Loading Data . . .

EmVClass

EGL's Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by EGL Genetics for that gene.
EGL Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CFTREx1NM_000492.3:c.-2C>GLRG_663t1:c.-2C>G, NM_000492.3:c.-2C>GVOUS06/28/2019
2CFTREx1NM_000492.3:c.-4G>CLRG_663t1:c.-4G>C, NM_000492.3:c.-4G>CLikely benign05/18/2015 
3CFTREx1NM_000492.3:c.-8G>CLRG_663t1:c.-8G>C, NM_000492.3:c.-8G>CBenign07/06/2017 
4CFTREx1NM_000492.3:c.10T>Cp.Ser4Pro | p.S4PLRG_663t1:c.10T>C, NM_000492.3:c.10T>CVOUS03/05/2019
5CFTREx1NM_000492.3:c.14C>Tp.Pro5Leu | p.P5LLRG_663t1:c.14C>T, NM_000492.3:c.14C>TLikely pathogenic11/20/2017 
6CFTREx1NM_000492.3:c.19G>Tp.Glu7* | p.E7XLRG_663t1:c.19G>T, NM_000492.3:c.19G>TPathogenic05/16/2016 
7CFTREx1NM_000492.3:c.40A>Gp.Lys14Glu | p.K14ELRG_663t1:c.40A>G, NM_000492.3:c.40A>GVOUS12/28/2017
8CFTREx1NM_000492.3:c.49_50dupTTp.Trp19Alafs*7 | p.W19AfsX7LRG_663t1:c.49_50dupTT, NM_000492.3:c.49_50dupTTPathogenic04/27/2018 
9CFTREx1NM_000492.3:c.53+45A>GLRG_663t1:c.53+45A>G, NM_000492.3:c.53+45A>GVOUS**
10CFTREx1NM_000492.3:c.-132-680T>GLRG_663t1:c.-812T>G, NM_000492.3:c.-812T>GLikely benign01/18/2017 
11CFTREx1NM_000492.3:c.-132-329A>GLRG_663t1:c.-461A>G, NM_000492.3:c.-461A>GVOUS04/29/2019
12CFTREx1NM_000492.3:c.-132-316A>GLRG_663t1:c.-448A>G, NM_000492.3:c.-448A>GVOUS05/24/2019
13CFTREx1NM_000492.3:c.-132-156G>CLRG_663t1:c.-288G>C, NM_000492.3:c.-288G>CLikely benign03/20/2017 
14CFTREx1NM_000492.3:c.-132-94G>TLRG_663t1:c.-226G>T, NM_000492.3:c.-226G>TVOUS07/22/2019
15CFTREx1NM_000492.3:c.-132-33G>ALRG_663t1:c.-165G>A, NM_000492.3:c.-165G>AVOUS04/19/2018
16CFTREx1NM_000492.3:c.-132-20G>CLRG_663t1:c.-152G>C, NM_000492.3:c.-152G>CVOUS03/14/2019
17CFTREx1NM_000492.3:c.-132T>GLRG_663t1:c.-132T>G, NM_000492.3:c.-132T>GVOUS01/09/2017
18CFTREx2NM_000492.3:c.91C>Tp.Arg31Cys | p.R31CLRG_663t1:c.91C>T, NM_000492.3:c.91C>TVOUS03/07/2019
19CFTREx2NM_000492.3:c.92G>Tp.Arg31Leu | p.R31LLRG_663t1:c.92G>T, NM_000492.3:c.92G>TVOUS06/07/2018
20CFTREx2NM_000492.3:c.94C>Ap.Leu32Met | p.L32MLRG_663t1:c.94C>A, NM_000492.3:c.94C>AVOUS06/15/2017
21CFTREx2NM_000492.3:c.109A>Gp.Ile37Val | p.I37VLRG_663t1:c.109A>G, NM_000492.3:c.109A>GVOUS03/15/2018
22CFTREx2NM_000492.3:c.125C>Tp.Ser42Phe | p.S42FLRG_663t1:c.125C>T, NM_000492.3:c.125C>TVOUS06/29/2018
23CFTREx2NM_000492.3:c.137C>Tp.Ala46Val | p.A46VLRG_663t1:c.137C>T, NM_000492.3:c.137C>TVOUS09/04/2018
24CFTREx2NM_000492.3:c.164+9A>GLRG_663t1:c.164+9A>G, NM_000492.3:c.164+9A>GVOUS12/26/2018
25CFTREx2NM_000492.3:c.164+10delTinsATGALRG_663t1:c.164+10delinsATGA, NM_000492.3:c.164+10delinsATGAVOUS**
26CFTREx2NM_000492.3:c.164+12T>CLRG_663t1:c.164+12T>C, NM_000492.3:c.164+12T>CVOUS10/26/2018
27CFTREx2NM_000492.3:c.164+28A>GLRG_663t1:c.164+28A>G, NM_000492.3:c.164+28A>GBenign11/20/2018 
28CFTREx3NM_000492.3:c.165-3C>TLRG_663t1:c.165-3C>T, NM_000492.3:c.165-3C>TPathogenic12/31/2018 
29CFTREx3NM_000492.3:c.165-1G>ALRG_663t1:c.165-1G>A, NM_000492.3:c.165-1G>APathogenic01/19/2016 
30CFTREx3NM_000492.3:c.180G>Cp.Glu60Asp | p.E60DLRG_663t1:c.180G>C, NM_000492.3:c.180G>CVOUS01/11/2018
31CFTREx3NM_000492.3:c.181C>Tp.Leu61= | p.L61=LRG_663t1:c.181C>T, NM_000492.3:c.181C>TVOUS12/11/2018
32CFTREx3NM_000492.3:c.200C>Tp.Pro67Leu | p.P67LLRG_663t1:c.200C>TPathogenic07/09/2018 
33CFTREx3NM_000492.3:c.202A>Gp.Lys68Glu | p.K68ELRG_663t1:c.202A>G, NM_000492.3:c.202A>GVOUS08/21/2018
34CFTREx3NM_000492.3:c.220C>Tp.Arg74Trp | p.R74WLRG_663t1:c.220C>T, NM_000492.3:c.220C>TLikely pathogenic03/22/2019 
35CFTREx3NM_000492.3:c.221G>Ap.Arg74Gln | p.R74QLRG_663t1:c.221G>A, NM_000492.3:c.221G>AVOUS07/19/2017
36CFTREx3NM_000492.3:c.224G>Ap.Arg75Gln | p.R75QLRG_663t1:c.224G>A, NM_000492.3:c.224G>ALikely benign10/20/2017 
37CFTREx3NM_000492.3:c.226T>Ap.Cys76Ser | p.C76SLRG_663t1:c.226T>A, NM_000492.3:c.226T>AVOUS09/06/2016
38CFTREx3NM_000492.3:c.233dupTp.Trp79Leufs*32 | p.W79LfsX32LRG_663t1:c.233dupT, NM_000492.3:c.233dupTPathogenic10/10/2018 
39CFTREx3NM_000492.3:c.246G>Ap.Met82Ile | p.M82ILRG_663t1:c.246G>A, NM_000492.3:c.246G>AVOUS03/22/2019
40CFTREx3NM_000492.3:c.250T>Cp.Tyr84His | p.Y84HLRG_663t1:c.250T>C, NM_000492.3:c.250T>CVOUS01/26/2017
41CFTREx3NM_000492.3:c.254G>Ap.Gly85Glu | p.G85ELRG_663t1:c.254G>A, NM_000492.3:c.254G>APathogenic02/07/2017 
42CFTREx3NM_000492.3:c.262_263delTTp.Leu88Ilefs*22 | p.L88IfsX22LRG_663t1:c.262_263delTT, NM_000492.3:c.262_263delTTPathogenic** 
43CFTREx4NM_000492.3:c.274-6T>CLRG_663t1:c.274-6T>C, NM_000492.3:c.274-6T>CVOUS04/19/2019
44CFTREx4NM_000492.3:c.274-1G>ALRG_663t1:c.274-1G>A, NM_000492.3:c.274-1G>APathogenic06/24/2014 
45CFTREx4NM_000492.3:c.290T>Cp.Val97Ala | p.V97AVOUS**
46CFTREx4NM_000492.3:c.316A>Gp.Ile106Val | p.I106VLRG_663t1:c.316A>G, NM_000492.3:c.316A>GVOUS10/05/2016
47CFTREx4NM_000492.3:c.326A>Gp.Tyr109Cys | p.Y109CLRG_663t1:c.326A>G, NM_000492.3:c.326A>GLikely pathogenic02/08/2019 
48CFTREx4NM_000492.3:c.328G>Cp.Asp110His | p.D110HLRG_663t1:c.328G>C, NM_000492.3:c.328G>CPathogenic12/06/2018 
49CFTREx4NM_000492.3:c.328G>Tp.Asp110Tyr | p.D110YLRG_663t1:c.328G>T, NM_000492.3:c.328G>TPathogenic** 
50CFTREx4NM_000492.3:c.330C>Ap.Asp110Glu | p.D110ELRG_663t1:c.330C>A, NM_000492.3:c.330C>APathogenic05/23/2017 
51CFTREx4NM_000492.3:c.332C>Tp.Pro111Leu | p.P111LLRG_663t1:c.332C>T, NM_000492.3:c.332C>TVOUS08/07/2019
52CFTREx4NM_000492.3:c.332C>Gp.Pro111Arg | p.P111RLRG_663t1:c.332C>G, NM_000492.3:c.332C>GVOUS08/02/2016
53CFTREx4NM_000492.3:c.349C>Tp.Arg117Cys | p.R117CLRG_663t1:c.349C>T, NM_000492.3:c.349C>TPathogenic12/06/2017 
54CFTREx4NM_000492.3:c.350G>Ap.Arg117His | p.R117HLRG_663t1:c.350G>A, NM_000492.3:c.350G>APathogenic05/24/2019 
55CFTREx4NM_000492.3:c.350G>Tp.Arg117Leu | p.R117LLRG_663t1:c.350G>T, NM_000492.3:c.350G>TPathogenic** 
56CFTREx4NM_000492.3:c.358G>Ap.Ala120Thr | p.A120TLRG_663t1:c.358G>A, NM_000492.3:c.358G>AVOUS11/14/2018
57CFTREx4NM_000492.3:c.360G>Ap.Ala120= | p.A120=LRG_663t1:c.360G>A, NM_000492.3:c.360G>AVOUS08/22/2019
58CFTREx4NM_000492.3:c.374T>Cp.Ile125Thr | p.I125TLRG_663t1:c.374T>C, NM_000492.3:c.374T>CLikely benign03/13/2017 
59CFTREx4NM_000492.3:c.377G>Tp.Gly126Val | p.G126VLRG_663t1:c.377G>T, NM_000492.3:c.377G>TVOUS05/25/2018
60CFTREx4NM_000492.3:c.393T>Cp.Phe131= | p.F131=LRG_663t1:c.393T>C, NM_000492.3:c.393T>CVOUS08/30/2018
61CFTREx4NM_000492.3:c.403A>Gp.Thr135Ala | p.T135ALRG_663t1:c.403A>G, NM_000492.3:c.403A>GVOUS12/13/2017
62CFTREx4NM_000492.3:c.416A>Cp.His139Pro | p.H139PLRG_663t1:c.416A>C, NM_000492.3:c.416A>CVOUS03/30/2018
63CFTREx4NM_000492.3:c.418C>Tp.Pro140Ser | p.P140SLRG_663t1:c.418C>T, NM_000492.3:c.418C>TVOUS01/21/2019
64CFTREx4NM_000492.3:c.442delAp.Ile148Leufs*5 | p.I148LfsX5LRG_663t1:c.442delA, NM_000492.3:c.442delAPathogenic09/22/2017 
65CFTREx4NM_000492.3:c.443T>Cp.Ile148Thr | p.I148TLRG_663t1:c.443T>C, NM_000492.3:c.443T>CBenign08/06/2012 
66CFTREx4NM_000492.3:c.443T>Ap.Ile148Asn | p.I148NLRG_663t1:c.443T>A, NM_000492.3:c.443T>AVOUS02/27/2017
67CFTREx4NM_000492.3:c.451C>Ap.Gln151Lys | p.Q151KLRG_663t1:c.451C>A, NM_000492.3:c.451C>AVOUS07/14/2019
68CFTREx4NM_000492.3:c.454A>Tp.Met152Leu | p.M152LLRG_663t1:c.454A>T, NM_000492.3:c.454A>TVOUS01/09/2019
69CFTREx4NM_000492.3:c.489+1G>T 621+1G->T, LRG_663t1:c.489+1G>T, NM_000492.3:c.489+1G>TPathogenic11/24/2018 
70CFTREx4NM_000492.3:c.489+3A>GLRG_663t1:c.489+3A>G, NM_000492.3:c.489+3A>GVOUS10/25/2018
71CFTREx4NM_000492.3:c.489+8T>GLRG_663t1:c.489+8T>G, NM_000492.3:c.489+8T>GVOUS02/20/2018
72CFTREx4NM_000492.3:c.489+87A>GLRG_663t1:c.489+87A>G, NM_000492.3:c.489+87A>GVOUS02/15/2018
73CFTREx5NM_000492.3:c.509G>Ap.Arg170His | p.R170HLRG_663t1:c.509G>A, NM_000492.3:c.509G>AVOUS08/29/2019
74CFTREx5NM_000492.3:c.530T>Cp.Ile177Thr | p.I177TLRG_663t1:c.530T>C, NM_000492.3:c.530T>CVOUS11/07/2018
75CFTREx5NM_000492.3:c.538C>Gp.Leu180Val | p.L180VLRG_663t1:c.538C>G, NM_000492.3:c.538C>GVOUS04/08/2019
76CFTREx5NM_000492.3:c.547C>Ap.Leu183Ile | p.L183ILRG_663t1:c.547C>A, NM_000492.3:c.547C>AVOUS03/26/2019
77CFTREx5NM_000492.3:c.561C>Tp.Asn187= | p.N187=LRG_663t1:c.561C>T, NM_000492.3:c.561C>TVOUS06/26/2018
78CFTREx5NM_000492.3:c.571T>Gp.Phe191Val | p.F191VLRG_663t1:c.571T>G, NM_000492.3:c.571T>GLikely pathogenic04/21/2017 
79CFTREx5NM_000492.3:c.577G>Tp.Glu193* | p.E193XNM_000492.3:c.577G>TPathogenic08/18/2014 
80CFTREx5NM_000492.3:c.579+1G>TLRG_663t1:c.579+1G>T, NM_000492.3:c.579+1G>TPathogenic05/19/2016 
81CFTREx5NM_000492.3:c.579+4delTVOUS**
82CFTREx6NM_000492.3:c.581G>Tp.Gly194Val | p.G194VLRG_663t1:c.581G>T, NM_000492.3:c.581G>TVOUS11/07/2017
83CFTREx6NM_000492.3:c.592G>Ap.Ala198Thr | p.A198TLRG_663t1:c.592G>A, NM_000492.3:c.592G>AVOUS01/27/2017
84CFTREx6NM_000492.3:c.592G>Cp.Ala198Pro | p.A198PLRG_663t1:c.592G>C, NM_000492.3:c.592G>CVOUS03/14/2016
85CFTREx6NM_000492.3:c.601G>Ap.Val201Met | p.V201MLRG_663t1:c.601G>A, NM_000492.3:c.601G>AVOUS02/07/2018
86CFTREx6NM_000492.3:c.613C>Tp.Pro205Ser | p.P205SLRG_663t1:c.613C>T, NM_000492.3:c.613C>TPathogenic03/12/2019 
87CFTREx6NM_000492.3:c.617T>Gp.Leu206Trp | p.L206WLRG_663t1:c.617T>G, NM_000492.3:c.617T>GPathogenic05/17/2019 
88CFTREx6NM_000492.3:c.648G>Tp.Trp216Cys | p.W216CLRG_663t1:c.648G>T, NM_000492.3:c.648G>TVOUS06/12/2018
89CFTREx6NM_000492.3:c.650A>Gp.Glu217Gly | p.E217GLRG_663t1:c.650A>G, NM_000492.3:c.650A>GVOUS07/10/2018
90CFTREx6NM_000492.3:c.663G>Ap.Ala221= | p.A221=LRG_663t1:c.663G>A, NM_000492.3:c.663G>AVOUS08/25/2016
91CFTREx6NM_000492.3:c.688C>Tp.Leu230= | p.L230=LRG_663t1:c.688C>T, NM_000492.3:c.688C>TVOUS04/17/2018
92CFTREx6NM_000492.3:c.695T>Ap.Val232Asp | p.V232DLRG_663t1:c.695T>A, NM_000492.3:c.695T>APathogenic04/04/2018 
93CFTREx6NM_000492.3:c.708delTPathogenic** 
94CFTREx6NM_000492.3:c.709C>Gp.Gln237Glu | p.Q237ELRG_663t1:c.709C>G, NM_000492.3:c.709C>GLikely pathogenic01/08/2019 
95CFTREx6NM_000492.3:c.710A>Tp.Gln237Leu | p.Q237LLRG_663t1:c.710A>T, NM_000492.3:c.710A>TVOUS01/08/2019
96CFTREx6NM_000492.3:c.710A>Gp.Gln237Arg | p.Q237RLRG_663t1:c.710A>G, NM_000492.3:c.710A>GVOUS01/08/2019
97CFTREx6NM_000492.3:c.711G>Tp.Gln237His | p.Q237HLRG_663t1:c.711G>T, NM_000492.3:c.711G>TVOUS12/28/2018
98CFTREx6NM_000492.3:c.711G>Cp.Gln237His | p.Q237HLRG_663t1:c.711G>C, NM_000492.3:c.711G>CVOUS01/08/2019
99CFTREx6NM_000492.3:c.715G>Ap.Gly239Arg | p.G239RLRG_663t1:c.715G>A, NM_000492.3:c.715G>AVOUS08/15/2017
100CFTREx6NM_000492.3:c.738G>Ap.Lys246= | p.K246=LRG_663t1:c.738G>A, NM_000492.3:c.738G>ALikely benign12/07/2016 
101CFTREx6NM_000492.3:c.743+1G>ALRG_663t1:c.743+1G>A, NM_000492.3:c.743+1G>APathogenic07/06/2016 
102CFTREx6NM_000492.3:c.743+40A>GNM_000492.3:c.743+40A>GBenign** 
103CFTREx7NM_000492.3:c.744-33GATT(6_9)Benign11/20/2018 
104CFTREx7NM_000492.3:c.744-9_744-6dupGATTLRG_663t1:c.744-9_744-6dupGATT, NM_000492.3:c.744-9_744-6dupGATTBenign06/23/2017 
105CFTREx7NM_000492.3:c.772A>Gp.Arg258Gly | p.R258GLRG_663t1:c.772A>G, NM_000492.3:c.772A>GVOUS06/28/2017
106CFTREx7NM_000492.3:c.794T>Gp.Met265Arg | p.M265RLRG_663t1:c.794T>G, NM_000492.3:c.794T>GVOUS02/11/2019
107CFTREx7NM_000492.3:c.803delAp.Asn268Ilefs*17 | p.N268IfsX17LRG_663t1:c.803delA, NM_000492.3:c.803delAPathogenic07/25/2019 
108CFTREx7NM_000492.3:c.806T>Cp.Ile269Thr | p.I269TLRG_663t1:c.806T>C, NM_000492.3:c.806T>CVOUS08/22/2017
109CFTREx7NM_000492.3:c.837A>Tp.Glu279Asp | p.E279DLRG_663t1:c.837A>T, NM_000492.3:c.837A>TVOUS03/27/2017
110CFTREx7NM_000492.3:c.842T>Cp.Met281Thr | p.M281TLRG_663t1:c.842T>C, NM_000492.3:c.842T>CVOUS08/19/2019
111CFTREx7NM_000492.3:c.846A>Tp.Glu282Asp | p.E282DLRG_663t1:c.846A>T, NM_000492.3:c.846A>TVOUS05/23/2018
112CFTREx7NM_000492.3:c.848_860delAAATGATTGAAAAinsTGNM_000492.3:c.848_860delinsTGPathogenic10/27/2014 
113CFTREx7NM_000492.3:c.850dupALRG_663t1:c.850_851insA, NM_000492.3:c.850_851insAPathogenic03/28/2016 
114CFTREx7NM_000492.3:c.853A>Tp.Ile285Phe | p.I285FLRG_663t1:c.853A>T, NM_000492.3:c.853A>TLikely benign06/23/2017 
115CFTREx7NM_000492.3:c.861C>Gp.Asn287Lys | p.N287KLRG_663t1:c.861C>G, NM_000492.3:c.861C>GVOUS09/25/2018
116CFTREx7NM_000492.3:c.869+1G>CLRG_663t1:c.869+1G>C, NM_000492.3:c.869+1G>CPathogenic06/14/2018 
117CFTREx7NM_000492.3:c.869+11C>TLRG_663t1:c.869+11C>T, NM_000492.3:c.869+11C>TBenign05/19/2016 
118CFTREx7NM_000492.3:c.869+40A>GNM_000492.3:c.869+40A>GBenign** 
119CFTREx8NM_000492.3:c.870-7_870-5delTTTLRG_663t1:c.870-7_870-5delTTT, NM_000492.3:c.870-7_870-5delTTTLikely benign05/30/2017 
120CFTREx8NM_000492.3:c.889C>Tp.Arg297Trp | p.R297WLRG_663t1:c.889C>T, NM_000492.3:c.889C>TVOUS03/29/2019
121CFTREx8NM_000492.3:c.890G>Ap.Arg297Gln | p.R297QLikely benign09/26/2014 
122CFTREx8NM_000492.3:c.902A>Gp.Tyr301Cys | p.Y301CLRG_663t1:c.902A>G, NM_000492.3:c.902A>GVOUS09/03/2019
123CFTREx8NM_000492.3:c.925G>Tp.Ala309Ser | p.A309SLRG_663t1:c.925G>T, NM_000492.3:c.925G>TVOUS02/07/2019
124CFTREx8NM_000492.3:c.926C>Gp.Ala309Gly | p.A309GLRG_663t1:c.926C>G, NM_000492.3:c.926C>GVOUS11/14/2017
125CFTREx8NM_000492.3:c.935_937delTCTp.Phe312del | p.F312delLRG_663t1:c.935_937delTCT, NM_000492.3:c.935_937delTCTPathogenic11/19/2013 
126CFTREx8NM_000492.3:c.944T>Cp.Phe315Ser | p.F315SLRG_663t1:c.944T>C, NM_000492.3:c.944T>CVOUS09/15/2017
127CFTREx8NM_000492.3:c.948T>Gp.Phe316Leu | p.F316LLRG_663t1:c.948T>G, NM_000492.3:c.948T>GVOUS11/09/2017
128CFTREx8NM_000492.3:c.948delTp.Phe316Leufs*12 | p.F316LfsX12LRG_663t1:c.948delT, NM_000492.3:c.948delTPathogenic08/15/2017 
129CFTREx8NM_000492.3:c.958T>Gp.Leu320Val | p.L320VLRG_663t1:c.958T>G, NM_000492.3:c.958T>GVOUS04/23/2019
130CFTREx8NM_000492.3:c.960A>Gp.Leu320= | p.L320=LRG_663t1:c.960A>G, NM_000492.3:c.960A>GVOUS06/18/2019
131CFTREx8NM_000492.3:c.974A>Gp.Tyr325Cys | p.Y325CLRG_663t1:c.974A>G, NM_000492.3:c.974A>GVOUS09/13/2018
132CFTREx8NM_000492.3:c.1000C>Tp.Arg334Trp | p.R334WLRG_663t1:c.1000C>T, NM_000492.3:c.1000C>TPathogenic** 
133CFTREx8NM_000492.3:c.1001G>Ap.Arg334Gln | p.R334QLRG_663t1:c.1001G>A, NM_000492.3:c.1001G>AVOUS12/24/2018
134CFTREx8NM_000492.3:c.1007T>Ap.Ile336Lys | p.I336KLRG_663t1:c.1007T>A, NM_000492.3:c.1007T>APathogenic03/15/2017 
135CFTREx8NM_000492.3:c.1021T>Cp.Ser341Pro | p.S341PLRG_663t1:c.1021T>C, NM_000492.3:c.1021T>CPathogenic10/10/2016 
136CFTREx8NM_000492.3:c.1022_1023insTC1157InsTC, NM_000492.3:c.1022_1023insTCPathogenic07/10/2014 
137CFTREx8NM_000492.3:c.1039C>Tp.Arg347Cys | p.R347CLRG_663t1:c.1039C>T, NM_000492.3:c.1039C>TVOUS09/27/2017
138CFTREx8NM_000492.3:c.1040G>Cp.Arg347Pro | p.R347PLRG_663t1:c.1040G>C, NM_000492.3:c.1040G>CPathogenic10/17/2018 
139CFTREx8NM_000492.3:c.1043T>Ap.Met348Lys | p.M348KLRG_663t1:c.1043T>A, NM_000492.3:c.1043T>AVOUS09/16/2016
140CFTREx8NM_000492.3:c.1046C>Tp.Ala349Val | p.A349VLRG_663t1:c.1046C>T, NM_000492.3:c.1046C>TVOUS08/24/2017
141CFTREx8NM_000492.3:c.1047G>Ap.Ala349= | p.A349=LRG_663t1:c.1047G>A, NM_000492.3:c.1047G>AVOUS12/15/2017
142CFTREx8NM_000492.3:c.1052C>Gp.Thr351Ser | p.T351SLRG_663t1:c.1052C>G, NM_000492.3:c.1052C>GVOUS05/16/2019
143CFTREx8NM_000492.3:c.1054C>Tp.Arg352Trp | p.R352WLRG_663t1:c.1054C>T, NM_000492.3:c.1054C>TVOUS05/31/2019
144CFTREx8NM_000492.3:c.1055G>Ap.Arg352Gln | p.R352QLRG_663t1:c.1055G>A, NM_000492.3:c.1055G>APathogenic** 
145CFTREx8NM_000492.3:c.1066_1072delTGGGCTGinsANM_000492.3:c.1066_1072delinsAVOUS05/29/2015
146CFTREx8NM_000492.3:c.1083delGp.Trp361Cysfs*8 | p.W361CfsX8LRG_663t1:c.1083delG, NM_000492.3:c.1083delGPathogenic04/18/2017 
147CFTREx8NM_000492.3:c.1116+6G>CLRG_663t1:c.1116+6G>C, NM_000492.3:c.1116+6G>CVOUS03/21/2017
148CFTREx9NM_000492.3:c.1118A>Tp.Asp373Val | p.D373VLRG_663t1:c.1118A>T, NM_000492.3:c.1118A>TVOUS08/21/2019
149CFTREx9NM_000492.3:c.1125A>Cp.Leu375Phe | p.L375FLRG_663t1:c.1125A>C, NM_000492.3:c.1125A>CLikely pathogenic09/18/2019 
150CFTREx9NM_000492.3:c.1149G>Ap.Leu383= | p.L383=LRG_663t1:c.1149G>A, NM_000492.3:c.1149G>AVOUS10/09/2017
151CFTREx9NM_000492.3:c.1163C>Tp.Thr388Met | p.T388MLRG_663t1:c.1163C>T, NM_000492.3:c.1163C>TVOUS07/24/2019
152CFTREx9NM_000492.3:c.1164G>Ap.Thr388= | p.T388=LRG_663t1:c.1164G>A, NM_000492.3:c.1164G>AVOUS05/19/2017
153CFTREx10NM_000492.3:c.1210-32T>GLRG_663t1:c.1210-32T>G, NM_000492.3:c.1210-32T>GVOUS09/23/2016
154CFTREx10NM_000492.3:c.1210-15G>TLRG_663t1:c.1210-15G>T, NM_000492.3:c.1210-15G>TVOUS06/26/2017
155CFTREx10NM_000492.3:c.1210-14_1210-13insTGLRG_663t1:c.1210-14_1210-13insTG, NM_000492.3:c.1210-14_1210-13insTGBenign07/02/2014 
156CFTREx10NM_000492.3:c.1210-13GT(10_12)Benign** 
157CFTREx10NM_000492.3:c.1210-13G>TNM_000492.3:c.1210-13G>TBenign01/31/2014 
158CFTREx10NM_000492.3:c.1210-13_1210-10delGTTTLRG_663t1:c.1210-13_1210-10delGTTT, NM_000492.3:c.1210-13_1210-10delGTTTVOUS09/23/2016
159CFTREx10NM_000492.3:c.1210-12T(5_9)Other Reportable03/05/2019 
160CFTREx10NM_000492.3:c.1210-11T>GLRG_663t1:c.1210-11T>G, NM_000492.3:c.1210-11T>GOther Reportable05/19/2016 
161CFTREx10NM_000492.3:c.1210-7_1210-6delTTLRG_663t1:c.1210-7_1210-6delTT, NM_000492.3:c.1210-7_1210-6delTTOther Reportable05/06/2019 
162CFTREx10NM_000492.3:c.1210-7_1210-6dupTTLRG_663t1:c.1210-7_1210-6dupTT, NM_000492.3:c.1210-6_1210-5insTT, NM_000492.3:c.1210-7_1210-6dupTTBenign09/29/2014 
163CFTREx10NM_000492.3:c.1227T>Cp.Phe409= | p.F409=LRG_663t1:c.1227T>C, NM_000492.3:c.1227T>CVOUS03/29/2019
164CFTREx10NM_000492.3:c.1231A>Gp.Lys411Glu | p.K411ELRG_663t1:c.1231A>G, NM_000492.3:c.1231A>GVOUS04/19/2019
165CFTREx10NM_000492.3:c.1234_1238delGCAAALRG_663t1:c.1234_1238delGCAAA, NM_000492.3:c.1234_1238delGCAAAPathogenic09/22/2016 
166CFTREx10NM_000492.3:c.1251C>Ap.Asn417Lys | p.N417KLRG_663t1:c.1251C>A, NM_000492.3:c.1251C>ABenign03/21/2015 
167CFTREx10NM_000492.3:c.1254T>Cp.Asn418= | p.N418=NM_000492.3:c.1254T>CBenign08/19/2014 
168CFTREx10NM_000492.3:c.1270G>Ap.Gly424Ser | p.G424SLRG_663t1:c.1270G>A, NM_000492.3:c.1270G>AVOUS04/18/2019
169CFTREx10NM_000492.3:c.1301_1307delCACTTCTPathogenic** 
170CFTREx10NM_000492.3:c.1312A>Gp.Thr438Ala | p.T438ALRG_663t1:c.1312A>G, NM_000492.3:c.1312A>GVOUS08/31/2018
171CFTREx10NM_000492.3:c.1327G>Tp.Asp443Tyr | p.D443YLRG_663t1:c.1327G>T, NM_000492.3:c.1327G>TPathogenic12/05/2018 
172CFTREx10NM_000492.3:c.1327_1330dupGATAp.Ile444Argfs*3 | p.I444RfsX3LRG_663t1:c.1327_1330dupGATA, NM_000492.3:c.1327_1330dupGATAPathogenic09/18/2018 
173CFTREx10NM_000492.3:c.1331T>Cp.Ile444Thr | p.I444TLRG_663t1:c.1331T>C, NM_000492.3:c.1331T>CVOUS12/21/2017
174CFTREx10NM_000492.3:c.1340delANM_000492.3:c.1340delAPathogenic** 
175CFTREx10NM_000492.3:c.1343T>Ap.Ile448Lys | p.I448KVOUS**
176CFTREx10NM_000492.3:c.1360_1362delTTGLRG_663t1:c.1360_1362delTTG, NM_000492.3:c.1360_1362delTTGLikely benign01/11/2017 
177CFTREx10NM_000492.3:c.1364C>Ap.Ala455Glu | p.A455ELRG_663t1:c.1364C>A, NM_000492.3:c.1364C>APathogenic** 
178CFTREx10NM_000492.3:c.1364C>Tp.Ala455Val | p.A455VLRG_663t1:c.1364C>T, NM_000492.3:c.1364C>TVOUS06/13/2019
179CFTREx10NM_000492.3:c.1365G>Tp.Ala455= | p.A455=LRG_663t1:c.1365G>T, NM_000492.3:c.1365G>TVOUS01/12/2016
180CFTREx10NM_000492.3:c.1365G>Ap.Ala455= | p.A455=LRG_663t1:c.1365G>A, NM_000492.3:c.1365G>AVOUS08/02/2019
181CFTREx10NM_000492.3:c.1367T>Cp.Val456Ala | p.V456ALRG_663t1:c.1367T>C, NM_000492.3:c.1367T>CPathogenic07/26/2019 
182CFTREx11NM_000492.3:c.1393-42G>ALRG_663t1:c.1393-42G>A, NM_000492.3:c.1393-42G>ABenign01/19/2017 
183CFTREx11NM_000492.3:c.1397C>Gp.Ser466* | p.S466XLRG_663t1:c.1397C>G, NM_000492.3:c.1397C>GPathogenic02/24/2017 
184CFTREx11NM_000492.3:c.1400T>Cp.Leu467Pro | p.L467PLRG_663t1:c.1400T>C, NM_000492.3:c.1400T>CPathogenic04/24/2017 
185CFTREx11NM_000492.3:c.1408A>Gp.Met470Val | p.M470VLRG_663t1:c.1408A>G, NM_000492.3:c.1408A>GBenign04/13/2017 
186CFTREx11NM_000492.3:c.1408G>Ap.Val470Met | p.V470MLRG_663t1:c.1408G>A, NM_000492.3:c.1408G>ABenign11/20/2018 
187CFTREx11NM_000492.3:c.1430C>Ap.Pro477His | p.P477HLRG_663t1:c.1430C>A, NM_000492.3:c.1430C>AVOUS07/28/2016
188CFTREx11NM_000492.3:c.1436A>Cp.Glu479Ala | p.E479ALRG_663t1:c.1436A>C, NM_000492.3:c.1436A>CVOUS04/07/2016
189CFTREx11NM_000492.3:c.1438G>Tp.Gly480Cys | p.G480CLRG_663t1:c.1438G>T, NM_000492.3:c.1438G>TPathogenic09/30/2013 
190CFTREx11NM_000492.3:c.1446T>Ap.Ile482= | p.I482=LRG_663t1:c.1446T>A, NM_000492.3:c.1446T>AVOUS04/27/2018
191CFTREx11NM_000492.3:c.1450C>Tp.His484Tyr | p.H484YLRG_663t1:c.1450C>T, NM_000492.3:c.1450C>TVOUS05/08/2017
192CFTREx11NM_000492.3:c.1454G>Cp.Ser485Thr | p.S485TLRG_663t1:c.1454G>C, NM_000492.3:c.1454G>CVOUS02/18/2019
193CFTREx11NM_000492.3:c.1477C>Tp.Gln493* | p.Q493XLRG_663t1:c.1477C>T, NM_000492.3:c.1477C>TPathogenic08/15/2018 
194CFTREx11NM_000492.3:c.1479G>Cp.Gln493His | p.Q493HLRG_663t1:c.1479G>C, NM_000492.3:c.1479G>CVOUS11/04/2016
195CFTREx11NM_000492.3:c.1499G>Ap.Gly500Asp | p.G500DLRG_663t1:c.1499G>A, NM_000492.3:c.1499G>AVOUS08/12/2016
196CFTREx11NM_000492.3:c.1516A>Gp.Ile506Val | p.I506VLRG_663t1:c.1516A>G, NM_000492.3:c.1516A>GBenign07/06/2016 
197CFTREx11NM_000492.3:c.1517T>Cp.Ile506Thr | p.I506TLRG_663t1:c.1517T>C, NM_000492.3:c.1517T>CLikely pathogenic07/30/2018 
198CFTREx11NM_000492.3:c.1519_1521delATCp.Ile507del | p.I507delLRG_663t1:c.1519_1521delATC, NM_000492.3:c.1519_1521delATCPathogenic11/30/2018 
199CFTREx11NM_000492.3:c.1521_1523delCTTp.Phe508del | p.F508deldelF508, DeltaF508, dF508, LRG_663t1:c.1521_1523delCTT, NM_000492.3:c.1521_1523delCTTPathogenic09/17/2019 
200CFTREx11NM_000492.3:c.1523T>Gp.Phe508Cys | p.F508CLRG_663t1:c.1523T>G, NM_000492.3:c.1523T>GBenign04/14/2016 
201CFTREx11NM_000492.3:c.1534T>Ap.Tyr512Asn | p.Y512NLRG_663t1:c.1534T>A, NM_000492.3:c.1534T>AVOUS11/15/2017
202CFTREx11NM_000492.3:c.1552A>Gp.Arg518Gly | p.R518GLRG_663t1:c.1552A>G, NM_000492.3:c.1552A>GVOUS04/26/2018
203CFTREx11NM_000492.3:c.1558G>Ap.Val520Ile | p.V520ILRG_663t1:c.1558G>A, NM_000492.3:c.1558G>AVOUS08/05/2019
204CFTREx11NM_000492.3:c.1582G>Ap.Glu528Lys | p.E528KLRG_663t1:c.1582G>A, NM_000492.3:c.1582G>AVOUS05/21/2018
205CFTREx11NM_000492.3:c.1584G>Tp.Glu528Asp | p.E528DLRG_663t1:c.1584G>T, NM_000492.3:c.1584G>TVOUS12/20/2017
206CFTREx11NM_000492.3:c.1584G>Ap.Glu528= | p.E528=LRG_663t1:c.1584G>A, NM_000492.3:c.1584G>ABenign10/17/2014 
207CFTREx12NM_000492.3:c.1585-1G>ALRG_663t1:c.1585-1G>A, NM_000492.3:c.1585-1G>APathogenic03/28/2018 
208CFTREx12NM_000492.3:c.1586A>Gp.Asp529Gly | p.D529GLRG_663t1:c.1586A>G, NM_000492.3:c.1586A>GVOUS12/04/2017
209CFTREx12NM_000492.3:c.1606A>Gp.Lys536Glu | p.K536ELRG_663t1:c.1606A>G, NM_000492.3:c.1606A>GVOUS12/05/2017
210CFTREx12NM_000492.3:c.1612A>Cp.Asn538His | p.N538HLRG_663t1:c.1612A>C, NM_000492.3:c.1612A>CVOUS05/13/2019
211CFTREx12NM_000492.3:c.1616T>Cp.Ile539Thr | p.I539TLRG_663t1:c.1616T>C, NM_000492.3:c.1616T>CVOUS07/19/2018
212CFTREx12NM_000492.3:c.1624G>Tp.Gly542* | p.G542XLRG_663t1:c.1624G>T, NM_000492.3:c.1624G>TPathogenic12/27/2018 
213CFTREx12NM_000492.3:c.1630G>Ap.Gly544Ser | p.G544SLRG_663t1:c.1630G>A, NM_000492.3:c.1630G>AVOUS09/11/2019
214CFTREx12NM_000492.3:c.1645A>Cp.Ser549Arg | p.S549RLRG_663t1:c.1645A>C, NM_000492.3:c.1645A>CPathogenic** 
215CFTREx12NM_000492.3:c.1646G>Ap.Ser549Asn | p.S549NLRG_663t1:c.1646G>A, NM_000492.3:c.1646G>APathogenic07/30/2018 
216CFTREx12NM_000492.3:c.1651G>Ap.Gly551Ser | p.G551SLRG_663t1:c.1651G>A, NM_000492.3:c.1651G>APathogenic** 
217CFTREx12NM_000492.3:c.1652G>Ap.Gly551Asp | p.G551DLRG_663t1:c.1652G>A, NM_000492.3:c.1652G>APathogenic04/03/2019 
218CFTREx12NM_000492.3:c.1655A>Cp.Gln552Pro | p.Q552PLRG_663t1:c.1655A>C, NM_000492.3:c.1655A>CVOUS07/17/2019
219CFTREx12NM_000492.3:c.1657C>Tp.Arg553* | p.R553XLRG_663t1:c.1657C>T, NM_000492.3:c.1657C>TPathogenic08/15/2017 
220CFTREx12NM_000492.3:c.1666A>Gp.Ile556Val | p.I556VLRG_663t1:c.1666A>G, NM_000492.3:c.1666A>GBenign10/17/2014 
221CFTREx12NM_000492.3:c.1674A>Gp.Leu558= | p.L558=LRG_663t1:c.1674A>G, NM_000492.3:c.1674A>GVOUS08/07/2019
222CFTREx12NM_000492.3:c.1675G>Ap.Ala559Thr | p.A559TLRG_663t1:c.1675G>A, NM_000492.3:c.1675G>APathogenic02/22/2018 
223CFTREx12NM_000492.3:c.1675G>Cp.Ala559Pro | p.A559PVOUS**
224CFTREx12NM_000492.3:c.1679G>Cp.Arg560Thr | p.R560TLRG_663t1:c.1679G>C, NM_000492.3:c.1679G>CPathogenic05/09/2019 
225CFTREx12NM_000492.3:c.1679G>Ap.Arg560Lys | p.R560KLRG_663t1:c.1679G>A, NM_000492.3:c.1679G>APathogenic** 
226CFTREx12NM_000492.3:c.1679+1G>ALRG_663t1:c.1679+1G>A, NM_000492.3:c.1679+1G>APathogenic04/28/2016 
227CFTREx12NM_000492.3:c.1679+16T>CVOUS07/16/2019
228CFTREx13NM_000492.3:c.1680-886A>GLRG_663t1:c.1680-886A>G, NM_000492.3:c.1680-886A>GPathogenic02/28/2017 
229CFTREx13NM_000492.3:c.1680-8C>ALRG_663t1:c.1680-8C>A, NM_000492.3:c.1680-8C>AVOUS07/17/2018
230CFTREx13NM_000492.3:c.1680-6T>GLRG_663t1:c.1680-6T>G, NM_000492.3:c.1680-6T>GVOUS06/13/2019
231CFTREx13NM_000492.3:c.1684G>Ap.Val562Ile | p.V562ILRG_663t1:c.1684G>A, NM_000492.3:c.1684G>AVOUS10/25/2018
232CFTREx13NM_000492.3:c.1692delAp.Asp565Metfs*7 | p.D565MfsX7LRG_663t1:c.1692delA, NM_000492.3:c.1692delAPathogenic** 
233CFTREx13NM_000492.3:c.1706A>Gp.Tyr569Cys | p.Y569CPathogenic** 
234CFTREx13NM_000492.3:c.1718C>Tp.Ser573Phe | p.S573FLRG_663t1:c.1718C>T, NM_000492.3:c.1718C>TVOUS06/07/2017
235CFTREx13NM_000492.3:c.1721C>Ap.Pro574His | p.P574HPathogenic** 
236CFTREx13NM_000492.3:c.1727G>Cp.Gly576Ala | p.G576ALRG_663t1:c.1727G>C, NM_000492.3:c.1727G>CVOUS05/21/2019
237CFTREx13NM_000492.3:c.1753G>Tp.Glu585* | p.E585XLRG_663t1:c.1753G>T, NM_000492.3:c.1753G>TPathogenic08/07/2017 
238CFTREx13NM_000492.3:c.1763A>Gp.Glu588Gly | p.E588GLRG_663t1:c.1763A>G, NM_000492.3:c.1763A>GVOUS06/30/2017
239CFTREx13NM_000492.3:c.1766+2T>ALRG_663t1:c.1766+2T>A, NM_000492.3:c.1766+2T>APathogenic08/31/2018 
240CFTREx13NM_000492.3:c.1766+3A>GLRG_663t1:c.1766+3A>G, NM_000492.3:c.1766+3A>GPathogenic05/23/2016 
241CFTREx13NM_000492.3:c.1766+26T>CVOUS**
242CFTREx13NM_000492.3:c.1766+73T>GLRG_663t1:c.1766+73T>G, NM_000492.3:c.1766+73T>GVOUS09/18/2017
243CFTREx14NM_000492.3:c.1811C>Gp.Thr604Ser | p.T604SLRG_663t1:c.1811C>G, NM_000492.3:c.1811C>GVOUS04/19/2019
244CFTREx14NM_000492.3:c.1820_1903delp.Met607_Gln634del | p.M607_Q634delLRG_663t1:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA, NM_000492.3:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAPathogenic11/09/2018 
245CFTREx14NM_000492.3:c.1826A>Gp.His609Arg | p.H609RLRG_663t1:c.1826A>G, NM_000492.3:c.1826A>GPathogenic07/14/2019 
246CFTREx14NM_000492.3:c.1853T>Cp.Ile618Thr | p.I618TLRG_663t1:c.1853T>C, NM_000492.3:c.1853T>CPathogenic05/02/2019 
247CFTREx14NM_000492.3:c.1865G>Ap.Gly622Asp | p.G622DLRG_663t1:c.1865G>APathogenic01/17/2019 
248CFTREx14NM_000492.3:c.1882G>Cp.Gly628Arg | p.G628RLRG_663t1:c.1882G>C, NM_000492.3:c.1882G>CLikely pathogenic12/22/2017 
249CFTREx14NM_000492.3:c.1920T>Cp.Phe640= | p.F640=LRG_663t1:c.1920T>C, NM_000492.3:c.1920T>CVOUS02/06/2018
250CFTREx14NM_000492.3:c.1970delGPathogenic** 
251CFTREx14NM_000492.3:c.2002C>Tp.Arg668Cys | p.R668CLRG_663t1:c.2002C>T, NM_000492.3:c.2002C>TVOUS03/06/2019
252CFTREx14NM_000492.3:c.2042A>Tp.Glu681Val | p.E681VLRG_663t1:c.2042A>T, NM_000492.3:c.2042A>TVOUS03/25/2016
253CFTREx14NM_000492.3:c.2051_2052delAAinsGLRG_663t1:c.2051_2052delinsG, NM_000492.3:c.2051_2052delinsGPathogenic04/28/2016 
254CFTREx14NM_000492.3:c.2052_2053insAPathogenic** 
255CFTREx14NM_000492.3:c.2052dupAp.Gln685Thrfs*4 | p.Q685TfsX4LRG_663t1:c.2052dupA, NM_000492.3:c.2052dup, NM_000492.3:c.2052dupAPathogenic12/03/2013 
256CFTREx14NM_000492.3:c.2055A>Gp.Gln685= | p.Q685=LRG_663t1:c.2055A>G, NM_000492.3:c.2055A>GVOUS09/04/2018
257CFTREx14NM_000492.3:c.2079T>Gp.Phe693Leu | p.F693LLRG_663t1:c.2079T>G, NM_000492.3:c.2079T>GVOUS09/06/2018
258CFTREx14NM_000492.3:c.2125C>Tp.Arg709* | p.R709XLRG_663t1:c.2125C>T, NM_000492.3:c.2125C>TPathogenic05/31/2018 
259CFTREx14NM_000492.3:c.2145A>Cp.Gln715His | p.Q715HLRG_663t1:c.2145A>C, NM_000492.3:c.2145A>CVOUS07/26/2017
260CFTREx14NM_000492.3:c.2153C>Gp.Pro718Arg | p.P718RLRG_663t1:c.2153C>G, NM_000492.3:c.2153C>GVOUS10/02/2018
261CFTREx14NM_000492.3:c.2169C>Tp.Gly723= | p.G723=LRG_663t1:c.2169C>T, NM_000492.3:c.2169C>TVOUS12/14/2018
262CFTREx14NM_000492.3:c.2173G>Ap.Glu725Lys | p.E725KLRG_663t1:c.2173G>A, NM_000492.3:c.2173G>AVOUS12/27/2016
263CFTREx14NM_000492.3:c.2175dupAp.Glu726Argfs*4 | p.E726RfsX4c2307dupA, LRG_663t1:c.2175dupA, NM_000492.3:c.2175dupAPathogenic01/19/2018 
264CFTREx14NM_000492.3:c.2191C>Tp.Pro731Ser | p.P731SLRG_663t1:c.2191C>T, NM_000492.3:c.2191C>TVOUS06/20/2018
265CFTREx14NM_000492.3:c.2193T>Cp.Pro731= | p.P731=LRG_663t1:c.2193T>C, NM_000492.3:c.2193T>CVOUS05/09/2016
266CFTREx14NM_000492.3:c.2205G>Cp.Arg735Ser | p.R735SLRG_663t1:c.2205G>C, NM_000492.3:c.2205G>CVOUS10/31/2018
267CFTREx14NM_000492.3:c.2210C>Tp.Ser737Phe | p.S737FLRG_663t1:c.2210C>T, NM_000492.3:c.2210C>TPathogenic** 
268CFTREx14NM_000492.3:c.2245C>Tp.Leu749= | p.L749=LRG_663t1:c.2245C>T, NM_000492.3:c.2245C>TVOUS02/04/2019
269CFTREx14NM_000492.3:c.2249C>Tp.Pro750Leu | p.P750LLRG_663t1:c.2249C>T, NM_000492.3:c.2249C>TVOUS06/25/2019
270CFTREx14NM_000492.3:c.2251C>Tp.Arg751Cys | p.R751CLRG_663t1:c.2251C>T, NM_000492.3:c.2251C>TVOUS12/27/2017
271CFTREx14NM_000492.3:c.2260G>Ap.Val754Met | p.V754MLRG_663t1:c.2260G>A, NM_000492.3:c.2260G>AVOUS06/19/2019
272CFTREx14NM_000492.3:c.2280G>Ap.Thr760= | p.T760=LRG_663t1:c.2280G>A, NM_000492.3:c.2280G>AVOUS01/21/2019
273CFTREx14NM_000492.3:c.2347A>Gp.Ile783Val | p.I783VLRG_663t1:c.2347A>G, NM_000492.3:c.2347A>GVOUS04/16/2019
274CFTREx14NM_000492.3:c.2353C>Tp.Arg785* | p.R785XPathogenic** 
275CFTREx14NM_000492.3:c.2372_2377delCACGAAp.Thr791_Arg792del | p.T791_R792delLRG_663t1:c.2372_2377delCACGAA, NM_000492.3:c.2372_2377delCACGAAVOUS08/11/2017
276CFTREx14NM_000492.3:c.2374C>Gp.Arg792Gly | p.R792GLRG_663t1:c.2374C>G, NM_000492.3:c.2374C>GVOUS02/18/2019
277CFTREx14NM_000492.3:c.2374C>Ap.Arg792= | p.R792=VOUS**
278CFTREx14NM_000492.3:c.2392C>Tp.Pro798Ser | p.P798SLRG_663t1:c.2392C>T, NM_000492.3:c.2392C>TVOUS01/27/2017
279CFTREx14NM_000492.3:c.2421A>Gp.Ile807Met | p.I807MLRG_663t1:c.2421A>G, NM_000492.3:c.2421A>GVOUS04/09/2019
280CFTREx14NM_000492.3:c.2424T>Cp.Tyr808= | p.Y808=LRG_663t1:c.2424T>C, NM_000492.3:c.2424T>CVOUS01/02/2019
281CFTREx14NM_000492.3:c.2450G>Tp.Gly817Val | p.G817VLRG_663t1:c.2450G>T, NM_000492.3:c.2450G>TVOUS04/09/2019
282CFTREx14NM_000492.3:c.2482G>Ap.Asp828Asn | p.D828NLRG_663t1:c.2482G>A, NM_000492.3:c.2482G>AVOUS08/21/2019
283CFTREx14NM_000492.3:c.2490+5G>TLRG_663t1:c.2490+5G>T, NM_000492.3:c.2490+5G>TVOUS06/17/2016
284CFTREx15NM_000492.3:c.2506G>Tp.Asp836Tyr | p.D836YLRG_663t1:c.2506G>T, NM_000492.3:c.2506G>TVOUS06/20/2019
285CFTREx15NM_000492.3:c.2537G>Ap.Trp846* | p.W846XPathogenic** 
286CFTREx15NM_000492.3:c.2544A>Tp.Thr848= | p.T848=LRG_663t1:c.2544A>T, NM_000492.3:c.2544A>TVOUS01/16/2017
287CFTREx15NM_000492.3:c.2559T>Cp.Ile853= | p.I853=LRG_663t1:c.2559T>C, NM_000492.3:c.2559T>CVOUS10/19/2018
288CFTREx15NM_000492.3:c.2561_2562delCTinsTGp.Thr854Met | p.T854MLRG_663t1:c.2561_2562delinsTG, NM_000492.3:c.2561_2562delinsTGVOUS12/04/2018
289CFTREx15NM_000492.3:c.2562T>Gp.Thr854= | p.T854=LRG_663t1:c.2562T>G, NM_000492.3:c.2562T>GBenign11/20/2018 
290CFTREx15NM_000492.3:c.2583delTp.Phe861Leufs*3 | p.F861LfsX3LRG_663t1:c.2583delT, NM_000492.3:c.2583delTPathogenic10/30/2018 
291CFTREx15NM_000492.3:c.2619+1G>ALRG_663t1:c.2619+1G>A, NM_000492.3:c.2619+1G>APathogenic05/18/2017 
292CFTREx16NM_000492.3:c.2620-26A>GLRG_663t1:c.2620-26A>G, NM_000492.3:c.2620-26A>GLikely benign04/23/2019 
293CFTREx16NM_000492.3:c.2620-15C>GLRG_663t1:c.2620-15C>G, NM_000492.3:c.2620-15C>GBenign11/29/2016 
294CFTREx16NM_000492.3:c.2620-6T>CLRG_663t1:c.2620-6T>C, NM_000492.3:c.2620-6T>CVOUS06/09/2016
295CFTREx16NM_000492.3:c.2657+2_2657+3insAc.2789insA, LRG_663t1:c.2657+2_2657+3insA, NM_000492.3:c.2657+2_2657+3insAPathogenic07/11/2018 
296CFTREx16NM_000492.3:c.2657+5G>ALRG_663t1:c.2657+5G>A, NM_000492.3:c.2657+5G>APathogenic12/06/2017 
297CFTREx17NM_000492.3:c.2658-2A>GLRG_663t1:c.2658-2A>G, NM_000492.3:c.2658-2A>GPathogenic10/17/2016 
298CFTREx17NM_000492.3:c.2659A>Cp.Thr887Pro | p.T887PLRG_663t1:c.2659A>C, NM_000492.3:c.2659A>CVOUS05/07/2019
299CFTREx17NM_000492.3:c.2665C>Tp.Leu889Phe | p.L889FLRG_663t1:c.2665C>T, NM_000492.3:c.2665C>TVOUS06/27/2018
300CFTREx17NM_000492.3:c.2673C>Gp.Asp891Glu | p.D891ELRG_663t1:c.2673C>G, NM_000492.3:c.2673C>GVOUS12/05/2016
301CFTREx17NM_000492.3:c.2709T>Cp.Tyr903= | p.Y903=LRG_663t1:c.2709T>C, NM_000492.3:c.2709T>CVOUS05/16/2019
302CFTREx17NM_000492.3:c.2735C>Tp.Ser912Leu | p.S912LLRG_663t1:c.2735C>T, NM_000492.3:c.2735C>TVOUS03/21/2019
303CFTREx17NM_000492.3:c.2736G>Ap.Ser912= | p.S912=LRG_663t1:c.2736G>A, NM_000492.3:c.2736G>AVOUS01/02/2019
304CFTREx17NM_000492.3:c.2736G>Cp.Ser912= | p.S912=LRG_663t1:c.2736G>C, NM_000492.3:c.2736G>CVOUS08/22/2017
305CFTREx17NM_000492.3:c.2739T>Ap.Tyr913* | p.Y913XNM_000492.3:c.2739T>APathogenic** 
306CFTREx17NM_000492.3:c.2756A>Gp.Tyr919Cys | p.Y919CLRG_663t1:c.2756A>G, NM_000492.3:c.2756A>GVOUS07/06/2018
307CFTREx17NM_000492.3:c.2757C>Tp.Tyr919= | p.Y919=LRG_663t1:c.2757C>T, NM_000492.3:c.2757C>TVOUS11/02/2018
308CFTREx17NM_000492.3:c.2758G>Ap.Val920Met | p.V920MLRG_663t1:c.2758G>A, NM_000492.3:c.2758G>AVOUS01/08/2018
309CFTREx17NM_000492.3:c.2758G>Tp.Val920Leu | p.V920LLRG_663t1:c.2758G>T, NM_000492.3:c.2758G>TVOUS03/13/2017
310CFTREx17NM_000492.3:c.2769C>Tp.Ala923= | p.A923=LRG_663t1:c.2769C>T, NM_000492.3:c.2769C>TVOUS04/14/2017
311CFTREx17NM_000492.3:c.2770G>Ap.Asp924Asn | p.D924NLRG_663t1:c.2770G>A, NM_000492.3:c.2770G>AVOUS12/05/2016
312CFTREx17NM_000492.3:c.2772C>Ap.Asp924Glu | p.D924ELRG_663t1:c.2772C>A, NM_000492.3:c.2772C>AVOUS11/29/2017
313CFTREx17NM_000492.3:c.2797A>Gp.Arg933Gly | p.R933GLRG_663t1:c.2797A>G, NM_000492.3:c.2797A>GVOUS06/08/2017
314CFTREx17NM_000492.3:c.2805A>Gp.Leu935= | p.L935=LRG_663t1:c.2805A>G, NM_000492.3:c.2805A>GVOUS08/29/2019
315CFTREx17NM_000492.3:c.2813T>Gp.Val938Gly | p.V938GLRG_663t1:c.2813T>G, NM_000492.3:c.2813T>GVOUS10/19/2017
316CFTREx17NM_000492.3:c.2820T>Gp.Thr940= | p.T940=LRG_663t1:c.2820T>G, NM_000492.3:c.2820T>GLikely benign12/15/2016 
317CFTREx17NM_000492.3:c.2822delTp.Leu941Glnfs*27 | p.L941QfsX27LRG_663t1:c.2822delT, NM_000492.3:c.2822delTPathogenic10/25/2018 
318CFTREx17NM_000492.3:c.2834C>Tp.Ser945Leu | p.S945LLRG_663t1:c.2834C>T, NM_000492.3:c.2834C>TPathogenic04/13/2015 
319CFTREx17NM_000492.3:c.2855T>Cp.Met952Thr | p.M952TLRG_663t1:c.2855T>C, NM_000492.3:c.2855T>CVOUS10/07/2016
320CFTREx17NM_000492.3:c.2856G>Ap.Met952Ile | p.M952ILRG_663t1:c.2856G>A, NM_000492.3:c.2856G>AVOUS05/17/2018
321CFTREx17NM_000492.3:c.2856G>Cp.Met952Ile | p.M952ILRG_663t1:c.2856G>C, NM_000492.3:c.2856G>CLikely pathogenic04/23/2019 
322CFTREx17NM_000492.3:c.2882T>Cp.Met961Thr | p.M961TLRG_663t1:c.2882T>C, NM_000492.3:c.2882T>CVOUS03/28/2017
323CFTREx17NM_000492.3:c.2895C>Ap.Asn965Lys | p.N965KLRG_663t1:c.2895C>A, NM_000492.3:c.2895C>AVOUS09/29/2017
324CFTREx17NM_000492.3:c.2898G>Ap.Thr966= | p.T966=LRG_663t1:c.2898G>A, NM_000492.3:c.2898G>ABenign10/12/2017 
325CFTREx17NM_000492.3:c.2900T>Cp.Leu967Ser | p.L967SLRG_663t1:c.2900T>C, NM_000492.3:c.2900T>CVOUS03/11/2019
326CFTREx17NM_000492.3:c.2908+4C>ALRG_663t1:c.2908+4C>A, NM_000492.3:c.2908+4C>AVOUS04/12/2018
327CFTREx17NM_000492.3:c.2908+19G>CVOUS**
328CFTREx18NM_000492.3:c.2909-4A>GLRG_663t1:c.2909-4A>G, NM_000492.3:c.2909-4A>GVOUS11/23/2016
329CFTREx18NM_000492.3:c.2946T>Gp.Ile982Met | p.I982MLRG_663t1:c.2946T>G, NM_000492.3:c.2946T>GVOUS07/22/2019
330CFTREx18NM_000492.3:c.2981T>Gp.Phe994Cys | p.F994CLRG_663t1:c.2981T>G, NM_000492.3:c.2981T>GVOUS08/09/2018
331CFTREx18NM_000492.3:c.2988G>Ap.Gln996= | p.Q996=LRG_663t1:c.2988G>A, NM_000492.3:c.2988G>APathogenic06/15/2017 
332CFTREx18NM_000492.3:c.2988+1G>A3120+1 G>A, LRG_663t1:c.2988+1G>A, NM_000492.3:c.2988+1G>APathogenic07/12/2019 
333CFTREx19NM_000492.3:c.2991G>Cp.Leu997Phe | p.L997FLRG_663t1:c.2991G>C, NM_000492.3:c.2991G>CVOUS08/05/2019
334CFTREx19NM_000492.3:c.2998A>Tp.Ile1000Phe | p.I1000FLRG_663t1:c.2998A>T, NM_000492.3:c.2998A>TVOUS12/11/2018
335CFTREx19NM_000492.3:c.3001G>Ap.Val1001Met | p.V1001MLRG_663t1:c.3001G>A, NM_000492.3:c.3001G>AVOUS09/06/2018
336CFTREx19NM_000492.3:c.3024C>Tp.Val1008= | p.V1008=NM_000492.3:c.3024C>TVOUS02/12/2015
337CFTREx19NM_000492.3:c.3025G>Ap.Ala1009Thr | p.A1009TLRG_663t1:c.3025G>A, NM_000492.3:c.3025G>AVOUS11/20/2018
338CFTREx19NM_000492.3:c.3036A>Gp.Gln1012= | p.Q1012=LRG_663t1:c.3036A>G, NM_000492.3:c.3036A>GVOUS09/19/2019
339CFTREx19NM_000492.3:c.3041A>Gp.Tyr1014Cys | p.Y1014CLRG_663t1:c.3041A>G, NM_000492.3:c.3041A>GVOUS08/15/2019
340CFTREx19NM_000492.3:c.3067_3072delATAGTGPathogenic08/06/2012 
341CFTREx19NM_000492.3:c.3073G>Tp.Ala1025Ser | p.A1025SLRG_663t1:c.3073G>T, NM_000492.3:c.3073G>TVOUS12/13/2018
342CFTREx19NM_000492.3:c.3080T>Cp.Ile1027Thr | p.I1027TLRG_663t1:c.3080T>C, NM_000492.3:c.3080T>CBenign12/18/2012 
343CFTREx19NM_000492.3:c.3083T>Gp.Met1028Arg | p.M1028RLRG_663t1:c.3083T>G, NM_000492.3:c.3083T>GVOUS08/27/2019
344CFTREx19NM_000492.3:c.3095A>Gp.Tyr1032Cys | p.Y1032CLRG_663t1:c.3095A>G, NM_000492.3:c.3095A>GLikely pathogenic06/11/2018 
345CFTREx19NM_000492.3:c.3100C>Tp.Leu1034Phe | p.L1034FLRG_663t1:c.3100C>T, NM_000492.3:c.3100C>TVOUS03/08/2017
346CFTREx19NM_000492.3:c.3121A>Cp.Lys1041Gln | p.K1041QLRG_663t1:c.3121A>C, NM_000492.3:c.3121A>CVOUS12/27/2016
347CFTREx19NM_000492.3:c.3139G>Tp.Gly1047Cys | p.G1047CLRG_663t1:c.3139G>T, NM_000492.3:c.3139G>TVOUS10/02/2015
348CFTREx19NM_000492.3:c.3139delGPathogenic** 
349CFTREx19NM_000492.3:c.3139+1delGPathogenic** 
350CFTREx19NM_000492.3:c.3139+8A>GLRG_663t1:c.3139+8A>G, NM_000492.3:c.3139+8A>GVOUS10/01/2018
351CFTREx19NM_000492.3:c.3139+18C>TVOUS**
352CFTREx19NM_000492.3:c.3139+42A>TBenign** 
353CFTREx20NM_000492.3:c.3140-26A>GLRG_663t1:c.3140-26A>G, NM_000492.3:c.3140-26A>GPathogenic04/27/2017 
354CFTREx20NM_000492.3:c.3154T>Gp.Phe1052Val | p.F1052VLRG_663t1:c.3154T>G, NM_000492.3:c.3154T>GVOUS07/06/2018
355CFTREx20NM_000492.3:c.3169A>Gp.Thr1057Ala | p.T1057ALRG_663t1:c.3169A>G, NM_000492.3:c.3169A>GVOUS09/02/2015
356CFTREx20NM_000492.3:c.3177A>Gp.Leu1059= | p.L1059=LRG_663t1:c.3177A>G, NM_000492.3:c.3177A>GVOUS09/17/2019
357CFTREx20NM_000492.3:c.3181G>Cp.Gly1061Arg | p.G1061RLRG_663t1:c.3181G>C, NM_000492.3:c.3181G>CLikely pathogenic03/02/2018 
358CFTREx20NM_000492.3:c.3194T>Cp.Leu1065Pro | p.L1065PNM_000492.3:c.3194T>CPathogenic12/16/2015 
359CFTREx20NM_000492.3:c.3196C>Tp.Arg1066Cys | p.R1066CLRG_663t1:c.3196C>T, NM_000492.3:c.3196C>TPathogenic06/12/2017 
360CFTREx20NM_000492.3:c.3197G>Ap.Arg1066His | p.R1066HLRG_663t1:c.3197G>A, NM_000492.3:c.3197G>APathogenic12/10/2018 
361CFTREx20NM_000492.3:c.3199G>Ap.Ala1067Thr | p.A1067TNM_000492.3:c.3199G>AVOUS04/16/2013
362CFTREx20NM_000492.3:c.3200C>Tp.Ala1067Val | p.A1067VNM_000492.3:c.3200C>TVOUS02/11/2016
363CFTREx20NM_000492.3:c.3205G>Ap.Gly1069Arg | p.G1069RLRG_663t1:c.3205G>A, NM_000492.3:c.3205G>AVOUS08/27/2019
364CFTREx20NM_000492.3:c.3209G>Ap.Arg1070Gln | p.R1070QLRG_663t1:c.3209G>A, NM_000492.3:c.3209G>APathogenic04/28/2015 
365CFTREx20NM_000492.3:c.3222T>Ap.Phe1074Leu | p.F1074LLRG_663t1:c.3222T>A, NM_000492.3:c.3222T>ALikely pathogenic05/23/2018 
366CFTREx20NM_000492.3:c.3256A>Gp.Thr1086Ala | p.T1086ALRG_663t1:c.3256A>G, NM_000492.3:c.3256A>GVOUS03/12/2019
367CFTREx20NM_000492.3:c.3256A>Tp.Thr1086Ser | p.T1086SLRG_663t1:c.3256A>T, NM_000492.3:c.3256A>TVOUS06/12/2017
368CFTREx20NM_000492.3:c.3274T>Cp.Tyr1092His | p.Y1092HLRG_663t1:c.3274T>C, NM_000492.3:c.3274T>CVOUS01/22/2018
369CFTREx20NM_000492.3:c.3275A>Gp.Tyr1092Cys | p.Y1092CLRG_663t1:c.3275A>G, NM_000492.3:c.3275A>GVOUS03/01/2017
370CFTREx20NM_000492.3:c.3276C>Ap.Tyr1092* | p.Y1092XLRG_663t1:c.3276C>A, NM_000492.3:c.3276C>APathogenic08/14/2018 
371CFTREx20NM_000492.3:c.3285A>Tp.Thr1095= | p.T1095=LRG_663t1:c.3285A>T, NM_000492.3:c.3285A>TBenign12/21/2015 
372CFTREx20NM_000492.3:c.3289C>Tp.Arg1097Cys | p.R1097CLRG_663t1:c.3289C>T, NM_000492.3:c.3289C>TVOUS05/16/2019
373CFTREx20NM_000492.3:c.3297C>Ap.Phe1099Leu | p.F1099LLRG_663t1:c.3297C>A, NM_000492.3:c.3297C>AVOUS04/08/2016
374CFTREx20NM_000492.3:c.3302T>Ap.Met1101Lys | p.M1101KLRG_663t1:c.3302T>A, NM_000492.3:c.3302T>APathogenic08/09/2019 
375CFTREx20NM_000492.3:c.3303G>Ap.Met1101Ile | p.M1101ILRG_663t1:c.3303G>A, NM_000492.3:c.3303G>AVOUS09/24/2018
376CFTREx20NM_000492.3:c.3306A>Gp.Arg1102= | p.R1102=LRG_663t1:c.3306A>G, NM_000492.3:c.3306A>GVOUS08/13/2019
377CFTREx20NM_000492.3:c.3367+45T>CNM_000492.3:c.3367+45T>CVOUS**
378CFTREx21NM_000492.3:c.3368-4A>GLRG_663t1:c.3368-4A>G, NM_000492.3:c.3368-4A>GVOUS07/07/2017
379CFTREx21NM_000492.3:c.3382A>Gp.Arg1128Gly | p.R1128GLRG_663t1:c.3382A>G, NM_000492.3:c.3382A>GVOUS07/28/2016
380CFTREx21NM_000492.3:c.3407C>Tp.Ala1136Val | p.A1136VLRG_663t1:c.3407C>T, NM_000492.3:c.3407C>TVOUS02/02/2018
381CFTREx21NM_000492.3:c.3415A>Gp.Ile1139Val | p.I1139VLRG_663t1:c.3415A>G, NM_000492.3:c.3415A>GVOUS07/13/2018
382CFTREx21NM_000492.3:c.3420G>Ap.Met1140Ile | p.M1140ILRG_663t1:c.3420G>A, NM_000492.3:c.3420G>AVOUS03/07/2019
383CFTREx21NM_000492.3:c.3429G>Ap.Leu1143= | p.L1143=LRG_663t1:c.3429G>A, NM_000492.3:c.3429G>AVOUS12/04/2018
384CFTREx21NM_000492.3:c.3454G>Cp.Asp1152His | p.D1152HLRG_663t1:c.3454G>C, NM_000492.3:c.3454G>CPathogenic11/15/2018 
385CFTREx21NM_000492.3:c.3468G>Ap.Leu1156= | p.L1156=LRG_663t1:c.3468G>AVOUS12/11/2014
386CFTREx21NM_000492.3:c.3468+2dupTLRG_663t1:c.3468+2_3468+3insT, LRG_663t1:c.3468+2dupT, NM_000492.3:c.3468+2_3468+3insT, NM_000492.3:c.3468+2dupTLikely pathogenic12/27/2016 
387CFTREx22NM_000492.3:c.3469-20T>CLRG_663t1:c.3469-20T>C, NM_000492.3:c.3469-20T>CBenign03/29/2019 
388CFTREx22NM_000492.3:c.3469-17T>CLRG_663t1:c.3469-17T>C, NM_000492.3:c.3469-17T>CVOUS06/27/2019
389CFTREx22NM_000492.3:c.3472C>Tp.Arg1158* | p.R1158XLRG_663t1:c.3472C>T, NM_000492.3:c.3472C>TPathogenic10/29/2018 
390CFTREx22NM_000492.3:c.3485G>Tp.Arg1162Leu | p.R1162LLRG_663t1:c.3485G>T, NM_000492.3:c.3485G>TVOUS04/09/2019
391CFTREx22NM_000492.3:c.3485G>Ap.Arg1162Gln | p.R1162QLRG_663t1:c.3485G>A, NM_000492.3:c.3485G>AVOUS04/03/2018
392CFTREx22NM_000492.3:c.3503A>Gp.Asp1168Gly | p.D1168GLRG_663t1:c.3503A>G, NM_000492.3:c.3503A>GVOUS05/30/2017
393CFTREx22NM_000492.3:c.3508C>Tp.Pro1170Ser | p.P1170SLRG_663t1:c.3508C>T, NM_000492.3:c.3508C>TVOUS10/11/2018
394CFTREx22NM_000492.3:c.3517G>Ap.Gly1173Ser | p.G1173SLRG_663t1:c.3517G>A, NM_000492.3:c.3517G>AVOUS09/26/2016
395CFTREx22NM_000492.3:c.3528delCp.Lys1177Serfs*15 | p.K1177SfsX15LRG_663t1:c.3528delC, NM_000492.3:c.3528delCPathogenic03/13/2017 
396CFTREx22NM_000492.3:c.3558A>Gp.Gln1186= | p.Q1186=LRG_663t1:c.3558A>G, NM_000492.3:c.3558A>GVOUS01/23/2018
397CFTREx22NM_000492.3:c.3564G>Ap.Ser1188= | p.S1188=LRG_663t1:c.3564G>A, NM_000492.3:c.3564G>AVOUS06/20/2013
398CFTREx22NM_000492.3:c.3588A>Tp.Ser1196= | p.S1196=LRG_663t1:c.3588A>T, NM_000492.3:c.3588A>TVOUS08/30/2018
399CFTREx22NM_000492.3:c.3607A>Gp.Ile1203Val | p.I1203VNM_000492.3:c.3607A>GVOUS01/23/2014
400CFTREx22NM_000492.3:c.3612G>Ap.Trp1204* | p.W1204XLRG_663t1:c.3612G>A, NM_000492.3:c.3612G>APathogenic01/03/2013 
401CFTREx22NM_000492.3:c.3659C>Tp.Thr1220Ile | p.T1220ILRG_663t1:c.3659C>T, NM_000492.3:c.3659C>TVOUS04/19/2018
402CFTREx22NM_000492.3:c.3665G>Ap.Gly1222Asp | p.G1222DLRG_663t1:c.3665G>A, NM_000492.3:c.3665G>AVOUS09/05/2017
403CFTREx22NM_000492.3:c.3682G>Cp.Glu1228Gln | p.E1228QLRG_663t1:c.3682G>C, NM_000492.3:c.3682G>CVOUS05/29/2019
404CFTREx22NM_000492.3:c.3705T>Gp.Ser1235Arg | p.S1235RLRG_663t1:c.3705T>G, NM_000492.3:c.3705T>GBenign07/24/2012 
405CFTREx22NM_000492.3:c.3710G>Ap.Gly1237Asp | p.G1237DLRG_663t1:c.3710G>A, NM_000492.3:c.3710G>AVOUS09/17/2018
406CFTREx22NM_000492.3:c.3713A>Gp.Gln1238Arg | p.Q1238RLRG_663t1:c.3713A>G, NM_000492.3:c.3713A>GVOUS07/31/2019
407CFTREx22NM_000492.3:c.3717+40A>GLRG_663t1:c.3717+40A>G, NM_000492.3:c.3717+40A>GLikely pathogenic08/31/2017 
408CFTREx22NM_000492.3:c.3717+45G>ALRG_663t1:c.3717+45G>A, NM_000492.3:c.3717+45G>ABenign03/14/2019 
409CFTREx22NM_000492.3:c.3717+12191C>T3849+10kb C>T, LRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic07/22/2019 
410CFTREx23NM_000492.3:c.3718-2530A>GLRG_663t1:c.3718-2530A>G, NM_000492.3:c.3718-2530A>GBenign10/26/2016 
411CFTREx23NM_000492.3:c.3718-2477C>TLRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic05/08/2017 
412CFTREx23NM_000492.3:c.3718-24G>ALRG_663t1:c.3718-24G>A, NM_000492.3:c.3718-24G>AVOUS12/12/2018
413CFTREx23NM_000492.3:c.3744delAp.Lys1250Argfs*9 | p.K1250RfsX9LRG_663t1:c.3744delA, NM_000492.3:c.3744delAPathogenic10/02/2018 
414CFTREx23NM_000492.3:c.3747G>Ap.Gly1249= | p.G1249=LRG_663t1:c.3747G>A, NM_000492.3:c.3747G>AVOUS01/15/2015
415CFTREx23NM_000492.3:c.3761T>Gp.Leu1254* | p.L1254XPathogenic** 
416CFTREx23NM_000492.3:c.3762A>Gp.Leu1254= | p.L1254=LRG_663t1:c.3762A>G, NM_000492.3:c.3762A>GVOUS06/19/2019
417CFTREx23NM_000492.3:c.3764C>Ap.Ser1255* | p.S1255XPathogenic** 
418CFTREx23NM_000492.3:c.3772T>Cp.Leu1258= | p.L1258=LRG_663t1:c.3772T>C, NM_000492.3:c.3772T>CVOUS06/26/2017
419CFTREx23NM_000492.3:c.3794G>Tp.Gly1265Val | p.G1265VLRG_663t1:c.3794G>T, NM_000492.3:c.3794G>TVOUS06/08/2017
420CFTREx23NM_000492.3:c.3808G>Ap.Asp1270Asn | p.D1270NLRG_663t1:c.3808G>A, NM_000492.3:c.3808G>AVOUS03/22/2019
421CFTREx23NM_000492.3:c.3815T>Ap.Val1272Glu | p.V1272ENM_000492.3:c.3815T>AVOUS04/23/2015
422CFTREx23NM_000492.3:c.3836T>Cp.Leu1279Ser | p.L1279SLRG_663t1:c.3836T>C, NM_000492.3:c.3836T>CVOUS04/04/2018
423CFTREx23NM_000492.3:c.3846G>Cp.Trp1282Cys | p.W1282CLRG_663t1:c.3846G>C, NM_000492.3:c.3846G>CVOUS08/15/2018
424CFTREx23NM_000492.3:c.3846G>Ap.Trp1282* | p.W1282XLRG_663t1:c.3846G>A, NM_000492.3:c.3846G>APathogenic11/20/2018 
425CFTREx23NM_000492.3:c.3852A>Gp.Lys1284= | p.K1284=LRG_663t1:c.3852A>G, NM_000492.3:c.3852A>GVOUS10/19/2017
426CFTREx23NM_000492.3:c.3853G>Ap.Ala1285Thr | p.A1285TLRG_663t1:c.3853G>A, NM_000492.3:c.3853G>AVOUS10/10/2017
427CFTREx23NM_000492.3:c.3854C>Tp.Ala1285Val | p.A1285VLRG_663t1:c.3854C>T, NM_000492.3:c.3854C>TVOUS02/22/2019
428CFTREx23NM_000492.3:c.3870A>Gp.Pro1290= | p.P1290=LRG_663t1:c.3870A>G, NM_000492.3:c.3870A>GBenign11/01/2018 
429CFTREx23NM_000492.3:c.3873+7A>TLRG_663t1:c.3873+7A>T, NM_000492.3:c.3873+7A>TVOUS09/20/2017
430CFTREx24NM_000492.3:c.3874-4522A>GLRG_663t1:c.3874-4522A>G, NM_000492.3:c.3874-4522A>GLikely pathogenic08/26/2019 
431CFTREx24NM_000492.3:c.3874-21_3874-15dupTTCTTTTLRG_663t1:c.3874-15_3874-14insTTCTTTT, LRG_663t1:c.3874-21_3874-15dupTTCTTTT, LRG_663t1:c.3874-21_3874-15insTTCTTTT, NM_000492.3:c.3874-15_3874-14insTTCTTTT, NM_000492.3:c.3874-21_3874-15dupTTCTTTT, NM_000492.3:c.3874-21_3874-15insTTCTTTTVOUS02/22/2017
432CFTREx24NM_000492.3:c.3874-14_3874-10delCTTTTLRG_663t1:c.3874-14_3874-10delCTTTT, NM_000492.3:c.3874-14_3874-10delCTTTTLikely benign11/27/2018 
433CFTREx24NM_000492.3:c.3893G>Tp.Gly1298Val | p.G1298VLRG_663t1:c.3893G>T, NM_000492.3:c.3893G>TVOUS10/13/2017
434CFTREx24NM_000492.3:c.3895A>Gp.Thr1299Ala | p.T1299ALRG_663t1:c.3895A>G, NM_000492.3:c.3895A>GVOUS09/06/2018
435CFTREx24NM_000492.3:c.3897A>Gp.Thr1299= | p.T1299=LRG_663t1:c.3897A>G, NM_000492.3:c.3897A>GLikely benign01/11/2017 
436CFTREx24NM_000492.3:c.3909C>Gp.Asn1303Lys | p.N1303KLRG_663t1:c.3909C>G, NM_000492.3:c.3909C>GPathogenic09/17/2019 
437CFTREx24NM_000492.3:c.3933T>Gp.Ser1311Arg | p.S1311RLRG_663t1:c.3933T>G, NM_000492.3:c.3933T>GVOUS09/27/2016
438CFTREx25NM_000492.3:c.3964-16T>CNM_000492.3:c.3964-16T>CVOUS08/25/2014
439CFTREx25NM_000492.3:c.3983T>Cp.Ile1328Thr | p.I1328TLRG_663t1:c.3983T>C, NM_000492.3:c.3983T>CVOUS04/09/2019
440CFTREx25NM_000492.3:c.3999delGNM_000492.3:c.3999delGPathogenic09/04/2015 
441CFTREx25NM_000492.3:c.4036C>Tp.Leu1346= | p.L1346=LRG_663t1:c.4036C>T, NM_000492.3:c.4036C>TVOUS11/15/2017
442CFTREx25NM_000492.3:c.4045G>Ap.Gly1349Ser | p.G1349SLRG_663t1:c.4045G>A, NM_000492.3:c.4045G>AVOUS06/27/2017
443CFTREx25NM_000492.3:c.4053_4054delGCinsAGp.Gln1352Glu | p.Q1352ELRG_663t1:c.4053_4054delinsAG, NM_000492.3:c.4053_4054delinsAGVOUS09/21/2018
444CFTREx25NM_000492.3:c.4056G>Cp.Gln1352His | p.Q1352HLRG_663t1:c.4056G>C, NM_000492.3:c.4056G>CVOUS04/16/2019
445CFTREx25NM_000492.3:c.4058delTp.Leu1353* | p.L1353XLRG_663t1:c.4058delT, NM_000492.3:c.4058delTPathogenic02/23/2018 
446CFTREx25NM_000492.3:c.4077_4080delTGTTinsAAp.Val1360Thrfs*3 | p.V1360TfsX3LRG_663t1:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delinsAAPathogenic** 
447CFTREx25NM_000492.3:c.4092G>Ap.Ala1364= | p.A1364=LRG_663t1:c.4092G>A, NM_000492.3:c.4092G>AVOUS07/12/2019
448CFTREx25NM_000492.3:c.4121C>Gp.Ala1374Gly | p.A1374GLRG_663t1:c.4121C>G, NM_000492.3:c.4121C>GVOUS02/17/2017
449CFTREx25NM_000492.3:c.4123C>Ap.His1375Asn | p.H1375NLRG_663t1:c.4123C>A, NM_000492.3:c.4123C>AVOUS12/28/2017
450CFTREx25NM_000492.3:c.4129G>Cp.Asp1377His | p.D1377HLRG_663t1:c.4129G>C, NM_000492.3:c.4129G>CVOUS06/23/2016
451CFTREx26NM_000492.3:c.4159A>Gp.Thr1387Ala | p.T1387ALRG_663t1:c.4159A>G, NM_000492.3:c.4159A>GVOUS12/21/2017
452CFTREx26NM_000492.3:c.4195C>Gp.Leu1399Val | p.L1399VLRG_663t1:c.4195C>G, NM_000492.3:c.4195C>GVOUS05/11/2018
453CFTREx26NM_000492.3:c.4197C>Gp.Leu1399= | p.L1399=LRG_663t1:c.4197C>G, NM_000492.3:c.4197C>GVOUS05/02/2017
454CFTREx26NM_000492.3:c.4197C>Tp.Leu1399= | p.L1399=LRG_663t1:c.4197C>T, NM_000492.3:c.4197C>TVOUS10/28/2016
455CFTREx26NM_000492.3:c.4241T>Cp.Leu1414Ser | p.L1414SLRG_663t1:c.4241T>C, NM_000492.3:c.4241T>CVOUS02/01/2018
456CFTREx26NM_000492.3:c.4242+10T>CLRG_663t1:c.4242+10T>C, NM_000492.3:c.4242+10T>CBenign05/24/2013 
457CFTREx26NM_000492.3:c.4242+13A>GBenign04/29/2013 
458CFTREx27NM_000492.3:c.*2G>ALRG_663t1:c.*2G>A, NM_000492.3:c.*2G>AVOUS05/21/2019
459CFTREx27NM_000492.3:c.*10T>ALRG_663t1:c.*10T>A, NM_000492.3:c.*10T>AVOUS**
460CFTREx27NM_000492.3:c.*1043A>CLRG_663t1:c.*1043A>C, NM_000492.3:c.*1043A>CBenign03/28/2017 
461CFTREx27NM_000492.3:c.4243-20A>GLRG_663t1:c.4243-20A>G, NM_000492.3:c.4243-20A>GVOUS06/05/2019
462CFTREx27NM_000492.3:c.4243-5C>TLRG_663t1:c.4243-5C>T, NM_000492.3:c.4243-5C>TBenign08/25/2015 
463CFTREx27NM_000492.3:c.4251delAp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4251delA, NM_000492.3:c.4251delAPathogenic10/26/2017 
464CFTREx27NM_000492.3:c.4252delGp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4252delG, NM_000492.3:c.4252delGPathogenic12/21/2018 
465CFTREx27NM_000492.3:c.4272C>Tp.Tyr1424= | p.Y1424=LRG_663t1:c.4272C>T, NM_000492.3:c.4272C>TBenign11/14/2017 
466CFTREx27NM_000492.3:c.4296C>Tp.Asn1432= | p.N1432=LRG_663t1:c.4296C>T, NM_000492.3:c.4296C>TVOUS04/30/2019
467CFTREx27NM_000492.3:c.4322T>Cp.Ile1441Thr | p.I1441TNM_000492.3:c.4322T>CVOUS06/26/2015
468CFTREx27NM_000492.3:c.4332C>Tp.Ser1444= | p.S1444=LRG_663t1:c.4332C>T, NM_000492.3:c.4332C>TVOUS05/09/2017
469CFTREx27NM_000492.3:c.4333G>Ap.Asp1445Asn | p.D1445NLRG_663t1:c.4333G>A, NM_000492.3:c.4333G>AVOUS04/08/2019
470CFTREx27NM_000492.3:c.4357C>Tp.Arg1453Trp | p.R1453WLRG_663t1:c.4357C>T, NM_000492.3:c.4357C>TVOUS09/24/2018
471CFTREx27NM_000492.3:c.4358G>Ap.Arg1453Gln | p.R1453QLRG_663t1:c.4358G>A, NM_000492.3:c.4358G>AVOUS08/21/2019
472CFTREx27NM_000492.3:c.4383G>Tp.Lys1461Asn | p.K1461NLRG_663t1:c.4383G>T, NM_000492.3:c.4383G>TVOUS12/20/2017
473CFTREx27NM_000492.3:c.4387C>Tp.Gln1463* | p.Q1463XLRG_663t1:c.4387C>T, NM_000492.3:c.4387C>TVOUS08/15/2016
474CFTREx27NM_000492.3:c.4389G>Ap.Gln1463= | p.Q1463=LRG_663t1:c.4389G>A, NM_000492.3:c.4389G>ABenign11/20/2018 
475CFTREx27NM_000492.3:c.4417G>Ap.Glu1473Lys | p.E1473KLRG_663t1:c.4417G>A, NM_000492.3:c.4417G>AVOUS05/05/2017
476CFTREx27NM_000492.3:c.4426C>Tp.Gln1476* | p.Q1476XLRG_663t1:c.4426C>T, NM_000492.3:c.4426C>TPathogenic05/15/2018 
477CFTREx27NM_000492.3:c.4436G>Ap.Arg1479Lys | p.R1479KLRG_663t1:c.4436G>A, NM_000492.3:c.4436G>AVOUS03/13/2019

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by EGL Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2018-Q2.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official EGL clinical report and should be approached with caution. Only variants identified at EGL are listed in the EmVClass. If you intend to use EGL's classification for publication purposes please contact the laboratory for permission.