040G>CPathogenic10/17/2018 
147CFTREx8NM_000492.3:c.1043T>Ap.Met348Lys | p.M348KLRG_663t1:c.1043T>A, NM_000492.3:c.1043T>AVOUS09/16/2016
148CFTREx8NM_000492.3:c.1046C>Tp.Ala349Val | p.A349VLRG_663t1:c.1046C>T, NM_000492.3:c.1046C>TVOUS11/12/2019
149CFTREx8NM_000492.3:c.1047G>Ap.Ala349= | p.A349=LRG_663t1:c.1047G>A, NM_000492.3:c.1047G>AVOUS12/15/2017
150CFTREx8NM_000492.3:c.1052C>Gp.Thr351Ser | p.T351SLRG_663t1:c.1052C>G, NM_000492.3:c.1052C>GVOUS11/05/2019
151CFTREx8NM_000492.3:c.1054C>Tp.Arg352Trp | p.R352WLRG_663t1:c.1054C>T, NM_000492.3:c.1054C>TVOUS05/31/2019
152CFTREx8NM_000492.3:c.1055G>Ap.Arg352Gln | p.R352QLRG_663t1:c.1055G>A, NM_000492.3:c.1055G>APathogenic** 
153CFTREx8NM_000492.3:c.1066_1072delTGGGCTGinsANM_000492.3:c.1066_1072delinsAVOUS05/29/2015
154CFTREx8NM_000492.3:c.1083delGp.Trp361Cysfs*8 | p.W361CfsX8LRG_663t1:c.1083delG, NM_000492.3:c.1083delGPathogenic04/18/2017 
155CFTREx8NM_000492.3:c.1116+6G>CLRG_663t1:c.1116+6G>C, NM_000492.3:c.1116+6G>CVOUS03/21/2017
156CFTREx9NM_000492.3:c.1118A>Tp.Asp373Val | p.D373VLRG_663t1:c.1118A>T, NM_000492.3:c.1118A>TVOUS08/21/2019
157CFTREx9NM_000492.3:c.1125A>Cp.Leu375Phe | p.L375FLRG_663t1:c.1125A>C, NM_000492.3:c.1125A>CLikely pathogenic09/18/2019 
158CFTREx9NM_000492.3:c.1149G>Ap.Leu383= | p.L383=LRG_663t1:c.1149G>A, NM_000492.3:c.1149G>AVOUS10/09/2017
159CFTREx9NM_000492.3:c.1163C>Tp.Thr388Met | p.T388MLRG_663t1:c.1163C>T, NM_000492.3:c.1163C>TVOUS07/24/2019
160CFTREx9NM_000492.3:c.1164G>Ap.Thr388= | p.T388=LRG_663t1:c.1164G>A, NM_000492.3:c.1164G>AVOUS05/19/2017
161CFTREx10NM_000492.3:c.1210-32T>GLRG_663t1:c.1210-32T>G, NM_000492.3:c.1210-32T>GVOUS09/23/2016
162CFTREx10NM_000492.3:c.1210-15G>TLRG_663t1:c.1210-15G>T, NM_000492.3:c.1210-15G>TVOUS06/26/2017
163CFTREx10NM_000492.3:c.1210-14_1210-13insTGLRG_663t1:c.1210-14_1210-13insTG, NM_000492.3:c.1210-14_1210-13insTGBenign07/02/2014 
164CFTREx10NM_000492.3:c.1210-13G>TNM_000492.3:c.1210-13G>TBenign01/31/2014 
165CFTREx10NM_000492.3:c.1210-13GT(10_12)Benign** 
166CFTREx10NM_000492.3:c.1210-13_1210-10delGTTTLRG_663t1:c.1210-13_1210-10delGTTT, NM_000492.3:c.1210-13_1210-10delGTTTVOUS09/23/2016
167CFTREx10NM_000492.3:c.1210-12T(5_9)Other Reportable02/19/2020 
168CFTREx10NM_000492.3:c.1210-11T>GLRG_663t1:c.1210-11T>G, NM_000492.3:c.1210-11T>GOther Reportable05/19/2016 
169CFTREx10NM_000492.3:c.1210-7_1210-6dupTTLRG_663t1:c.1210-7_1210-6dupTT, NM_000492.3:c.1210-6_1210-5insTT, NM_000492.3:c.1210-7_1210-6dupTTBenign09/29/2014 
170CFTREx10NM_000492.3:c.1210-7_1210-6delTTLRG_663t1:c.1210-7_1210-6delTT, NM_000492.3:c.1210-7_1210-6delTTOther Reportable05/06/2019 
171CFTREx10NM_000492.3:c.1210-2_1210-1delAGLRG_663t1:c.1210-2_1210-1delAG, NM_000492.3:c.1210-2_1210-1delAGPathogenic10/04/2019 
172CFTREx10NM_000492.3:c.1227T>Cp.Phe409= | p.F409=LRG_663t1:c.1227T>C, NM_000492.3:c.1227T>CVOUS03/29/2019
173CFTREx10NM_000492.3:c.1231A>Gp.Lys411Glu | p.K411ELRG_663t1:c.1231A>G, NM_000492.3:c.1231A>GVOUS04/19/2019
174CFTREx10NM_000492.3:c.1234_1238delGCAAAp.Ala412Thrfs*4 | p.A412TfsX4LRG_663t1:c.1234_1238delGCAAA, NM_000492.3:c.1234_1238delGCAAAPathogenic09/22/2016 
175CFTREx10NM_000492.3:c.1251C>Ap.Asn417Lys | p.N417KLRG_663t1:c.1251C>A, NM_000492.3:c.1251C>ABenign03/21/2015 
176CFTREx10NM_000492.3:c.1254T>Cp.Asn418= | p.N418=NM_000492.3:c.1254T>CBenign08/19/2014 
177CFTREx10NM_000492.3:c.1270G>Ap.Gly424Ser | p.G424SLRG_663t1:c.1270G>A, NM_000492.3:c.1270G>AVOUS04/18/2019
178CFTREx10NM_000492.3:c.1301_1307delCACTTCTPathogenic** 
179CFTREx10NM_000492.3:c.1312A>Gp.Thr438Ala | p.T438ALRG_663t1:c.1312A>G, NM_000492.3:c.1312A>GVOUS08/31/2018
180CFTREx10NM_000492.3:c.1327G>Tp.Asp443Tyr | p.D443YLRG_663t1:c.1327G>T, NM_000492.3:c.1327G>TPathogenic12/05/2018 
181CFTREx10NM_000492.3:c.1327_1330dupGATAp.Ile444Argfs*3 | p.I444RfsX3LRG_663t1:c.1327_1330dupGATA, NM_000492.3:c.1327_1330dupGATAPathogenic11/08/2019 
182CFTREx10NM_000492.3:c.1331T>Cp.Ile444Thr | p.I444TLRG_663t1:c.1331T>C, NM_000492.3:c.1331T>CVOUS12/21/2017
183CFTREx10NM_000492.3:c.1340delANM_000492.3:c.1340delAPathogenic** 
184CFTREx10NM_000492.3:c.1343T>Ap.Ile448Lys | p.I448KVOUS**
185CFTREx10NM_000492.3:c.1360_1362delTTGLRG_663t1:c.1360_1362delTTG, NM_000492.3:c.1360_1362delTTGLikely benign01/11/2017 
186CFTREx10NM_000492.3:c.1364C>Ap.Ala455Glu | p.A455ELRG_663t1:c.1364C>A, NM_000492.3:c.1364C>APathogenic** 
187CFTREx10NM_000492.3:c.1364C>Tp.Ala455Val | p.A455VLRG_663t1:c.1364C>T, NM_000492.3:c.1364C>TVOUS06/13/2019
188CFTREx10NM_000492.3:c.1365G>Ap.Ala455= | p.A455=LRG_663t1:c.1365G>A, NM_000492.3:c.1365G>AVOUS08/02/2019
189CFTREx10NM_000492.3:c.1365G>Tp.Ala455= | p.A455=LRG_663t1:c.1365G>T, NM_000492.3:c.1365G>TVOUS01/12/2016
190CFTREx10NM_000492.3:c.1367T>Cp.Val456Ala | p.V456ALRG_663t1:c.1367T>C, NM_000492.3:c.1367T>CPathogenic07/26/2019 
191CFTREx11NM_000492.3:c.1393-42G>ALRG_663t1:c.1393-42G>A, NM_000492.3:c.1393-42G>ABenign01/19/2017 
192CFTREx11NM_000492.3:c.1397C>Gp.Ser466* | p.S466XLRG_663t1:c.1397C>G, NM_000492.3:c.1397C>GPathogenic02/24/2017 
193CFTREx11NM_000492.3:c.1400T>Cp.Leu467Pro | p.L467PLRG_663t1:c.1400T>C, NM_000492.3:c.1400T>CPathogenic04/24/2017 
194CFTREx11NM_000492.3:c.1408A>Gp.Met470Val | p.M470VLRG_663t1:c.1408A>G, NM_000492.3:c.1408A>GBenign01/06/2020 
195CFTREx11NM_000492.3:c.1408G>Ap.Val470Met | p.V470MLRG_663t1:c.1408G>A, NM_000492.3:c.1408G>ABenign01/06/2020 
196CFTREx11NM_000492.3:c.1414A>Gp.Met472Val | p.M472VLRG_663t1:c.1414A>G, NM_000492.3:c.1414A>GVOUS11/05/2019
197CFTREx11NM_000492.3:c.1430C>Ap.Pro477His | p.P477HLRG_663t1:c.1430C>A, NM_000492.3:c.1430C>AVOUS07/28/2016
198CFTREx11NM_000492.3:c.1436A>Cp.Glu479Ala | p.E479ALRG_663t1:c.1436A>C, NM_000492.3:c.1436A>CVOUS04/07/2016
199CFTREx11NM_000492.3:c.1438G>Tp.Gly480Cys | p.G480CLRG_663t1:c.1438G>T, NM_000492.3:c.1438G>TPathogenic09/30/2013 
200CFTREx11NM_000492.3:c.1446T>Ap.Ile482= | p.I482=LRG_663t1:c.1446T>A, NM_000492.3:c.1446T>AVOUS04/27/2018
201CFTREx11NM_000492.3:c.1450C>Tp.His484Tyr | p.H484YLRG_663t1:c.1450C>T, NM_000492.3:c.1450C>TVOUS05/08/2017
202CFTREx11NM_000492.3:c.1454G>Cp.Ser485Thr | p.S485TLRG_663t1:c.1454G>C, NM_000492.3:c.1454G>CVOUS02/18/2019
203CFTREx11NM_000492.3:c.1477C>Tp.Gln493* | p.Q493XLRG_663t1:c.1477C>T, NM_000492.3:c.1477C>TPathogenic08/15/2018 
204CFTREx11NM_000492.3:c.1479G>Cp.Gln493His | p.Q493HLRG_663t1:c.1479G>C, NM_000492.3:c.1479G>CVOUS11/04/2016
205CFTREx11NM_000492.3:c.1499G>Ap.Gly500Asp | p.G500DLRG_663t1:c.1499G>A, NM_000492.3:c.1499G>AVOUS08/12/2016
206CFTREx11NM_000492.3:c.1516A>Gp.Ile506Val | p.I506VLRG_663t1:c.1516A>G, NM_000492.3:c.1516A>GBenign07/06/2016 
207CFTREx11NM_000492.3:c.1517T>Cp.Ile506Thr | p.I506TLRG_663t1:c.1517T>C, NM_000492.3:c.1517T>CLikely pathogenic07/30/2018 
208CFTREx11NM_000492.3:c.1519_1521delATCp.Ile507del | p.I507delLRG_663t1:c.1519_1521delATC, NM_000492.3:c.1519_1521delATCPathogenic11/30/2018 
209CFTREx11NM_000492.3:c.1521_1523delCTTp.Phe508del | p.F508deldelF508, DeltaF508, dF508, LRG_663t1:c.1521_1523delCTT, NM_000492.3:c.1521_1523delCTTPathogenic09/17/2019 
210CFTREx11NM_000492.3:c.1523T>Gp.Phe508Cys | p.F508CLRG_663t1:c.1523T>G, NM_000492.3:c.1523T>GBenign04/14/2016 
211CFTREx11NM_000492.3:c.1534T>Ap.Tyr512Asn | p.Y512NLRG_663t1:c.1534T>A, NM_000492.3:c.1534T>AVOUS11/15/2017
212CFTREx11NM_000492.3:c.1552A>Gp.Arg518Gly | p.R518GLRG_663t1:c.1552A>G, NM_000492.3:c.1552A>GVOUS04/26/2018
213CFTREx11NM_000492.3:c.1558G>Ap.Val520Ile | p.V520ILRG_663t1:c.1558G>A, NM_000492.3:c.1558G>AVOUS08/05/2019
214CFTREx11NM_000492.3:c.1582G>Ap.Glu528Lys | p.E528KLRG_663t1:c.1582G>A, NM_000492.3:c.1582G>AVOUS05/21/2018
215CFTREx11NM_000492.3:c.1584G>Tp.Glu528Asp | p.E528DLRG_663t1:c.1584G>T, NM_000492.3:c.1584G>TVOUS12/20/2017
216CFTREx11NM_000492.3:c.1584G>Ap.Glu528= | p.E528=LRG_663t1:c.1584G>A, NM_000492.3:c.1584G>ABenign12/03/2019 
217CFTREx12NM_000492.3:c.1585-1G>ALRG_663t1:c.1585-1G>A, NM_000492.3:c.1585-1G>APathogenic10/01/2019 
218CFTREx12NM_000492.3:c.1586A>Gp.Asp529Gly | p.D529GLRG_663t1:c.1586A>G, NM_000492.3:c.1586A>GVOUS12/04/2017
219CFTREx12NM_000492.3:c.1606A>Gp.Lys536Glu | p.K536ELRG_663t1:c.1606A>G, NM_000492.3:c.1606A>GVOUS12/03/2019
220CFTREx12NM_000492.3:c.1612A>Cp.Asn538His | p.N538HLRG_663t1:c.1612A>C, NM_000492.3:c.1612A>CVOUS05/13/2019
221CFTREx12NM_000492.3:c.1616T>Cp.Ile539Thr | p.I539TLRG_663t1:c.1616T>C, NM_000492.3:c.1616T>CVOUS07/19/2018
222CFTREx12NM_000492.3:c.1624G>Tp.Gly542* | p.G542XLRG_663t1:c.1624G>T, NM_000492.3:c.1624G>TPathogenic12/27/2018 
223CFTREx12NM_000492.3:c.1630G>Ap.Gly544Ser | p.G544SLRG_663t1:c.1630G>A, NM_000492.3:c.1630G>AVOUS09/11/2019
224CFTREx12NM_000492.3:c.1645A>Cp.Ser549Arg | p.S549RLRG_663t1:c.1645A>C, NM_000492.3:c.1645A>CPathogenic** 
225CFTREx12NM_000492.3:c.1646G>Ap.Ser549Asn | p.S549NLRG_663t1:c.1646G>A, NM_000492.3:c.1646G>APathogenic07/30/2018 
226CFTREx12NM_000492.3:c.1651G>Ap.Gly551Ser | p.G551SLRG_663t1:c.1651G>A, NM_000492.3:c.1651G>APathogenic** 
227CFTREx12NM_000492.3:c.1652G>Ap.Gly551Asp | p.G551DLRG_663t1:c.1652G>A, NM_000492.3:c.1652G>APathogenic10/23/2019 
228CFTREx12NM_000492.3:c.1655A>Cp.Gln552Pro | p.Q552PLRG_663t1:c.1655A>C, NM_000492.3:c.1655A>CVOUS07/17/2019
229CFTREx12NM_000492.3:c.1657C>Tp.Arg553* | p.R553XLRG_663t1:c.1657C>T, NM_000492.3:c.1657C>TPathogenic08/15/2017 
230CFTREx12NM_000492.3:c.1666A>Gp.Ile556Val | p.I556VLRG_663t1:c.1666A>G, NM_000492.3:c.1666A>GBenign10/17/2014 
231CFTREx12NM_000492.3:c.1674A>Gp.Leu558= | p.L558=LRG_663t1:c.1674A>G, NM_000492.3:c.1674A>GVOUS08/07/2019
232CFTREx12NM_000492.3:c.1675G>Ap.Ala559Thr | p.A559TLRG_663t1:c.1675G>A, NM_000492.3:c.1675G>APathogenic02/22/2018 
233CFTREx12NM_000492.3:c.1675G>Cp.Ala559Pro | p.A559PVOUS**
234CFTREx12NM_000492.3:c.1679G>Cp.Arg560Thr | p.R560TLRG_663t1:c.1679G>C, NM_000492.3:c.1679G>CPathogenic05/09/2019 
235CFTREx12NM_000492.3:c.1679G>Ap.Arg560Lys | p.R560KLRG_663t1:c.1679G>A, NM_000492.3:c.1679G>APathogenic** 
236CFTREx12NM_000492.3:c.1679+1G>ALRG_663t1:c.1679+1G>A, NM_000492.3:c.1679+1G>APathogenic04/28/2016 
237CFTREx12NM_000492.3:c.1679+16T>CVOUS07/16/2019
238CFTREx13NM_000492.3:c.1680-886A>GLRG_663t1:c.1680-886A>G, NM_000492.3:c.1680-886A>GPathogenic02/28/2017 
239CFTREx13NM_000492.3:c.1680-8C>ALRG_663t1:c.1680-8C>A, NM_000492.3:c.1680-8C>AVOUS07/17/2018
240CFTREx13NM_000492.3:c.1680-6T>GLRG_663t1:c.1680-6T>G, NM_000492.3:c.1680-6T>GVOUS06/13/2019
241CFTREx13NM_000492.3:c.1684G>Ap.Val562Ile | p.V562ILRG_663t1:c.1684G>A, NM_000492.3:c.1684G>AVOUS11/08/2019
242CFTREx13NM_000492.3:c.1692delAp.Asp565Metfs*7 | p.D565MfsX7LRG_663t1:c.1692delA, NM_000492.3:c.1692delAPathogenic** 
243CFTREx13NM_000492.3:c.1706A>Gp.Tyr569Cys | p.Y569CPathogenic** 
244CFTREx13NM_000492.3:c.1707T>Cp.Tyr569= | p.Y569=VOUS12/16/2019
245CFTREx13NM_000492.3:c.1718C>Tp.Ser573Phe | p.S573FLRG_663t1:c.1718C>T, NM_000492.3:c.1718C>TVOUS06/07/2017
246CFTREx13NM_000492.3:c.1721C>Ap.Pro574His | p.P574HPathogenic** 
247CFTREx13NM_000492.3:c.1727G>Cp.Gly576Ala | p.G576ALRG_663t1:c.1727G>C, NM_000492.3:c.1727G>CVOUS01/02/2020
248CFTREx13NM_000492.3:c.1753G>Tp.Glu585* | p.E585XLRG_663t1:c.1753G>T, NM_000492.3:c.1753G>TPathogenic08/07/2017 
249CFTREx13NM_000492.3:c.1763A>Gp.Glu588Gly | p.E588GLRG_663t1:c.1763A>G, NM_000492.3:c.1763A>GVOUS06/30/2017
250CFTREx13NM_000492.3:c.1766+2T>ALRG_663t1:c.1766+2T>A, NM_000492.3:c.1766+2T>APathogenic08/31/2018 
251CFTREx13NM_000492.3:c.1766+3A>GLRG_663t1:c.1766+3A>G, NM_000492.3:c.1766+3A>GPathogenic05/23/2016 
252CFTREx13NM_000492.3:c.1766+26T>CVOUS**
253CFTREx13NM_000492.3:c.1766+73T>GLRG_663t1:c.1766+73T>G, NM_000492.3:c.1766+73T>GVOUS09/18/2017
254CFTREx14NM_000492.3:c.1807G>Ap.Val603Ile | p.V603ILRG_663t1:c.1807G>A, NM_000492.3:c.1807G>AVOUS11/14/2019
255CFTREx14NM_000492.3:c.1811C>Gp.Thr604Ser | p.T604SLRG_663t1:c.1811C>G, NM_000492.3:c.1811C>GVOUS04/19/2019
256CFTREx14NM_000492.3:c.1820_1903delp.Met607_Gln634del | p.M607_Q634delLRG_663t1:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA, NM_000492.3:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAPathogenic11/09/2018 
257CFTREx14NM_000492.3:c.1826A>Gp.His609Arg | p.H609RLRG_663t1:c.1826A>G, NM_000492.3:c.1826A>GPathogenic07/14/2019 
258CFTREx14NM_000492.3:c.1853T>Cp.Ile618Thr | p.I618TLRG_663t1:c.1853T>C, NM_000492.3:c.1853T>CPathogenic05/02/2019 
259CFTREx14NM_000492.3:c.1865G>Ap.Gly622Asp | p.G622DLRG_663t1:c.1865G>APathogenic11/13/2019 
260CFTREx14NM_000492.3:c.1882G>Cp.Gly628Arg | p.G628RLRG_663t1:c.1882G>C, NM_000492.3:c.1882G>CLikely pathogenic12/22/2017 
261CFTREx14NM_000492.3:c.1885A>Gp.Thr629Ala | p.T629ALRG_663t1:c.1885A>G, NM_000492.3:c.1885A>GVOUS11/13/2019
262CFTREx14NM_000492.3:c.1920T>Cp.Phe640= | p.F640=LRG_663t1:c.1920T>C, NM_000492.3:c.1920T>CVOUS01/22/2020
263CFTREx14NM_000492.3:c.1970delGPathogenic** 
264CFTREx14NM_000492.3:c.2002C>Tp.Arg668Cys | p.R668CLRG_663t1:c.2002C>T, NM_000492.3:c.2002C>TVOUS11/08/2019
265CFTREx14NM_000492.3:c.2042A>Tp.Glu681Val | p.E681VLRG_663t1:c.2042A>T, NM_000492.3:c.2042A>TVOUS03/25/2016
266CFTREx14NM_000492.3:c.2051_2052delAAinsGp.Lys684Serfs*38 | p.K684SfsX38LRG_663t1:c.2051_2052delinsG, NM_000492.3:c.2051_2052delinsGPathogenic01/02/2020 
267CFTREx14NM_000492.3:c.2052dupAp.Gln685Thrfs*4 | p.Q685TfsX4LRG_663t1:c.2052dupA, NM_000492.3:c.2052dup, NM_000492.3:c.2052dupAPathogenic12/03/2013 
268CFTREx14NM_000492.3:c.2052_2053insAPathogenic** 
269CFTREx14NM_000492.3:c.2055A>Gp.Gln685= | p.Q685=LRG_663t1:c.2055A>G, NM_000492.3:c.2055A>GVOUS09/04/2018
270CFTREx14NM_000492.3:c.2079T>Gp.Phe693Leu | p.F693LLRG_663t1:c.2079T>G, NM_000492.3:c.2079T>GLikely benign02/19/2020 
271CFTREx14NM_000492.3:c.2125C>Tp.Arg709* | p.R709XLRG_663t1:c.2125C>T, NM_000492.3:c.2125C>TPathogenic05/31/2018 
272CFTREx14NM_000492.3:c.2145A>Cp.Gln715His | p.Q715HLRG_663t1:c.2145A>C, NM_000492.3:c.2145A>CVOUS07/26/2017
273CFTREx14NM_000492.3:c.2153C>Gp.Pro718Arg | p.P718RLRG_663t1:c.2153C>G, NM_000492.3:c.2153C>GVOUS10/02/2018
274CFTREx14NM_000492.3:c.2169C>Tp.Gly723= | p.G723=LRG_663t1:c.2169C>T, NM_000492.3:c.2169C>TVOUS12/14/2018
275CFTREx14NM_000492.3:c.2173G>Ap.Glu725Lys | p.E725KLRG_663t1:c.2173G>A, NM_000492.3:c.2173G>AVOUS12/27/2016
276CFTREx14NM_000492.3:c.2175dupAp.Glu726Argfs*4 | p.E726RfsX4c2307dupA, LRG_663t1:c.2175dupA, NM_000492.3:c.2175dupAPathogenic01/19/2018 
277CFTREx14NM_000492.3:c.2191C>Tp.Pro731Ser | p.P731SLRG_663t1:c.2191C>T, NM_000492.3:c.2191C>TVOUS06/20/2018
278CFTREx14NM_000492.3:c.2193T>Cp.Pro731= | p.P731=LRG_663t1:c.2193T>C, NM_000492.3:c.2193T>CVOUS05/09/2016
279CFTREx14NM_000492.3:c.2205G>Cp.Arg735Ser | p.R735SLRG_663t1:c.2205G>C, NM_000492.3:c.2205G>CVOUS10/31/2018
280CFTREx14NM_000492.3:c.2210C>Tp.Ser737Phe | p.S737FLRG_663t1:c.2210C>T, NM_000492.3:c.2210C>TPathogenic** 
281CFTREx14NM_000492.3:c.2245C>Tp.Leu749= | p.L749=LRG_663t1:c.2245C>T, NM_000492.3:c.2245C>TVOUS02/04/2019
282CFTREx14NM_000492.3:c.2249C>Tp.Pro750Leu | p.P750LLRG_663t1:c.2249C>T, NM_000492.3:c.2249C>TVOUS02/10/2020
283CFTREx14NM_000492.3:c.2251C>Tp.Arg751Cys | p.R751CLRG_663t1:c.2251C>T, NM_000492.3:c.2251C>TVOUS12/27/2017
284CFTREx14NM_000492.3:c.2260G>Ap.Val754Met | p.V754MLRG_663t1:c.2260G>A, NM_000492.3:c.2260G>AVOUS06/19/2019
285CFTREx14NM_000492.3:c.2280G>Ap.Thr760= | p.T760=LRG_663t1:c.2280G>A, NM_000492.3:c.2280G>AVOUS01/21/2019
286CFTREx14NM_000492.3:c.2347A>Gp.Ile783Val | p.I783VLRG_663t1:c.2347A>G, NM_000492.3:c.2347A>GVOUS04/16/2019
287CFTREx14NM_000492.3:c.2353C>Tp.Arg785* | p.R785XLRG_663t1:c.2353C>T, NM_000492.3:c.2353C>TPathogenic09/24/2019 
288CFTREx14NM_000492.3:c.2372_2377delCACGAAp.Thr791_Arg792del | p.T791_R792delLRG_663t1:c.2372_2377delCACGAA, NM_000492.3:c.2372_2377delCACGAAVOUS08/11/2017
289CFTREx14NM_000492.3:c.2374C>Ap.Arg792= | p.R792=VOUS**
290CFTREx14NM_000492.3:c.2374C>Gp.Arg792Gly | p.R792GLRG_663t1:c.2374C>G, NM_000492.3:c.2374C>GVOUS12/03/2019
291CFTREx14NM_000492.3:c.2392C>Tp.Pro798Ser | p.P798SLRG_663t1:c.2392C>T, NM_000492.3:c.2392C>TVOUS01/27/2017
292CFTREx14NM_000492.3:c.2393C>Gp.Pro798Arg | p.P798RLRG_663t1:c.2393C>G, NM_000492.3:c.2393C>GVOUS12/02/2019
293CFTREx14NM_000492.3:c.2421A>Gp.Ile807Met | p.I807MLRG_663t1:c.2421A>G, NM_000492.3:c.2421A>GVOUS10/24/2019
294CFTREx14NM_000492.3:c.2424T>Cp.Tyr808= | p.Y808=LRG_663t1:c.2424T>C, NM_000492.3:c.2424T>CVOUS01/30/2020
295CFTREx14NM_000492.3:c.2450G>Tp.Gly817Val | p.G817VLRG_663t1:c.2450G>T, NM_000492.3:c.2450G>TVOUS12/03/2019
296CFTREx14NM_000492.3:c.2458A>Tp.Ile820Leu | p.I820LVOUS12/19/2019
297CFTREx14NM_000492.3:c.2475C>Tp.Asn825= | p.N825=LRG_663t1:c.2475C>T, NM_000492.3:c.2475C>TVOUS10/11/2019
298CFTREx14NM_000492.3:c.2482G>Ap.Asp828Asn | p.D828NLRG_663t1:c.2482G>A, NM_000492.3:c.2482G>AVOUS08/21/2019
299CFTREx14NM_000492.3:c.2490+5G>TLRG_663t1:c.2490+5G>T, NM_000492.3:c.2490+5G>TVOUS06/17/2016
300CFTREx15NM_000492.3:c.2506G>Tp.Asp836Tyr | p.D836YLRG_663t1:c.2506G>T, NM_000492.3:c.2506G>TVOUS06/20/2019
301CFTREx15NM_000492.3:c.2537G>Ap.Trp846* | p.W846XPathogenic** 
302CFTREx15NM_000492.3:c.2540A>Gp.Asn847Ser | p.N847SLRG_663t1:c.2540A>G, NM_000492.3:c.2540A>GVOUS01/07/2020
303CFTREx15NM_000492.3:c.2544A>Tp.Thr848= | p.T848=LRG_663t1:c.2544A>T, NM_000492.3:c.2544A>TVOUS01/16/2017
304CFTREx15NM_000492.3:c.2559T>Cp.Ile853= | p.I853=LRG_663t1:c.2559T>C, NM_000492.3:c.2559T>CVOUS01/15/2020
305CFTREx15NM_000492.3:c.2561_2562delCTinsTGp.Thr854Met | p.T854MLRG_663t1:c.2561_2562delinsTG, NM_000492.3:c.2561_2562delinsTGVOUS12/04/2018
306CFTREx15NM_000492.3:c.2562T>Gp.Thr854= | p.T854=LRG_663t1:c.2562T>G, NM_000492.3:c.2562T>GBenign11/20/2018 
307CFTREx15NM_000492.3:c.2583delTp.Phe861Leufs*3 | p.F861LfsX3LRG_663t1:c.2583delT, NM_000492.3:c.2583delTPathogenic10/30/2018 
308CFTREx15NM_000492.3:c.2597G>Ap.Cys866Tyr | p.C866YLRG_663t1:c.2597G>A, NM_000492.3:c.2597G>AVOUS12/03/2019
309CFTREx15NM_000492.3:c.2619+1G>ALRG_663t1:c.2619+1G>A, NM_000492.3:c.2619+1G>APathogenic05/18/2017 
310CFTREx16NM_000492.3:c.2620-26A>GLRG_663t1:c.2620-26A>G, NM_000492.3:c.2620-26A>GLikely benign04/23/2019 
311CFTREx16NM_000492.3:c.2620-15C>GLRG_663t1:c.2620-15C>G, NM_000492.3:c.2620-15C>GBenign11/29/2016 
312CFTREx16NM_000492.3:c.2620-6T>CLRG_663t1:c.2620-6T>C, NM_000492.3:c.2620-6T>CVOUS06/09/2016
313CFTREx16NM_000492.3:c.2657+2_2657+3insAc.2789insA, LRG_663t1:c.2657+2_2657+3insA, NM_000492.3:c.2657+2_2657+3insAPathogenic11/05/2019 
314CFTREx16NM_000492.3:c.2657+5G>ALRG_663t1:c.2657+5G>A, NM_000492.3:c.2657+5G>APathogenic12/04/2019 
315CFTREx17NM_000492.3:c.2658-2A>GLRG_663t1:c.2658-2A>G, NM_000492.3:c.2658-2A>GPathogenic10/17/2016 
316CFTREx17NM_000492.3:c.2659A>Cp.Thr887Pro | p.T887PLRG_663t1:c.2659A>C, NM_000492.3:c.2659A>CVOUS05/07/2019
317CFTREx17NM_000492.3:c.2665C>Tp.Leu889Phe | p.L889FLRG_663t1:c.2665C>T, NM_000492.3:c.2665C>TVOUS06/27/2018
318CFTREx17NM_000492.3:c.2673C>Gp.Asp891Glu | p.D891ELRG_663t1:c.2673C>G, NM_000492.3:c.2673C>GVOUS12/05/2016
319CFTREx17NM_000492.3:c.2709T>Cp.Tyr903= | p.Y903=LRG_663t1:c.2709T>C, NM_000492.3:c.2709T>CVOUS05/16/2019
320CFTREx17NM_000492.3:c.2723C>Ap.Thr908Asn | p.T908NLRG_663t1:c.2723C>A, NM_000492.3:c.2723C>AVOUS11/08/2019
321CFTREx17NM_000492.3:c.2732G>Cp.Ser911Thr | p.S911TVOUS01/13/2020
322CFTREx17NM_000492.3:c.2735C>Tp.Ser912Leu | p.S912LLRG_663t1:c.2735C>T, NM_000492.3:c.2735C>TVOUS03/21/2019
323CFTREx17NM_000492.3:c.2736G>Ap.Ser912= | p.S912=LRG_663t1:c.2736G>A, NM_000492.3:c.2736G>AVOUS01/02/2019
324CFTREx17NM_000492.3:c.2736G>Cp.Ser912= | p.S912=LRG_663t1:c.2736G>C, NM_000492.3:c.2736G>CVOUS08/22/2017
325CFTREx17NM_000492.3:c.2739T>Ap.Tyr913* | p.Y913XNM_000492.3:c.2739T>APathogenic** 
326CFTREx17NM_000492.3:c.2756A>Gp.Tyr919Cys | p.Y919CLRG_663t1:c.2756A>G, NM_000492.3:c.2756A>GVOUS07/06/2018
327CFTREx17NM_000492.3:c.2757C>Tp.Tyr919= | p.Y919=LRG_663t1:c.2757C>T, NM_000492.3:c.2757C>TVOUS11/02/2018
328CFTREx17NM_000492.3:c.2758G>Ap.Val920Met | p.V920MLRG_663t1:c.2758G>A, NM_000492.3:c.2758G>AVOUS01/08/2018
329CFTREx17NM_000492.3:c.2758G>Tp.Val920Leu | p.V920LLRG_663t1:c.2758G>T, NM_000492.3:c.2758G>TVOUS03/13/2017
330CFTREx17NM_000492.3:c.2769C>Tp.Ala923= | p.A923=LRG_663t1:c.2769C>T, NM_000492.3:c.2769C>TVOUS04/14/2017
331CFTREx17NM_000492.3:c.2770G>Ap.Asp924Asn | p.D924NLRG_663t1:c.2770G>A, NM_000492.3:c.2770G>AVOUS12/05/2016
332CFTREx17NM_000492.3:c.2772C>Ap.Asp924Glu | p.D924ELRG_663t1:c.2772C>A, NM_000492.3:c.2772C>AVOUS11/29/2017
333CFTREx17NM_000492.3:c.2797A>Gp.Arg933Gly | p.R933GLRG_663t1:c.2797A>G, NM_000492.3:c.2797A>GVOUS06/08/2017
334CFTREx17NM_000492.3:c.2805A>Gp.Leu935= | p.L935=LRG_663t1:c.2805A>G, NM_000492.3:c.2805A>GVOUS08/29/2019
335CFTREx17NM_000492.3:c.2813T>Gp.Val938Gly | p.V938GLRG_663t1:c.2813T>G, NM_000492.3:c.2813T>GVOUS10/19/2017
336CFTREx17NM_000492.3:c.2820T>Gp.Thr940= | p.T940=LRG_663t1:c.2820T>G, NM_000492.3:c.2820T>GLikely benign12/15/2016 
337CFTREx17NM_000492.3:c.2822delTp.Leu941Glnfs*27 | p.L941QfsX27LRG_663t1:c.2822delT, NM_000492.3:c.2822delTPathogenic10/25/2018 
338CFTREx17NM_000492.3:c.2832G>Ap.Val944= | p.V944=LRG_663t1:c.2832G>A, NM_000492.3:c.2832G>AVOUS12/11/2019
339CFTREx17NM_000492.3:c.2834C>Tp.Ser945Leu | p.S945LLRG_663t1:c.2834C>T, NM_000492.3:c.2834C>TPathogenic04/13/2015 
340CFTREx17NM_000492.3:c.2855T>Cp.Met952Thr | p.M952TLRG_663t1:c.2855T>C, NM_000492.3:c.2855T>CVOUS10/07/2016
341CFTREx17NM_000492.3:c.2856G>Ap.Met952Ile | p.M952ILRG_663t1:c.2856G>A, NM_000492.3:c.2856G>AVOUS05/17/2018
342CFTREx17NM_000492.3:c.2856G>Cp.Met952Ile | p.M952ILRG_663t1:c.2856G>C, NM_000492.3:c.2856G>CLikely pathogenic04/23/2019 
343CFTREx17NM_000492.3:c.2882T>Cp.Met961Thr | p.M961TLRG_663t1:c.2882T>C, NM_000492.3:c.2882T>CVOUS03/28/2017
344CFTREx17NM_000492.3:c.2895C>Ap.Asn965Lys | p.N965KLRG_663t1:c.2895C>A, NM_000492.3:c.2895C>AVOUS01/22/2020
345CFTREx17NM_000492.3:c.2898G>Ap.Thr966= | p.T966=LRG_663t1:c.2898G>A, NM_000492.3:c.2898G>ABenign10/12/2017 
346CFTREx17NM_000492.3:c.2900T>Cp.Leu967Ser | p.L967SLRG_663t1:c.2900T>C, NM_000492.3:c.2900T>CVOUS03/11/2019
347CFTREx17NM_000492.3:c.2908+4C>ALRG_663t1:c.2908+4C>A, NM_000492.3:c.2908+4C>AVOUS04/12/2018
348CFTREx17NM_000492.3:c.2908+19G>CVOUS**
349CFTREx18NM_000492.3:c.2909-4A>GLRG_663t1:c.2909-4A>G, NM_000492.3:c.2909-4A>GVOUS11/23/2016
350CFTREx18NM_000492.3:c.2909_2924dupGTGGGATTCTTAATAGp.Phe976Trpfs*4 | p.F976WfsX4LRG_663t1:c.2909_2924dupGTGGGATTCTTAATAG, NM_000492.3:c.2909_2924dupGTGGGATTCTTAATAGPathogenic11/05/2019 
351CFTREx18NM_000492.3:c.2946T>Gp.Ile982Met | p.I982MLRG_663t1:c.2946T>G, NM_000492.3:c.2946T>GVOUS07/22/2019
352CFTREx18NM_000492.3:c.2981T>Gp.Phe994Cys | p.F994CLRG_663t1:c.2981T>G, NM_000492.3:c.2981T>GVOUS08/09/2018
353CFTREx18NM_000492.3:c.2988G>Ap.Gln996= | p.Q996=LRG_663t1:c.2988G>A, NM_000492.3:c.2988G>APathogenic06/15/2017 
354CFTREx18NM_000492.3:c.2988+1G>A3120+1 G>A, LRG_663t1:c.2988+1G>A, NM_000492.3:c.2988+1G>APathogenic07/12/2019 
355CFTREx19NM_000492.3:c.2991G>Cp.Leu997Phe | p.L997FLRG_663t1:c.2991G>C, NM_000492.3:c.2991G>CVOUS08/05/2019
356CFTREx19NM_000492.3:c.2998A>Tp.Ile1000Phe | p.I1000FLRG_663t1:c.2998A>T, NM_000492.3:c.2998A>TVOUS12/11/2018
357CFTREx19NM_000492.3:c.3001G>Ap.Val1001Met | p.V1001MLRG_663t1:c.3001G>A, NM_000492.3:c.3001G>AVOUS09/06/2018
358CFTREx19NM_000492.3:c.3024C>Tp.Val1008= | p.V1008=NM_000492.3:c.3024C>TVOUS02/12/2015
359CFTREx19NM_000492.3:c.3025G>Ap.Ala1009Thr | p.A1009TLRG_663t1:c.3025G>A, NM_000492.3:c.3025G>AVOUS10/22/2019
360CFTREx19NM_000492.3:c.3036A>Gp.Gln1012= | p.Q1012=LRG_663t1:c.3036A>G, NM_000492.3:c.3036A>GVOUS09/19/2019
361CFTREx19NM_000492.3:c.3038C>Tp.Pro1013Leu | p.P1013LLRG_663t1:c.3038C>T, NM_000492.3:c.3038C>TVOUS12/26/2019
362CFTREx19NM_000492.3:c.3041A>Gp.Tyr1014Cys | p.Y1014CLRG_663t1:c.3041A>G, NM_000492.3:c.3041A>GVOUS08/15/2019
363CFTREx19NM_000492.3:c.3067_3072delATAGTGPathogenic08/06/2012 
364CFTREx19NM_000492.3:c.3073G>Tp.Ala1025Ser | p.A1025SLRG_663t1:c.3073G>T, NM_000492.3:c.3073G>TVOUS12/13/2018
365CFTREx19NM_000492.3:c.3080T>Cp.Ile1027Thr | p.I1027TLRG_663t1:c.3080T>C, NM_000492.3:c.3080T>CBenign12/18/2012 
366CFTREx19NM_000492.3:c.3083T>Gp.Met1028Arg | p.M1028RLRG_663t1:c.3083T>G, NM_000492.3:c.3083T>GVOUS08/27/2019
367CFTREx19NM_000492.3:c.3095A>Gp.Tyr1032Cys | p.Y1032CLRG_663t1:c.3095A>G, NM_000492.3:c.3095A>GLikely pathogenic06/11/2018 
368CFTREx19NM_000492.3:c.3100C>Tp.Leu1034Phe | p.L1034FLRG_663t1:c.3100C>T, NM_000492.3:c.3100C>TVOUS03/08/2017
369CFTREx19NM_000492.3:c.3121A>Cp.Lys1041Gln | p.K1041QLRG_663t1:c.3121A>C, NM_000492.3:c.3121A>CVOUS11/14/2019
370CFTREx19NM_000492.3:c.3139G>Tp.Gly1047Cys | p.G1047CLRG_663t1:c.3139G>T, NM_000492.3:c.3139G>TVOUS10/02/2015
371CFTREx19NM_000492.3:c.3139delGPathogenic** 
372CFTREx19NM_000492.3:c.3139+1delGPathogenic** 
373CFTREx19NM_000492.3:c.3139+8A>GLRG_663t1:c.3139+8A>G, NM_000492.3:c.3139+8A>GVOUS10/01/2018
374CFTREx19NM_000492.3:c.3139+18C>TVOUS**
375CFTREx19NM_000492.3:c.3139+42A>TBenign** 
376CFTREx20NM_000492.3:c.3140-26A>GLRG_663t1:c.3140-26A>G, NM_000492.3:c.3140-26A>GPathogenic04/27/2017 
377CFTREx20NM_000492.3:c.3154T>Gp.Phe1052Val | p.F1052VLRG_663t1:c.3154T>G, NM_000492.3:c.3154T>GVOUS11/25/2019
378CFTREx20NM_000492.3:c.3169A>Gp.Thr1057Ala | p.T1057ALRG_663t1:c.3169A>G, NM_000492.3:c.3169A>GVOUS09/02/2015
379CFTREx20NM_000492.3:c.3177A>Gp.Leu1059= | p.L1059=LRG_663t1:c.3177A>G, NM_000492.3:c.3177A>GVOUS09/17/2019
380CFTREx20NM_000492.3:c.3181G>Cp.Gly1061Arg | p.G1061RLRG_663t1:c.3181G>C, NM_000492.3:c.3181G>CLikely pathogenic03/02/2018 
381CFTREx20NM_000492.3:c.3194T>Cp.Leu1065Pro | p.L1065PNM_000492.3:c.3194T>CPathogenic12/16/2015 
382CFTREx20NM_000492.3:c.3196C>Tp.Arg1066Cys | p.R1066CLRG_663t1:c.3196C>T, NM_000492.3:c.3196C>TPathogenic06/12/2017 
383CFTREx20NM_000492.3:c.3197G>Ap.Arg1066His | p.R1066HLRG_663t1:c.3197G>A, NM_000492.3:c.3197G>APathogenic12/10/2018 
384CFTREx20NM_000492.3:c.3199G>Ap.Ala1067Thr | p.A1067TNM_000492.3:c.3199G>AVOUS04/16/2013
385CFTREx20NM_000492.3:c.3200C>Tp.Ala1067Val | p.A1067VNM_000492.3:c.3200C>TVOUS02/11/2016
386CFTREx20NM_000492.3:c.3205G>Ap.Gly1069Arg | p.G1069RLRG_663t1:c.3205G>A, NM_000492.3:c.3205G>AVOUS08/27/2019
387CFTREx20NM_000492.3:c.3209G>Ap.Arg1070Gln | p.R1070QLRG_663t1:c.3209G>A, NM_000492.3:c.3209G>APathogenic04/28/2015 
388CFTREx20NM_000492.3:c.3222T>Ap.Phe1074Leu | p.F1074LLRG_663t1:c.3222T>A, NM_000492.3:c.3222T>ALikely pathogenic05/23/2018 
389CFTREx20NM_000492.3:c.3256A>Gp.Thr1086Ala | p.T1086ALRG_663t1:c.3256A>G, NM_000492.3:c.3256A>GVOUS03/12/2019
390CFTREx20NM_000492.3:c.3256A>Tp.Thr1086Ser | p.T1086SLRG_663t1:c.3256A>T, NM_000492.3:c.3256A>TVOUS06/12/2017
391CFTREx20NM_000492.3:c.3273G>Cp.Leu1091Phe | p.L1091FLRG_663t1:c.3273G>C, NM_000492.3:c.3273G>CVOUS01/20/2020
392CFTREx20NM_000492.3:c.3274T>Cp.Tyr1092His | p.Y1092HLRG_663t1:c.3274T>C, NM_000492.3:c.3274T>CVOUS01/22/2018
393CFTREx20NM_000492.3:c.3275A>Gp.Tyr1092Cys | p.Y1092CLRG_663t1:c.3275A>G, NM_000492.3:c.3275A>GVOUS03/01/2017
394CFTREx20NM_000492.3:c.3276C>Ap.Tyr1092* | p.Y1092XLRG_663t1:c.3276C>A, NM_000492.3:c.3276C>APathogenic08/14/2018 
395CFTREx20NM_000492.3:c.3285A>Tp.Thr1095= | p.T1095=LRG_663t1:c.3285A>T, NM_000492.3:c.3285A>TBenign12/21/2015 
396CFTREx20NM_000492.3:c.3289C>Tp.Arg1097Cys | p.R1097CLRG_663t1:c.3289C>T, NM_000492.3:c.3289C>TVOUS05/16/2019
397CFTREx20NM_000492.3:c.3297C>Ap.Phe1099Leu | p.F1099LLRG_663t1:c.3297C>A, NM_000492.3:c.3297C>AVOUS04/08/2016
398CFTREx20NM_000492.3:c.3302T>Ap.Met1101Lys | p.M1101KLRG_663t1:c.3302T>A, NM_000492.3:c.3302T>APathogenic08/09/2019 
399CFTREx20NM_000492.3:c.3303G>Ap.Met1101Ile | p.M1101ILRG_663t1:c.3303G>A, NM_000492.3:c.3303G>AVOUS09/24/2018
400CFTREx20NM_000492.3:c.3306A>Gp.Arg1102= | p.R1102=LRG_663t1:c.3306A>G, NM_000492.3:c.3306A>GVOUS08/13/2019
401CFTREx20NM_000492.3:c.3367+45T>CNM_000492.3:c.3367+45T>CVOUS**
402CFTREx21NM_000492.3:c.3368-4A>GLRG_663t1:c.3368-4A>G, NM_000492.3:c.3368-4A>GVOUS07/07/2017
403CFTREx21NM_000492.3:c.3382A>Gp.Arg1128Gly | p.R1128GLRG_663t1:c.3382A>G, NM_000492.3:c.3382A>GVOUS07/28/2016
404CFTREx21NM_000492.3:c.3407C>Tp.Ala1136Val | p.A1136VLRG_663t1:c.3407C>T, NM_000492.3:c.3407C>TVOUS02/02/2018
405CFTREx21NM_000492.3:c.3409A>Gp.Met1137Val | p.M1137VLRG_663t1:c.3409A>G, NM_000492.3:c.3409A>GVOUS10/11/2019
406CFTREx21NM_000492.3:c.3411G>Cp.Met1137Ile | p.M1137ILRG_663t1:c.3411G>C, NM_000492.3:c.3411G>CVOUS12/23/2019
407CFTREx21NM_000492.3:c.3415A>Gp.Ile1139Val | p.I1139VLRG_663t1:c.3415A>G, NM_000492.3:c.3415A>GVOUS07/13/2018
408CFTREx21NM_000492.3:c.3420G>Ap.Met1140Ile | p.M1140ILRG_663t1:c.3420G>A, NM_000492.3:c.3420G>AVOUS03/07/2019
409CFTREx21NM_000492.3:c.3429G>Ap.Leu1143= | p.L1143=LRG_663t1:c.3429G>A, NM_000492.3:c.3429G>AVOUS12/04/2018
410CFTREx21NM_000492.3:c.3454G>Cp.Asp1152His | p.D1152HLRG_663t1:c.3454G>C, NM_000492.3:c.3454G>CPathogenic01/13/2020 
411CFTREx21NM_000492.3:c.3468G>Ap.Leu1156= | p.L1156=LRG_663t1:c.3468G>AVOUS12/11/2014
412CFTREx21NM_000492.3:c.3468+2dupTLRG_663t1:c.3468+2_3468+3insT, LRG_663t1:c.3468+2dupT, NM_000492.3:c.3468+2_3468+3insT, NM_000492.3:c.3468+2dupTLikely pathogenic12/27/2016 
413CFTREx22NM_000492.3:c.3469-20T>CLRG_663t1:c.3469-20T>C, NM_000492.3:c.3469-20T>CBenign03/29/2019 
414CFTREx22NM_000492.3:c.3469-17T>CLRG_663t1:c.3469-17T>C, NM_000492.3:c.3469-17T>CVOUS06/27/2019
415CFTREx22NM_000492.3:c.3472C>Tp.Arg1158* | p.R1158XLRG_663t1:c.3472C>T, NM_000492.3:c.3472C>TPathogenic10/29/2018 
416CFTREx22NM_000492.3:c.3485G>Tp.Arg1162Leu | p.R1162LLRG_663t1:c.3485G>T, NM_000492.3:c.3485G>TVOUS11/06/2019
417CFTREx22NM_000492.3:c.3485G>Ap.Arg1162Gln | p.R1162QLRG_663t1:c.3485G>A, NM_000492.3:c.3485G>AVOUS04/03/2018
418CFTREx22NM_000492.3:c.3503A>Gp.Asp1168Gly | p.D1168GLRG_663t1:c.3503A>G, NM_000492.3:c.3503A>GVOUS05/30/2017
419CFTREx22NM_000492.3:c.3508C>Tp.Pro1170Ser | p.P1170SLRG_663t1:c.3508C>T, NM_000492.3:c.3508C>TVOUS10/11/2018
420CFTREx22NM_000492.3:c.3517G>Ap.Gly1173Ser | p.G1173SLRG_663t1:c.3517G>A, NM_000492.3:c.3517G>AVOUS09/26/2016
421CFTREx22NM_000492.3:c.3528delCp.Lys1177Serfs*15 | p.K1177SfsX15LRG_663t1:c.3528delC, NM_000492.3:c.3528delCPathogenic03/13/2017 
422CFTREx22NM_000492.3:c.3558A>Gp.Gln1186= | p.Q1186=LRG_663t1:c.3558A>G, NM_000492.3:c.3558A>GVOUS10/03/2019
423CFTREx22NM_000492.3:c.3564G>Ap.Ser1188= | p.S1188=LRG_663t1:c.3564G>A, NM_000492.3:c.3564G>AVOUS06/20/2013
424CFTREx22NM_000492.3:c.3588A>Tp.Ser1196= | p.S1196=LRG_663t1:c.3588A>T, NM_000492.3:c.3588A>TVOUS08/30/2018
425CFTREx22NM_000492.3:c.3607A>Gp.Ile1203Val | p.I1203VNM_000492.3:c.3607A>GVOUS01/23/2014
426CFTREx22NM_000492.3:c.3612G>Ap.Trp1204* | p.W1204XLRG_663t1:c.3612G>A, NM_000492.3:c.3612G>APathogenic01/03/2013 
427CFTREx22NM_000492.3:c.3659C>Tp.Thr1220Ile | p.T1220ILRG_663t1:c.3659C>T, NM_000492.3:c.3659C>TVOUS04/19/2018
428CFTREx22NM_000492.3:c.3665G>Ap.Gly1222Asp | p.G1222DLRG_663t1:c.3665G>A, NM_000492.3:c.3665G>AVOUS09/05/2017
429CFTREx22NM_000492.3:c.3682G>Cp.Glu1228Gln | p.E1228QLRG_663t1:c.3682G>C, NM_000492.3:c.3682G>CVOUS05/29/2019
430CFTREx22NM_000492.3:c.3705T>Gp.Ser1235Arg | p.S1235RLRG_663t1:c.3705T>G, NM_000492.3:c.3705T>GBenign07/24/2012 
431CFTREx22NM_000492.3:c.3710G>Ap.Gly1237Asp | p.G1237DLRG_663t1:c.3710G>A, NM_000492.3:c.3710G>AVOUS09/17/2018
432CFTREx22NM_000492.3:c.3713A>Gp.Gln1238Arg | p.Q1238RLRG_663t1:c.3713A>G, NM_000492.3:c.3713A>GVOUS07/31/2019
433CFTREx22NM_000492.3:c.3717+40A>GLRG_663t1:c.3717+40A>G, NM_000492.3:c.3717+40A>GLikely pathogenic08/31/2017 
434CFTREx22NM_000492.3:c.3717+45G>ALRG_663t1:c.3717+45G>A, NM_000492.3:c.3717+45G>ABenign03/14/2019 
435CFTREx22NM_000492.3:c.3717+12191C>T3849+10kb C>T, LRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic01/03/2020 
436CFTREx23NM_000492.3:c.3718-2530A>GLRG_663t1:c.3718-2530A>G, NM_000492.3:c.3718-2530A>GBenign10/26/2016 
437CFTREx23NM_000492.3:c.3718-2477C>TLRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic05/08/2017 
438CFTREx23NM_000492.3:c.3718-24G>ALRG_663t1:c.3718-24G>A, NM_000492.3:c.3718-24G>AVOUS12/12/2018
439CFTREx23NM_000492.3:c.3744delAp.Lys1250Argfs*9 | p.K1250RfsX9LRG_663t1:c.3744delA, NM_000492.3:c.3744delAPathogenic10/02/2018 
440CFTREx23NM_000492.3:c.3747G>Ap.Gly1249= | p.G1249=LRG_663t1:c.3747G>A, NM_000492.3:c.3747G>AVOUS01/15/2015
441CFTREx23NM_000492.3:c.3761T>Gp.Leu1254* | p.L1254XPathogenic** 
442CFTREx23NM_000492.3:c.3762A>Gp.Leu1254= | p.L1254=LRG_663t1:c.3762A>G, NM_000492.3:c.3762A>GVOUS06/19/2019
443CFTREx23NM_000492.3:c.3764C>Ap.Ser1255* | p.S1255XPathogenic** 
444CFTREx23NM_000492.3:c.3772T>Cp.Leu1258= | p.L1258=LRG_663t1:c.3772T>C, NM_000492.3:c.3772T>CVOUS06/26/2017
445CFTREx23NM_000492.3:c.3794G>Tp.Gly1265Val | p.G1265VLRG_663t1:c.3794G>T, NM_000492.3:c.3794G>TVOUS06/08/2017
446CFTREx23NM_000492.3:c.3808G>Ap.Asp1270Asn | p.D1270NLRG_663t1:c.3808G>A, NM_000492.3:c.3808G>AVOUS11/12/2019
447CFTREx23NM_000492.3:c.3811G>Ap.Gly1271Ser | p.G1271SVOUS12/26/2019
448CFTREx23NM_000492.3:c.3815T>Ap.Val1272Glu | p.V1272ENM_000492.3:c.3815T>AVOUS04/23/2015
449CFTREx23NM_000492.3:c.3836T>Cp.Leu1279Ser | p.L1279SLRG_663t1:c.3836T>C, NM_000492.3:c.3836T>CVOUS04/04/2018
450CFTREx23NM_000492.3:c.3844T>Cp.Trp1282Arg | p.W1282RLRG_663t1:c.3844T>C, NM_000492.3:c.3844T>CVOUS12/05/2019
451CFTREx23NM_000492.3:c.3846G>Ap.Trp1282* | p.W1282XLRG_663t1:c.3846G>A, NM_000492.3:c.3846G>APathogenic12/05/2019 
452CFTREx23NM_000492.3:c.3846G>Cp.Trp1282Cys | p.W1282CLRG_663t1:c.3846G>C, NM_000492.3:c.3846G>CVOUS08/15/2018
453CFTREx23NM_000492.3:c.3852A>Gp.Lys1284= | p.K1284=LRG_663t1:c.3852A>G, NM_000492.3:c.3852A>GVOUS10/19/2017
454CFTREx23NM_000492.3:c.3853G>Ap.Ala1285Thr | p.A1285TLRG_663t1:c.3853G>A, NM_000492.3:c.3853G>AVOUS10/10/2017
455CFTREx23NM_000492.3:c.3854C>Tp.Ala1285Val | p.A1285VLRG_663t1:c.3854C>T, NM_000492.3:c.3854C>TVOUS02/01/2020
456CFTREx23NM_000492.3:c.3870A>Gp.Pro1290= | p.P1290=LRG_663t1:c.3870A>G, NM_000492.3:c.3870A>GBenign11/01/2018 
457CFTREx23NM_000492.3:c.3873+7A>TLRG_663t1:c.3873+7A>T, NM_000492.3:c.3873+7A>TVOUS09/20/2017
458CFTREx24NM_000492.3:c.3874-4522A>GLRG_663t1:c.3874-4522A>G, NM_000492.3:c.3874-4522A>GLikely pathogenic08/26/2019 
459CFTREx24NM_000492.3:c.3874-21_3874-15dupTTCTTTTLRG_663t1:c.3874-15_3874-14insTTCTTTT, LRG_663t1:c.3874-21_3874-15dupTTCTTTT, LRG_663t1:c.3874-21_3874-15insTTCTTTT, NM_000492.3:c.3874-15_3874-14insTTCTTTT, NM_000492.3:c.3874-21_3874-15dupTTCTTTT, NM_000492.3:c.3874-21_3874-15insTTCTTTTVOUS02/22/2017
460CFTREx24NM_000492.3:c.3874-14C>GVOUS12/10/2019
461CFTREx24NM_000492.3:c.3874-14_3874-10delCTTTTLRG_663t1:c.3874-14_3874-10delCTTTT, NM_000492.3:c.3874-14_3874-10delCTTTTLikely benign11/27/2018 
462CFTREx24NM_000492.3:c.3893G>Tp.Gly1298Val | p.G1298VLRG_663t1:c.3893G>T, NM_000492.3:c.3893G>TVOUS10/13/2017
463CFTREx24NM_000492.3:c.3895A>Gp.Thr1299Ala | p.T1299ALRG_663t1:c.3895A>G, NM_000492.3:c.3895A>GVOUS09/06/2018
464CFTREx24NM_000492.3:c.3897A>Gp.Thr1299= | p.T1299=LRG_663t1:c.3897A>G, NM_000492.3:c.3897A>GLikely benign01/11/2017 
465CFTREx24NM_000492.3:c.3909C>Gp.Asn1303Lys | p.N1303KLRG_663t1:c.3909C>G, NM_000492.3:c.3909C>GPathogenic09/17/2019 
466CFTREx24NM_000492.3:c.3933T>Gp.Ser1311Arg | p.S1311RLRG_663t1:c.3933T>G, NM_000492.3:c.3933T>GVOUS09/27/2016
467CFTREx24NM_000492.3:c.3963+6G>TVOUS01/21/2020
468CFTREx25NM_000492.3:c.3964-16T>CNM_000492.3:c.3964-16T>CVOUS08/25/2014
469CFTREx25NM_000492.3:c.3983T>Cp.Ile1328Thr | p.I1328TLRG_663t1:c.3983T>C, NM_000492.3:c.3983T>CVOUS04/09/2019
470CFTREx25NM_000492.3:c.3999delGNM_000492.3:c.3999delGPathogenic09/04/2015 
471CFTREx25NM_000492.3:c.4036C>Tp.Leu1346= | p.L1346=LRG_663t1:c.4036C>T, NM_000492.3:c.4036C>TVOUS11/15/2017
472CFTREx25NM_000492.3:c.4045G>Ap.Gly1349Ser | p.G1349SLRG_663t1:c.4045G>A, NM_000492.3:c.4045G>AVOUS06/27/2017
473CFTREx25NM_000492.3:c.4053_4054delGCinsAGp.Gln1352Glu | p.Q1352ELRG_663t1:c.4053_4054delinsAG, NM_000492.3:c.4053_4054delinsAGVOUS09/21/2018
474CFTREx25NM_000492.3:c.4056G>Cp.Gln1352His | p.Q1352HLRG_663t1:c.4056G>C, NM_000492.3:c.4056G>CVOUS01/16/2020
475CFTREx25NM_000492.3:c.4058delTp.Leu1353* | p.L1353XLRG_663t1:c.4058delT, NM_000492.3:c.4058delTPathogenic02/23/2018 
476CFTREx25NM_000492.3:c.4077_4080delTGTTinsAAp.Val1360Thrfs*3 | p.V1360TfsX3LRG_663t1:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delinsAAPathogenic** 
477CFTREx25NM_000492.3:c.4092G>Ap.Ala1364= | p.A1364=LRG_663t1:c.4092G>A, NM_000492.3:c.4092G>AVOUS07/12/2019
478CFTREx25NM_000492.3:c.4097T>Cp.Ile1366Thr | p.I1366TLRG_663t1:c.4097T>C, NM_000492.3:c.4097T>CVOUS11/23/2019
479CFTREx25NM_000492.3:c.4121C>Gp.Ala1374Gly | p.A1374GLRG_663t1:c.4121C>G, NM_000492.3:c.4121C>GVOUS02/17/2017
480CFTREx25NM_000492.3:c.4123C>Ap.His1375Asn | p.H1375NLRG_663t1:c.4123C>A, NM_000492.3:c.4123C>AVOUS12/28/2017
481CFTREx25NM_000492.3:c.4129G>Cp.Asp1377His | p.D1377HLRG_663t1:c.4129G>C, NM_000492.3:c.4129G>CVOUS06/23/2016
482CFTREx26NM_000492.3:c.4159A>Gp.Thr1387Ala | p.T1387ALRG_663t1:c.4159A>G, NM_000492.3:c.4159A>GVOUS12/21/2017
483CFTREx26NM_000492.3:c.4195C>Gp.Leu1399Val | p.L1399VLRG_663t1:c.4195C>G, NM_000492.3:c.4195C>GVOUS05/11/2018
484CFTREx26NM_000492.3:c.4197C>Gp.Leu1399= | p.L1399=LRG_663t1:c.4197C>G, NM_000492.3:c.4197C>GVOUS05/02/2017
485CFTREx26NM_000492.3:c.4197C>Tp.Leu1399= | p.L1399=LRG_663t1:c.4197C>T, NM_000492.3:c.4197C>TVOUS09/30/2019
486CFTREx26NM_000492.3:c.4232A>Cp.Gln1411Pro | p.Q1411PLRG_663t1:c.4232A>C, NM_000492.3:c.4232A>CVOUS12/23/2019
487CFTREx26NM_000492.3:c.4241T>Cp.Leu1414Ser | p.L1414SLRG_663t1:c.4241T>C, NM_000492.3:c.4241T>CVOUS02/01/2018
488CFTREx26NM_000492.3:c.4242+10T>CLRG_663t1:c.4242+10T>C, NM_000492.3:c.4242+10T>CBenign05/24/2013 
489CFTREx26NM_000492.3:c.4242+13A>GBenign04/29/2013 
490CFTREx27NM_000492.3:c.*2G>ALRG_663t1:c.*2G>A, NM_000492.3:c.*2G>AVOUS05/21/2019
491CFTREx27NM_000492.3:c.*10T>ALRG_663t1:c.*10T>A, NM_000492.3:c.*10T>AVOUS**
492CFTREx27NM_000492.3:c.*1043A>CLRG_663t1:c.*1043A>C, NM_000492.3:c.*1043A>CBenign03/28/2017 
493CFTREx27NM_000492.3:c.4243-20A>GLRG_663t1:c.4243-20A>G, NM_000492.3:c.4243-20A>GVOUS06/05/2019
494CFTREx27NM_000492.3:c.4243-5C>TLRG_663t1:c.4243-5C>T, NM_000492.3:c.4243-5C>TBenign08/25/2015 
495CFTREx27NM_000492.3:c.4251delAp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4251delA, NM_000492.3:c.4251delAPathogenic10/26/2017 
496CFTREx27NM_000492.3:c.4252delGp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4252delG, NM_000492.3:c.4252delGPathogenic12/21/2018 
497CFTREx27NM_000492.3:c.4272C>Tp.Tyr1424= | p.Y1424=LRG_663t1:c.4272C>T, NM_000492.3:c.4272C>TBenign11/14/2017 
498CFTREx27NM_000492.3:c.4296C>Tp.Asn1432= | p.N1432=LRG_663t1:c.4296C>T, NM_000492.3:c.4296C>TVOUS02/07/2020
499CFTREx27NM_000492.3:c.4322T>Cp.Ile1441Thr | p.I1441TNM_000492.3:c.4322T>CVOUS06/26/2015
500CFTREx27NM_000492.3:c.4332C>Tp.Ser1444= | p.S1444=LRG_663t1:c.4332C>T, NM_000492.3:c.4332C>TVOUS05/09/2017
501CFTREx27NM_000492.3:c.4333G>Ap.Asp1445Asn | p.D1445NLRG_663t1:c.4333G>A, NM_000492.3:c.4333G>AVOUS04/08/2019
502CFTREx27NM_000492.3:c.4357C>Tp.Arg1453Trp | p.R1453WLRG_663t1:c.4357C>T, NM_000492.3:c.4357C>TVOUS12/03/2019
503CFTREx27NM_000492.3:c.4358G>Ap.Arg1453Gln | p.R1453QLRG_663t1:c.4358G>A, NM_000492.3:c.4358G>AVOUS08/21/2019
504CFTREx27NM_000492.3:c.4383G>Tp.Lys1461Asn | p.K1461NLRG_663t1:c.4383G>T, NM_000492.3:c.4383G>TVOUS12/20/2017
505CFTREx27NM_000492.3:c.4387C>Tp.Gln1463* | p.Q1463XLRG_663t1:c.4387C>T, NM_000492.3:c.4387C>TVOUS08/15/2016
506CFTREx27NM_000492.3:c.4389G>Ap.Gln1463= | p.Q1463=LRG_663t1:c.4389G>A, NM_000492.3:c.4389G>ABenign11/20/2018 
507CFTREx27NM_000492.3:c.4417G>Ap.Glu1473Lys | p.E1473KLRG_663t1:c.4417G>A, NM_000492.3:c.4417G>AVOUS05/05/2017
508CFTREx27NM_000492.3:c.4426C>Tp.Gln1476* | p.Q1476XLRG_663t1:c.4426C>T, NM_000492.3:c.4426C>TPathogenic05/15/2018 
509CFTREx27NM_000492.3:c.4427A>Gp.Gln1476Arg | p.Q1476RLRG_663t1:c.4427A>G, NM_000492.3:c.4427A>GVOUS01/30/2020
510CFTREx27NM_000492.3:c.4436G>Ap.Arg1479Lys | p.R1479KLRG_663t1:c.4436G>A, NM_000492.3:c.4436G>AVOUS12/19/2019

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by EGL Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2020-Q1.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official EGL clinical report and should be approached with caution. Only variants identified at EGL are listed in the EmVClass. If you intend to use EGL's classification for publication purposes please contact the laboratory for permission.