Loading Data . . .

EmVClass

EGL's Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by EGL Genetics for that gene.
EGL Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CFTREx1NM_000492.3:c.-2C>GLRG_663t1:c.-2C>G, NM_000492.3:c.-2C>GVOUS06/28/2019
2CFTREx1NM_000492.3:c.-4G>CLRG_663t1:c.-4G>C, NM_000492.3:c.-4G>CLikely benign05/18/2015 
3CFTREx1NM_000492.3:c.-8G>CLRG_663t1:c.-8G>C, NM_000492.3:c.-8G>CBenign07/06/2017 
4CFTREx1NM_000492.3:c.-9C>AVOUS06/04/2020
5CFTREx1NM_000492.3:c.10T>Cp.Ser4Pro | p.S4PLRG_663t1:c.10T>C, NM_000492.3:c.10T>CVOUS03/05/2019
6CFTREx1NM_000492.3:c.14C>Tp.Pro5Leu | p.P5LLRG_663t1:c.14C>T, NM_000492.3:c.14C>TLikely pathogenic11/20/2017 
7CFTREx1NM_000492.3:c.19G>Tp.Glu7* | p.E7XLRG_663t1:c.19G>T, NM_000492.3:c.19G>TPathogenic05/16/2016 
8CFTREx1NM_000492.3:c.-34C>TVOUS03/12/2020
9CFTREx1NM_000492.3:c.40A>Gp.Lys14Glu | p.K14ELRG_663t1:c.40A>G, NM_000492.3:c.40A>GVOUS12/28/2017
10CFTREx1NM_000492.3:c.49_50dupTTp.Trp19Alafs*7 | p.W19AfsX7LRG_663t1:c.49_50dupTT, NM_000492.3:c.49_50dupTTPathogenic04/27/2018 
11CFTREx1NM_000492.3:c.50T>Gp.Phe17Cys | p.F17CLRG_663t1:c.50T>G, NM_000492.3:c.50T>GVOUS12/03/2019
12CFTREx1NM_000492.3:c.53+9G>TVOUS10/03/2019
13CFTREx1NM_000492.3:c.53+45A>GLRG_663t1:c.53+45A>G, NM_000492.3:c.53+45A>GVOUS**
14CFTREx1NM_000492.3:c.-132-680T>GLRG_663t1:c.-812T>G, NM_000492.3:c.-812T>GLikely benign01/18/2017 
15CFTREx1NM_000492.3:c.-132-470A>TVOUS08/28/2020
16CFTREx1NM_000492.3:c.-132-329A>GLRG_663t1:c.-461A>G, NM_000492.3:c.-461A>GVOUS12/09/2019
17CFTREx1NM_000492.3:c.-132-316A>GLRG_663t1:c.-448A>G, NM_000492.3:c.-448A>GVOUS11/02/2020
18CFTREx1NM_000492.3:c.-132-156G>CLRG_663t1:c.-288G>C, NM_000492.3:c.-288G>CLikely benign03/20/2017 
19CFTREx1NM_000492.3:c.-132-156G>AVOUS10/04/2019
20CFTREx1NM_000492.3:c.-132-94G>TLRG_663t1:c.-226G>T, NM_000492.3:c.-226G>TVOUS10/09/2020
21CFTREx1NM_000492.3:c.-132-33G>ALRG_663t1:c.-165G>A, NM_000492.3:c.-165G>AVOUS04/19/2018
22CFTREx1NM_000492.3:c.-132-20G>CLRG_663t1:c.-152G>C, NM_000492.3:c.-152G>CVOUS03/14/2019
23CFTREx1NM_000492.3:c.-132T>GLRG_663t1:c.-132T>G, NM_000492.3:c.-132T>GVOUS01/09/2017
24CFTREx2NM_000492.3:c.91C>Tp.Arg31Cys | p.R31CLRG_663t1:c.91C>T, NM_000492.3:c.91C>TVOUS08/18/2020
25CFTREx2NM_000492.3:c.92G>Tp.Arg31Leu | p.R31LLRG_663t1:c.92G>T, NM_000492.3:c.92G>TVOUS06/07/2018
26CFTREx2NM_000492.3:c.94C>Ap.Leu32Met | p.L32MLRG_663t1:c.94C>A, NM_000492.3:c.94C>AVOUS06/15/2017
27CFTREx2NM_000492.3:c.104C>Tp.Ser35Leu | p.S35LLRG_663t1:c.104C>T, NM_000492.3:c.104C>TVOUS02/20/2020
28CFTREx2NM_000492.3:c.109A>Gp.Ile37Val | p.I37VLRG_663t1:c.109A>G, NM_000492.3:c.109A>GVOUS03/15/2018
29CFTREx2NM_000492.3:c.117A>Cp.Gln39His | p.Q39HLRG_663t1:c.117A>C, NM_000492.3:c.117A>CVOUS02/12/2020
30CFTREx2NM_000492.3:c.125C>Tp.Ser42Phe | p.S42FLRG_663t1:c.125C>T, NM_000492.3:c.125C>TVOUS06/29/2018
31CFTREx2NM_000492.3:c.137C>Tp.Ala46Val | p.A46VLRG_663t1:c.137C>T, NM_000492.3:c.137C>TVOUS09/04/2018
32CFTREx2NM_000492.3:c.164+9A>GLRG_663t1:c.164+9A>G, NM_000492.3:c.164+9A>GVOUS12/26/2018
33CFTREx2NM_000492.3:c.164+10delTinsATGALRG_663t1:c.164+10delinsATGA, NM_000492.3:c.164+10delinsATGAVOUS**
34CFTREx2NM_000492.3:c.164+12T>CLRG_663t1:c.164+12T>C, NM_000492.3:c.164+12T>CVOUS10/26/2018
35CFTREx2NM_000492.3:c.164+28A>GLRG_663t1:c.164+28A>G, NM_000492.3:c.164+28A>GBenign11/20/2018 
36CFTREx3NM_000492.3:c.165-3C>TLRG_663t1:c.165-3C>T, NM_000492.3:c.165-3C>TPathogenic12/31/2018 
37CFTREx3NM_000492.3:c.165-1G>ALRG_663t1:c.165-1G>A, NM_000492.3:c.165-1G>APathogenic01/19/2016 
38CFTREx3NM_000492.3:c.166G>Ap.Glu56Lys | p.E56KLRG_663t1:c.166G>A, NM_000492.3:c.166G>ALikely pathogenic08/25/2020 
39CFTREx3NM_000492.3:c.180G>Cp.Glu60Asp | p.E60DLRG_663t1:c.180G>C, NM_000492.3:c.180G>CVOUS01/11/2018
40CFTREx3NM_000492.3:c.181C>Tp.Leu61= | p.L61=LRG_663t1:c.181C>T, NM_000492.3:c.181C>TVOUS12/11/2018
41CFTREx3NM_000492.3:c.200C>Tp.Pro67Leu | p.P67LLRG_663t1:c.200C>TPathogenic01/13/2020 
42CFTREx3NM_000492.3:c.202A>Gp.Lys68Glu | p.K68ELRG_663t1:c.202A>G, NM_000492.3:c.202A>GVOUS08/21/2018
43CFTREx3NM_000492.3:c.204A>Tp.Lys68Asn | p.K68NLRG_663t1:c.204A>T, NM_000492.3:c.204A>TVOUS10/22/2019
44CFTREx3NM_000492.3:c.220C>Tp.Arg74Trp | p.R74WLRG_663t1:c.220C>T, NM_000492.3:c.220C>TLikely pathogenic05/22/2020 
45CFTREx3NM_000492.3:c.221G>Ap.Arg74Gln | p.R74QLRG_663t1:c.221G>A, NM_000492.3:c.221G>AVOUS12/03/2019
46CFTREx3NM_000492.3:c.224G>Ap.Arg75Gln | p.R75QLRG_663t1:c.224G>A, NM_000492.3:c.224G>ALikely benign10/20/2017 
47CFTREx3NM_000492.3:c.226T>Ap.Cys76Ser | p.C76SLRG_663t1:c.226T>A, NM_000492.3:c.226T>AVOUS09/06/2016
48CFTREx3NM_000492.3:c.233dupTp.Trp79Leufs*32 | p.W79LfsX32LRG_663t1:c.233dupT, NM_000492.3:c.233dupTPathogenic10/10/2018 
49CFTREx3NM_000492.3:c.246G>Ap.Met82Ile | p.M82ILRG_663t1:c.246G>A, NM_000492.3:c.246G>AVOUS03/22/2019
50CFTREx3NM_000492.3:c.250T>Cp.Tyr84His | p.Y84HLRG_663t1:c.250T>C, NM_000492.3:c.250T>CVOUS01/26/2017
51CFTREx3NM_000492.3:c.254G>Ap.Gly85Glu | p.G85ELRG_663t1:c.254G>A, NM_000492.3:c.254G>APathogenic06/18/2020 
52CFTREx3NM_000492.3:c.256A>Gp.Ile86Val | p.I86VLRG_663t1:c.256A>G, NM_000492.3:c.256A>GVOUS09/30/2019
53CFTREx3NM_000492.3:c.262_263delTTp.Leu88Ilefs*22 | p.L88IfsX22LRG_663t1:c.262_263delTT, NM_000492.3:c.262_263delTTPathogenic** 
54CFTREx4NM_000492.3:c.274-6T>CLRG_663t1:c.274-6T>C, NM_000492.3:c.274-6T>CVOUS05/07/2020
55CFTREx4NM_000492.3:c.274-1G>ALRG_663t1:c.274-1G>A, NM_000492.3:c.274-1G>APathogenic06/24/2014 
56CFTREx4NM_000492.3:c.290T>Cp.Val97Ala | p.V97AVOUS**
57CFTREx4NM_000492.3:c.316A>Gp.Ile106Val | p.I106VLRG_663t1:c.316A>G, NM_000492.3:c.316A>GVOUS10/05/2016
58CFTREx4NM_000492.3:c.326A>Gp.Tyr109Cys | p.Y109CLRG_663t1:c.326A>G, NM_000492.3:c.326A>GLikely pathogenic02/08/2019 
59CFTREx4NM_000492.3:c.328G>Cp.Asp110His | p.D110HLRG_663t1:c.328G>C, NM_000492.3:c.328G>CPathogenic09/11/2020 
60CFTREx4NM_000492.3:c.328G>Tp.Asp110Tyr | p.D110YLRG_663t1:c.328G>T, NM_000492.3:c.328G>TPathogenic** 
61CFTREx4NM_000492.3:c.330C>Ap.Asp110Glu | p.D110ELRG_663t1:c.330C>A, NM_000492.3:c.330C>APathogenic05/23/2017 
62CFTREx4NM_000492.3:c.332C>Tp.Pro111Leu | p.P111LLRG_663t1:c.332C>T, NM_000492.3:c.332C>TVOUS08/07/2019
63CFTREx4NM_000492.3:c.332C>Gp.Pro111Arg | p.P111RLRG_663t1:c.332C>G, NM_000492.3:c.332C>GVOUS08/02/2016
64CFTREx4NM_000492.3:c.335A>Gp.Asp112Gly | p.D112GLRG_663t1:c.335A>G, NM_000492.3:c.335A>GVOUS09/03/2020
65CFTREx4NM_000492.3:c.349C>Tp.Arg117Cys | p.R117CLRG_663t1:c.349C>T, NM_000492.3:c.349C>TPathogenic12/06/2017 
66CFTREx4NM_000492.3:c.350G>Ap.Arg117His | p.R117HLRG_663t1:c.350G>A, NM_000492.3:c.350G>APathogenic08/03/2020 
67CFTREx4NM_000492.3:c.350G>Tp.Arg117Leu | p.R117LLRG_663t1:c.350G>T, NM_000492.3:c.350G>TPathogenic** 
68CFTREx4NM_000492.3:c.358G>Ap.Ala120Thr | p.A120TLRG_663t1:c.358G>A, NM_000492.3:c.358G>AVOUS12/03/2019
69CFTREx4NM_000492.3:c.360G>Ap.Ala120= | p.A120=LRG_663t1:c.360G>A, NM_000492.3:c.360G>AVOUS08/22/2019
70CFTREx4NM_000492.3:c.374T>Cp.Ile125Thr | p.I125TLRG_663t1:c.374T>C, NM_000492.3:c.374T>CLikely benign03/13/2017 
71CFTREx4NM_000492.3:c.377G>Tp.Gly126Val | p.G126VLRG_663t1:c.377G>T, NM_000492.3:c.377G>TVOUS05/25/2018
72CFTREx4NM_000492.3:c.393T>Cp.Phe131= | p.F131=LRG_663t1:c.393T>C, NM_000492.3:c.393T>CVOUS08/30/2018
73CFTREx4NM_000492.3:c.403A>Gp.Thr135Ala | p.T135ALRG_663t1:c.403A>G, NM_000492.3:c.403A>GVOUS12/13/2017
74CFTREx4NM_000492.3:c.416A>Cp.His139Pro | p.H139PLRG_663t1:c.416A>C, NM_000492.3:c.416A>CVOUS03/30/2018
75CFTREx4NM_000492.3:c.418C>Tp.Pro140Ser | p.P140SLRG_663t1:c.418C>T, NM_000492.3:c.418C>TVOUS06/30/2020
76CFTREx4NM_000492.3:c.442delAp.Ile148Leufs*5 | p.I148LfsX5LRG_663t1:c.442delA, NM_000492.3:c.442delAPathogenic09/22/2017 
77CFTREx4NM_000492.3:c.443T>Ap.Ile148Asn | p.I148NLRG_663t1:c.443T>A, NM_000492.3:c.443T>AVOUS02/27/2017
78CFTREx4NM_000492.3:c.443T>Cp.Ile148Thr | p.I148TLRG_663t1:c.443T>C, NM_000492.3:c.443T>CBenign08/06/2012 
79CFTREx4NM_000492.3:c.451C>Ap.Gln151Lys | p.Q151KLRG_663t1:c.451C>A, NM_000492.3:c.451C>AVOUS07/14/2019
80CFTREx4NM_000492.3:c.454A>Tp.Met152Leu | p.M152LLRG_663t1:c.454A>T, NM_000492.3:c.454A>TVOUS01/09/2019
81CFTREx4NM_000492.3:c.473G>Cp.Ser158Thr | p.S158TLRG_663t1:c.473G>C, NM_000492.3:c.473G>CVOUS02/05/2020
82CFTREx4NM_000492.3:c.478A>Gp.Ile160Val | p.I160VLRG_663t1:c.478A>G, NM_000492.3:c.478A>GVOUS07/06/2020
83CFTREx4NM_000492.3:c.489+1G>T 621+1G->T, LRG_663t1:c.489+1G>T, NM_000492.3:c.489+1G>TPathogenic11/24/2018 
84CFTREx4NM_000492.3:c.489+3A>GLRG_663t1:c.489+3A>G, NM_000492.3:c.489+3A>GVOUS10/18/2019
85CFTREx4NM_000492.3:c.489+4A>GVOUS10/20/2020
86CFTREx4NM_000492.3:c.489+8T>GLRG_663t1:c.489+8T>G, NM_000492.3:c.489+8T>GVOUS02/20/2018
87CFTREx4NM_000492.3:c.489+87A>GLRG_663t1:c.489+87A>G, NM_000492.3:c.489+87A>GVOUS02/15/2018
88CFTREx5NM_000492.3:c.509G>Ap.Arg170His | p.R170HLRG_663t1:c.509G>A, NM_000492.3:c.509G>AVOUS11/17/2020
89CFTREx5NM_000492.3:c.530T>Cp.Ile177Thr | p.I177TLRG_663t1:c.530T>C, NM_000492.3:c.530T>CVOUS11/07/2018
90CFTREx5NM_000492.3:c.538C>Gp.Leu180Val | p.L180VLRG_663t1:c.538C>G, NM_000492.3:c.538C>GVOUS04/08/2019
91CFTREx5NM_000492.3:c.547C>Ap.Leu183Ile | p.L183ILRG_663t1:c.547C>A, NM_000492.3:c.547C>AVOUS03/26/2019
92CFTREx5NM_000492.3:c.561C>Tp.Asn187= | p.N187=LRG_663t1:c.561C>T, NM_000492.3:c.561C>TVOUS06/26/2018
93CFTREx5NM_000492.3:c.571T>Gp.Phe191Val | p.F191VLRG_663t1:c.571T>G, NM_000492.3:c.571T>GLikely pathogenic02/06/2020 
94CFTREx5NM_000492.3:c.577G>Tp.Glu193* | p.E193XNM_000492.3:c.577G>TPathogenic08/18/2014 
95CFTREx5NM_000492.3:c.579+1G>TLRG_663t1:c.579+1G>T, NM_000492.3:c.579+1G>TPathogenic05/19/2016 
96CFTREx5NM_000492.3:c.579+4delTVOUS**
97CFTREx5NM_000492.3:c.579+4T>CVOUS08/06/2020
98CFTREx6NM_000492.3:c.581G>Tp.Gly194Val | p.G194VLRG_663t1:c.581G>T, NM_000492.3:c.581G>TVOUS11/07/2017
99CFTREx6NM_000492.3:c.592G>Cp.Ala198Pro | p.A198PLRG_663t1:c.592G>C, NM_000492.3:c.592G>CVOUS03/14/2016
100CFTREx6NM_000492.3:c.592G>Ap.Ala198Thr | p.A198TLRG_663t1:c.592G>A, NM_000492.3:c.592G>AVOUS01/27/2017
101CFTREx6NM_000492.3:c.598T>Ap.Phe200Ile | p.F200ILRG_663t1:c.598T>A, NM_000492.3:c.598T>AVOUS08/06/2020
102CFTREx6NM_000492.3:c.601G>Ap.Val201Met | p.V201MLRG_663t1:c.601G>A, NM_000492.3:c.601G>AVOUS01/22/2020
103CFTREx6NM_000492.3:c.610G>Ap.Ala204Thr | p.A204TLRG_663t1:c.610G>A, NM_000492.3:c.610G>AVOUS10/07/2020
104CFTREx6NM_000492.3:c.613C>Tp.Pro205Ser | p.P205SLRG_663t1:c.613C>T, NM_000492.3:c.613C>TPathogenic03/12/2019 
105CFTREx6NM_000492.3:c.617T>Gp.Leu206Trp | p.L206WLRG_663t1:c.617T>G, NM_000492.3:c.617T>GPathogenic03/19/2020 
106CFTREx6NM_000492.3:c.638G>Tp.Gly213Val | p.G213VLRG_663t1:c.638G>T, NM_000492.3:c.638G>TVOUS03/05/2020
107CFTREx6NM_000492.3:c.648G>Tp.Trp216Cys | p.W216CLRG_663t1:c.648G>T, NM_000492.3:c.648G>TVOUS06/12/2018
108CFTREx6NM_000492.3:c.650A>Gp.Glu217Gly | p.E217GLRG_663t1:c.650A>G, NM_000492.3:c.650A>GVOUS03/11/2020
109CFTREx6NM_000492.3:c.663G>Ap.Ala221= | p.A221=LRG_663t1:c.663G>A, NM_000492.3:c.663G>AVOUS08/25/2016
110CFTREx6NM_000492.3:c.688C>Tp.Leu230= | p.L230=LRG_663t1:c.688C>T, NM_000492.3:c.688C>TVOUS04/17/2018
111CFTREx6NM_000492.3:c.695T>Ap.Val232Asp | p.V232DLRG_663t1:c.695T>A, NM_000492.3:c.695T>APathogenic04/04/2018 
112CFTREx6NM_000492.3:c.708delTPathogenic** 
113CFTREx6NM_000492.3:c.709C>Gp.Gln237Glu | p.Q237ELRG_663t1:c.709C>G, NM_000492.3:c.709C>GLikely pathogenic01/08/2019 
114CFTREx6NM_000492.3:c.710A>Tp.Gln237Leu | p.Q237LLRG_663t1:c.710A>T, NM_000492.3:c.710A>TVOUS01/08/2019
115CFTREx6NM_000492.3:c.710A>Gp.Gln237Arg | p.Q237RLRG_663t1:c.710A>G, NM_000492.3:c.710A>GVOUS01/08/2019
116CFTREx6NM_000492.3:c.711G>Tp.Gln237His | p.Q237HLRG_663t1:c.711G>T, NM_000492.3:c.711G>TVOUS12/28/2018
117CFTREx6NM_000492.3:c.711G>Cp.Gln237His | p.Q237HLRG_663t1:c.711G>C, NM_000492.3:c.711G>CVOUS01/08/2019
118CFTREx6NM_000492.3:c.715G>Ap.Gly239Arg | p.G239RLRG_663t1:c.715G>A, NM_000492.3:c.715G>AVOUS10/04/2019
119CFTREx6NM_000492.3:c.738G>Ap.Lys246= | p.K246=LRG_663t1:c.738G>A, NM_000492.3:c.738G>ALikely benign12/07/2016 
120CFTREx6NM_000492.3:c.743+1G>ALRG_663t1:c.743+1G>A, NM_000492.3:c.743+1G>APathogenic07/06/2016 
121CFTREx6NM_000492.3:c.743+40A>GNM_000492.3:c.743+40A>GBenign** 
122CFTREx7NM_000492.3:c.744-33GATT(6_9)Benign11/20/2018 
123CFTREx7NM_000492.3:c.744-9_744-6dupGATTLRG_663t1:c.744-9_744-6dupGATT, NM_000492.3:c.744-9_744-6dupGATTBenign06/23/2017 
124CFTREx7NM_000492.3:c.772A>Gp.Arg258Gly | p.R258GLRG_663t1:c.772A>G, NM_000492.3:c.772A>GVOUS10/02/2019
125CFTREx7NM_000492.3:c.780G>Cp.Val260= | p.V260=LRG_663t1:c.780G>C, NM_000492.3:c.780G>CVOUS10/07/2020
126CFTREx7NM_000492.3:c.794T>Gp.Met265Arg | p.M265RLRG_663t1:c.794T>G, NM_000492.3:c.794T>GVOUS02/11/2019
127CFTREx7NM_000492.3:c.803delAp.Asn268Ilefs*17 | p.N268IfsX17LRG_663t1:c.803delA, NM_000492.3:c.803delAPathogenic07/25/2019 
128CFTREx7NM_000492.3:c.806T>Cp.Ile269Thr | p.I269TLRG_663t1:c.806T>C, NM_000492.3:c.806T>CVOUS06/26/2020
129CFTREx7NM_000492.3:c.837A>Tp.Glu279Asp | p.E279DLRG_663t1:c.837A>T, NM_000492.3:c.837A>TVOUS03/27/2017
130CFTREx7NM_000492.3:c.842T>Cp.Met281Thr | p.M281TLRG_663t1:c.842T>C, NM_000492.3:c.842T>CVOUS08/19/2019
131CFTREx7NM_000492.3:c.846A>Tp.Glu282Asp | p.E282DLRG_663t1:c.846A>T, NM_000492.3:c.846A>TVOUS12/13/2019
132CFTREx7NM_000492.3:c.848_860delAAATGATTGAAAAinsTGNM_000492.3:c.848_860delinsTGPathogenic10/27/2014 
133CFTREx7NM_000492.3:c.850dupALRG_663t1:c.850_851insA, NM_000492.3:c.850_851insAPathogenic03/28/2016 
134CFTREx7NM_000492.3:c.853A>Tp.Ile285Phe | p.I285FLRG_663t1:c.853A>T, NM_000492.3:c.853A>TLikely benign06/23/2017 
135CFTREx7NM_000492.3:c.860A>Gp.Asn287Ser | p.N287SLRG_663t1:c.860A>G, NM_000492.3:c.860A>GVOUS02/20/2020
136CFTREx7NM_000492.3:c.861C>Gp.Asn287Lys | p.N287KLRG_663t1:c.861C>G, NM_000492.3:c.861C>GVOUS09/25/2018
137CFTREx7NM_000492.3:c.869+1G>CLRG_663t1:c.869+1G>C, NM_000492.3:c.869+1G>CPathogenic06/14/2018 
138CFTREx7NM_000492.3:c.869+11C>TLRG_663t1:c.869+11C>T, NM_000492.3:c.869+11C>TBenign05/19/2016 
139CFTREx7NM_000492.3:c.869+40A>GNM_000492.3:c.869+40A>GBenign** 
140CFTREx8NM_000492.3:c.870-7_870-5delTTTLRG_663t1:c.870-7_870-5delTTT, NM_000492.3:c.870-7_870-5delTTTLikely benign05/30/2017 
141CFTREx8NM_000492.3:c.889C>Tp.Arg297Trp | p.R297WLRG_663t1:c.889C>T, NM_000492.3:c.889C>TVOUS06/18/2020
142CFTREx8NM_000492.3:c.890G>Ap.Arg297Gln | p.R297QLRG_663t1:c.890G>A, NM_000492.3:c.890G>ALikely benign09/26/2014 
143CFTREx8NM_000492.3:c.902A>Gp.Tyr301Cys | p.Y301CLRG_663t1:c.902A>G, NM_000492.3:c.902A>GVOUS09/03/2019
144CFTREx8NM_000492.3:c.925G>Tp.Ala309Ser | p.A309SLRG_663t1:c.925G>T, NM_000492.3:c.925G>TVOUS02/07/2019
145CFTREx8NM_000492.3:c.926C>Gp.Ala309Gly | p.A309GLRG_663t1:c.926C>G, NM_000492.3:c.926C>GVOUS11/14/2017
146CFTREx8NM_000492.3:c.935_937delTCTp.Phe312del | p.F312delLRG_663t1:c.935_937delTCT, NM_000492.3:c.935_937delTCTPathogenic11/19/2013 
147CFTREx8NM_000492.3:c.944T>Cp.Phe315Ser | p.F315SLRG_663t1:c.944T>C, NM_000492.3:c.944T>CVOUS09/15/2017
148CFTREx8NM_000492.3:c.948delTp.Phe316Leufs*12 | p.F316LfsX12LRG_663t1:c.948delT, NM_000492.3:c.948delTPathogenic08/15/2017 
149CFTREx8NM_000492.3:c.948T>Gp.Phe316Leu | p.F316LLRG_663t1:c.948T>G, NM_000492.3:c.948T>GVOUS11/09/2017
150CFTREx8NM_000492.3:c.958T>Gp.Leu320Val | p.L320VLRG_663t1:c.958T>G, NM_000492.3:c.958T>GVOUS10/27/2020
151CFTREx8NM_000492.3:c.960A>Gp.Leu320= | p.L320=LRG_663t1:c.960A>G, NM_000492.3:c.960A>GVOUS06/18/2019
152CFTREx8NM_000492.3:c.974A>Gp.Tyr325Cys | p.Y325CLRG_663t1:c.974A>G, NM_000492.3:c.974A>GVOUS09/13/2018
153CFTREx8NM_000492.3:c.1000C>Tp.Arg334Trp | p.R334WLRG_663t1:c.1000C>T, NM_000492.3:c.1000C>TPathogenic** 
154CFTREx8NM_000492.3:c.1001G>Ap.Arg334Gln | p.R334QLRG_663t1:c.1001G>A, NM_000492.3:c.1001G>AVOUS12/24/2018
155CFTREx8NM_000492.3:c.1007T>Ap.Ile336Lys | p.I336KLRG_663t1:c.1007T>A, NM_000492.3:c.1007T>APathogenic03/15/2017 
156CFTREx8NM_000492.3:c.1021T>Cp.Ser341Pro | p.S341PLRG_663t1:c.1021T>C, NM_000492.3:c.1021T>CPathogenic10/10/2016 
157CFTREx8NM_000492.3:c.1022_1023insTC1157InsTC, NM_000492.3:c.1022_1023insTCPathogenic07/10/2014 
158CFTREx8NM_000492.3:c.1039C>Tp.Arg347Cys | p.R347CLRG_663t1:c.1039C>T, NM_000492.3:c.1039C>TVOUS09/27/2017
159CFTREx8NM_000492.3:c.1040G>Cp.Arg347Pro | p.R347PLRG_663t1:c.1040G>C, NM_000492.3:c.1040G>CPathogenic10/17/2018 
160CFTREx8NM_000492.3:c.1043T>Ap.Met348Lys | p.M348KLRG_663t1:c.1043T>A, NM_000492.3:c.1043T>ALikely benign06/08/2020 
161CFTREx8NM_000492.3:c.1046C>Tp.Ala349Val | p.A349VLRG_663t1:c.1046C>T, NM_000492.3:c.1046C>TVOUS07/07/2020
162CFTREx8NM_000492.3:c.1047G>Ap.Ala349= | p.A349=LRG_663t1:c.1047G>A, NM_000492.3:c.1047G>AVOUS12/15/2017
163CFTREx8NM_000492.3:c.1052C>Gp.Thr351Ser | p.T351SLRG_663t1:c.1052C>G, NM_000492.3:c.1052C>GVOUS06/04/2020
164CFTREx8NM_000492.3:c.1054C>Tp.Arg352Trp | p.R352WLRG_663t1:c.1054C>T, NM_000492.3:c.1054C>TVOUS05/31/2019
165CFTREx8NM_000492.3:c.1055G>Ap.Arg352Gln | p.R352QLRG_663t1:c.1055G>A, NM_000492.3:c.1055G>APathogenic** 
166CFTREx8NM_000492.3:c.1066_1072delTGGGCTGinsANM_000492.3:c.1066_1072delinsAVOUS05/29/2015
167CFTREx8NM_000492.3:c.1083delGp.Trp361Cysfs*8 | p.W361CfsX8LRG_663t1:c.1083delG, NM_000492.3:c.1083delGPathogenic04/18/2017 
168CFTREx8NM_000492.3:c.1116+6G>CLRG_663t1:c.1116+6G>C, NM_000492.3:c.1116+6G>CVOUS03/21/2017
169CFTREx9NM_000492.3:c.1118A>Tp.Asp373Val | p.D373VLRG_663t1:c.1118A>T, NM_000492.3:c.1118A>TVOUS08/21/2019
170CFTREx9NM_000492.3:c.1125A>Cp.Leu375Phe | p.L375FLRG_663t1:c.1125A>C, NM_000492.3:c.1125A>CLikely pathogenic09/18/2019 
171CFTREx9NM_000492.3:c.1139A>Gp.Tyr380Cys | p.Y380CLRG_663t1:c.1139A>G, NM_000492.3:c.1139A>GVOUS05/20/2020
172CFTREx9NM_000492.3:c.1149G>Ap.Leu383= | p.L383=LRG_663t1:c.1149G>A, NM_000492.3:c.1149G>AVOUS10/09/2017
173CFTREx9NM_000492.3:c.1163C>Tp.Thr388Met | p.T388MLRG_663t1:c.1163C>T, NM_000492.3:c.1163C>TVOUS07/24/2019
174CFTREx9NM_000492.3:c.1164G>Ap.Thr388= | p.T388=LRG_663t1:c.1164G>A, NM_000492.3:c.1164G>AVOUS05/19/2017
175CFTREx9NM_000492.3:c.1196C>Tp.Ala399Val | p.A399VLRG_663t1:c.1196C>T, NM_000492.3:c.1196C>TVOUS07/27/2020
176CFTREx10NM_000492.3:c.1210-32T>GLRG_663t1:c.1210-32T>G, NM_000492.3:c.1210-32T>GVOUS09/23/2016
177CFTREx10NM_000492.3:c.1210-15G>TLRG_663t1:c.1210-15G>T, NM_000492.3:c.1210-15G>TVOUS06/26/2017
178CFTREx10NM_000492.3:c.1210-14_1210-13insTGLRG_663t1:c.1210-14_1210-13insTG, NM_000492.3:c.1210-14_1210-13insTGBenign07/02/2014 
179CFTREx10NM_000492.3:c.1210-13GT(10_12)Benign** 
180CFTREx10NM_000492.3:c.1210-13G>TNM_000492.3:c.1210-13G>TBenign01/31/2014 
181CFTREx10NM_000492.3:c.1210-13_1210-10delGTTTLRG_663t1:c.1210-13_1210-10delGTTT, NM_000492.3:c.1210-13_1210-10delGTTTVOUS09/23/2016
182CFTREx10NM_000492.3:c.1210-12T(5_9)Other Reportable03/10/2020 
183CFTREx10NM_000492.3:c.1210-11T>GLRG_663t1:c.1210-11T>G, NM_000492.3:c.1210-11T>GOther Reportable05/19/2016 
184CFTREx10NM_000492.3:c.1210-7_1210-6delTTLRG_663t1:c.1210-7_1210-6delTT, NM_000492.3:c.1210-7_1210-6delTTOther Reportable05/06/2019 
185CFTREx10NM_000492.3:c.1210-7_1210-6dupTTLRG_663t1:c.1210-7_1210-6dupTT, NM_000492.3:c.1210-6_1210-5insTT, NM_000492.3:c.1210-7_1210-6dupTTBenign09/29/2014 
186CFTREx10NM_000492.3:c.1210-6T>AVOUS05/29/2020
187CFTREx10NM_000492.3:c.1210-2_1210-1delAGLRG_663t1:c.1210-2_1210-1delAG, NM_000492.3:c.1210-2_1210-1delAGPathogenic10/04/2019 
188CFTREx10NM_000492.3:c.1227T>Cp.Phe409= | p.F409=LRG_663t1:c.1227T>C, NM_000492.3:c.1227T>CVOUS03/29/2019
189CFTREx10NM_000492.3:c.1231A>Gp.Lys411Glu | p.K411ELRG_663t1:c.1231A>G, NM_000492.3:c.1231A>GVOUS04/19/2019
190CFTREx10NM_000492.3:c.1234_1238delGCAAAp.Ala412Thrfs*4 | p.A412TfsX4LRG_663t1:c.1234_1238delGCAAA, NM_000492.3:c.1234_1238delGCAAAPathogenic09/22/2016 
191CFTREx10NM_000492.3:c.1251C>Ap.Asn417Lys | p.N417KLRG_663t1:c.1251C>A, NM_000492.3:c.1251C>ABenign03/21/2015 
192CFTREx10NM_000492.3:c.1254T>Cp.Asn418= | p.N418=NM_000492.3:c.1254T>CBenign08/19/2014 
193CFTREx10NM_000492.3:c.1270G>Ap.Gly424Ser | p.G424SLRG_663t1:c.1270G>A, NM_000492.3:c.1270G>AVOUS04/18/2019
194CFTREx10NM_000492.3:c.1301_1307delCACTTCTPathogenic** 
195CFTREx10NM_000492.3:c.1312A>Gp.Thr438Ala | p.T438ALRG_663t1:c.1312A>G, NM_000492.3:c.1312A>GVOUS08/31/2018
196CFTREx10NM_000492.3:c.1327G>Tp.Asp443Tyr | p.D443YLRG_663t1:c.1327G>T, NM_000492.3:c.1327G>TPathogenic12/05/2018 
197CFTREx10NM_000492.3:c.1327_1330dupGATAp.Ile444Argfs*3 | p.I444RfsX3LRG_663t1:c.1327_1330dupGATA, NM_000492.3:c.1327_1330dupGATAPathogenic11/08/2019 
198CFTREx10NM_000492.3:c.1331T>Cp.Ile444Thr | p.I444TLRG_663t1:c.1331T>C, NM_000492.3:c.1331T>CVOUS12/21/2017
199CFTREx10NM_000492.3:c.1340delANM_000492.3:c.1340delAPathogenic** 
200CFTREx10NM_000492.3:c.1343T>Ap.Ile448Lys | p.I448KVOUS**
201CFTREx10NM_000492.3:c.1360_1362delTTGp.Leu454del | p.L454delLRG_663t1:c.1360_1362delTTG, NM_000492.3:c.1360_1362delTTGLikely benign01/11/2017 
202CFTREx10NM_000492.3:c.1364C>Ap.Ala455Glu | p.A455ELRG_663t1:c.1364C>A, NM_000492.3:c.1364C>APathogenic** 
203CFTREx10NM_000492.3:c.1364C>Tp.Ala455Val | p.A455VLRG_663t1:c.1364C>T, NM_000492.3:c.1364C>TVOUS08/06/2020
204CFTREx10NM_000492.3:c.1365G>Ap.Ala455= | p.A455=LRG_663t1:c.1365G>A, NM_000492.3:c.1365G>AVOUS03/16/2020
205CFTREx10NM_000492.3:c.1365G>Tp.Ala455= | p.A455=LRG_663t1:c.1365G>T, NM_000492.3:c.1365G>TVOUS01/12/2016
206CFTREx10NM_000492.3:c.1367T>Cp.Val456Ala | p.V456ALRG_663t1:c.1367T>C, NM_000492.3:c.1367T>CPathogenic07/26/2019 
207CFTREx11NM_000492.3:c.1393-42G>ALRG_663t1:c.1393-42G>A, NM_000492.3:c.1393-42G>ABenign01/19/2017 
208CFTREx11NM_000492.3:c.1393-3C>AVOUS05/07/2020
209CFTREx11NM_000492.3:c.1397C>Gp.Ser466* | p.S466XLRG_663t1:c.1397C>G, NM_000492.3:c.1397C>GPathogenic02/24/2017 
210CFTREx11NM_000492.3:c.1400T>Cp.Leu467Pro | p.L467PLRG_663t1:c.1400T>C, NM_000492.3:c.1400T>CPathogenic04/24/2017 
211CFTREx11NM_000492.3:c.1408A>Gp.Met470Val | p.M470VLRG_663t1:c.1408A>G, NM_000492.3:c.1408A>GBenign01/06/2020 
212CFTREx11NM_000492.3:c.1408G>Ap.Val470Met | p.V470MLRG_663t1:c.1408G>A, NM_000492.3:c.1408G>ABenign01/06/2020 
213CFTREx11NM_000492.3:c.1414A>Gp.Met472Val | p.M472VLRG_663t1:c.1414A>G, NM_000492.3:c.1414A>GVOUS11/05/2019
214CFTREx11NM_000492.3:c.1430C>Ap.Pro477His | p.P477HLRG_663t1:c.1430C>A, NM_000492.3:c.1430C>AVOUS07/28/2016
215CFTREx11NM_000492.3:c.1436A>Cp.Glu479Ala | p.E479ALRG_663t1:c.1436A>C, NM_000492.3:c.1436A>CVOUS04/07/2016
216CFTREx11NM_000492.3:c.1438G>Tp.Gly480Cys | p.G480CLRG_663t1:c.1438G>T, NM_000492.3:c.1438G>TPathogenic09/30/2013 
217CFTREx11NM_000492.3:c.1446T>Ap.Ile482= | p.I482=LRG_663t1:c.1446T>A, NM_000492.3:c.1446T>AVOUS04/27/2018
218CFTREx11NM_000492.3:c.1450C>Tp.His484Tyr | p.H484YLRG_663t1:c.1450C>T, NM_000492.3:c.1450C>TVOUS05/08/2017
219CFTREx11NM_000492.3:c.1454G>Cp.Ser485Thr | p.S485TLRG_663t1:c.1454G>C, NM_000492.3:c.1454G>CVOUS02/18/2019
220CFTREx11NM_000492.3:c.1457G>Ap.Gly486Glu | p.G486ELRG_663t1:c.1457G>A, NM_000492.3:c.1457G>AVOUS05/20/2020
221CFTREx11NM_000492.3:c.1477C>Tp.Gln493* | p.Q493XLRG_663t1:c.1477C>T, NM_000492.3:c.1477C>TPathogenic07/21/2020 
222CFTREx11NM_000492.3:c.1479G>Cp.Gln493His | p.Q493HLRG_663t1:c.1479G>C, NM_000492.3:c.1479G>CVOUS11/04/2016
223CFTREx11NM_000492.3:c.1499G>Ap.Gly500Asp | p.G500DLRG_663t1:c.1499G>A, NM_000492.3:c.1499G>AVOUS08/12/2016
224CFTREx11NM_000492.3:c.1516A>Gp.Ile506Val | p.I506VLRG_663t1:c.1516A>G, NM_000492.3:c.1516A>GBenign07/06/2016 
225CFTREx11NM_000492.3:c.1517T>Cp.Ile506Thr | p.I506TLRG_663t1:c.1517T>C, NM_000492.3:c.1517T>CLikely pathogenic07/30/2018 
226CFTREx11NM_000492.3:c.1519_1521delATCp.Ile507del | p.I507delLRG_663t1:c.1519_1521delATC, NM_000492.3:c.1519_1521delATCPathogenic11/30/2018 
227CFTREx11NM_000492.3:c.1521_1523delCTTp.Phe508del | p.F508deldelF508, DeltaF508, dF508, LRG_663t1:c.1521_1523delCTT, NM_000492.3:c.1521_1523delCTTPathogenic10/08/2020 
228CFTREx11NM_000492.3:c.1523T>Gp.Phe508Cys | p.F508CLRG_663t1:c.1523T>G, NM_000492.3:c.1523T>GBenign04/14/2016 
229CFTREx11NM_000492.3:c.1534T>Ap.Tyr512Asn | p.Y512NLRG_663t1:c.1534T>A, NM_000492.3:c.1534T>AVOUS11/15/2017
230CFTREx11NM_000492.3:c.1552A>Gp.Arg518Gly | p.R518GLRG_663t1:c.1552A>G, NM_000492.3:c.1552A>GVOUS04/26/2018
231CFTREx11NM_000492.3:c.1558G>Ap.Val520Ile | p.V520ILRG_663t1:c.1558G>A, NM_000492.3:c.1558G>AVOUS10/05/2020
232CFTREx11NM_000492.3:c.1561A>Cp.Ile521Leu | p.I521LLRG_663t1:c.1561A>C, NM_000492.3:c.1561A>CVOUS07/31/2020
233CFTREx11NM_000492.3:c.1567G>Tp.Ala523Ser | p.A523SLRG_663t1:c.1567G>T, NM_000492.3:c.1567G>TVOUS02/20/2020
234CFTREx11NM_000492.3:c.1582G>Ap.Glu528Lys | p.E528KLRG_663t1:c.1582G>A, NM_000492.3:c.1582G>AVOUS05/21/2018
235CFTREx11NM_000492.3:c.1584G>Tp.Glu528Asp | p.E528DLRG_663t1:c.1584G>T, NM_000492.3:c.1584G>TVOUS12/20/2017
236CFTREx11NM_000492.3:c.1584G>Ap.Glu528= | p.E528=LRG_663t1:c.1584G>A, NM_000492.3:c.1584G>ABenign12/03/2019 
237CFTREx12NM_000492.3:c.1585-1G>ALRG_663t1:c.1585-1G>A, NM_000492.3:c.1585-1G>APathogenic10/01/2019 
238CFTREx12NM_000492.3:c.1586A>Gp.Asp529Gly | p.D529GLRG_663t1:c.1586A>G, NM_000492.3:c.1586A>GVOUS12/04/2017
239CFTREx12NM_000492.3:c.1606A>Gp.Lys536Glu | p.K536ELRG_663t1:c.1606A>G, NM_000492.3:c.1606A>GVOUS12/03/2019
240CFTREx12NM_000492.3:c.1612A>Cp.Asn538His | p.N538HLRG_663t1:c.1612A>C, NM_000492.3:c.1612A>CVOUS05/13/2019
241CFTREx12NM_000492.3:c.1616T>Cp.Ile539Thr | p.I539TLRG_663t1:c.1616T>C, NM_000492.3:c.1616T>CVOUS08/10/2020
242CFTREx12NM_000492.3:c.1624G>Tp.Gly542* | p.G542XLRG_663t1:c.1624G>T, NM_000492.3:c.1624G>TPathogenic05/28/2020 
243CFTREx12NM_000492.3:c.1630G>Ap.Gly544Ser | p.G544SLRG_663t1:c.1630G>A, NM_000492.3:c.1630G>AVOUS09/11/2019
244CFTREx12NM_000492.3:c.1645A>Cp.Ser549Arg | p.S549RLRG_663t1:c.1645A>C, NM_000492.3:c.1645A>CPathogenic** 
245CFTREx12NM_000492.3:c.1646G>Ap.Ser549Asn | p.S549NLRG_663t1:c.1646G>A, NM_000492.3:c.1646G>APathogenic09/17/2020 
246CFTREx12NM_000492.3:c.1651G>Ap.Gly551Ser | p.G551SLRG_663t1:c.1651G>A, NM_000492.3:c.1651G>APathogenic** 
247CFTREx12NM_000492.3:c.1652G>Ap.Gly551Asp | p.G551DLRG_663t1:c.1652G>A, NM_000492.3:c.1652G>APathogenic10/23/2019 
248CFTREx12NM_000492.3:c.1655A>Cp.Gln552Pro | p.Q552PLRG_663t1:c.1655A>C, NM_000492.3:c.1655A>CVOUS07/17/2019
249CFTREx12NM_000492.3:c.1657C>Tp.Arg553* | p.R553XLRG_663t1:c.1657C>T, NM_000492.3:c.1657C>TPathogenic08/15/2017 
250CFTREx12NM_000492.3:c.1666A>Gp.Ile556Val | p.I556VLRG_663t1:c.1666A>G, NM_000492.3:c.1666A>GBenign10/17/2014 
251CFTREx12NM_000492.3:c.1674A>Gp.Leu558= | p.L558=LRG_663t1:c.1674A>G, NM_000492.3:c.1674A>GVOUS08/07/2019
252CFTREx12NM_000492.3:c.1675G>Ap.Ala559Thr | p.A559TLRG_663t1:c.1675G>A, NM_000492.3:c.1675G>APathogenic02/22/2018 
253CFTREx12NM_000492.3:c.1675G>Cp.Ala559Pro | p.A559PVOUS**
254CFTREx12NM_000492.3:c.1679G>Cp.Arg560Thr | p.R560TLRG_663t1:c.1679G>C, NM_000492.3:c.1679G>CPathogenic05/09/2019 
255CFTREx12NM_000492.3:c.1679G>Ap.Arg560Lys | p.R560KLRG_663t1:c.1679G>A, NM_000492.3:c.1679G>APathogenic** 
256CFTREx12NM_000492.3:c.1679+1G>ALRG_663t1:c.1679+1G>A, NM_000492.3:c.1679+1G>APathogenic04/28/2016 
257CFTREx12NM_000492.3:c.1679+16T>CVOUS07/16/2019
258CFTREx12NM_000492.3:c.1679+18G>CVOUS10/02/2020
259CFTREx13NM_000492.3:c.1680-886A>GLRG_663t1:c.1680-886A>G, NM_000492.3:c.1680-886A>GPathogenic05/06/2020 
260CFTREx13NM_000492.3:c.1680-877G>TLikely pathogenic05/19/2020 
261CFTREx13NM_000492.3:c.1680-8C>ALRG_663t1:c.1680-8C>A, NM_000492.3:c.1680-8C>AVOUS07/17/2018
262CFTREx13NM_000492.3:c.1680-6T>GLRG_663t1:c.1680-6T>G, NM_000492.3:c.1680-6T>GVOUS06/13/2019
263CFTREx13NM_000492.3:c.1681G>Ap.Ala561Thr | p.A561TLRG_663t1:c.1681G>A, NM_000492.3:c.1681G>AVOUS09/10/2020
264CFTREx13NM_000492.3:c.1682C>Tp.Ala561Val | p.A561VLRG_663t1:c.1682C>T, NM_000492.3:c.1682C>TVOUS03/20/2020
265CFTREx13NM_000492.3:c.1684G>Ap.Val562Ile | p.V562ILRG_663t1:c.1684G>A, NM_000492.3:c.1684G>AVOUS11/08/2019
266CFTREx13NM_000492.3:c.1692delAp.Asp565Metfs*7 | p.D565MfsX7LRG_663t1:c.1692delA, NM_000492.3:c.1692delAPathogenic** 
267CFTREx13NM_000492.3:c.1706A>Gp.Tyr569Cys | p.Y569CPathogenic** 
268CFTREx13NM_000492.3:c.1707T>Cp.Tyr569= | p.Y569=VOUS12/16/2019
269CFTREx13NM_000492.3:c.1718C>Tp.Ser573Phe | p.S573FLRG_663t1:c.1718C>T, NM_000492.3:c.1718C>TVOUS03/13/2020
270CFTREx13NM_000492.3:c.1721C>Ap.Pro574His | p.P574HPathogenic** 
271CFTREx13NM_000492.3:c.1727G>Cp.Gly576Ala | p.G576ALRG_663t1:c.1727G>C, NM_000492.3:c.1727G>CVOUS10/12/2020
272CFTREx13NM_000492.3:c.1753G>Tp.Glu585* | p.E585XLRG_663t1:c.1753G>T, NM_000492.3:c.1753G>TPathogenic08/07/2017 
273CFTREx13NM_000492.3:c.1763A>Gp.Glu588Gly | p.E588GLRG_663t1:c.1763A>G, NM_000492.3:c.1763A>GVOUS06/30/2017
274CFTREx13NM_000492.3:c.1766+1G>APathogenic10/27/2020 
275CFTREx13NM_000492.3:c.1766+2T>ALRG_663t1:c.1766+2T>A, NM_000492.3:c.1766+2T>APathogenic08/31/2018 
276CFTREx13NM_000492.3:c.1766+3A>GLRG_663t1:c.1766+3A>G, NM_000492.3:c.1766+3A>GPathogenic05/23/2016 
277CFTREx13NM_000492.3:c.1766+26T>CVOUS**
278CFTREx13NM_000492.3:c.1766+73T>GLRG_663t1:c.1766+73T>G, NM_000492.3:c.1766+73T>GVOUS09/18/2017
279CFTREx14NM_000492.3:c.1801A>Gp.Ile601Val | p.I601VLRG_663t1:c.1801A>G, NM_000492.3:c.1801A>GVOUS03/25/2020
280CFTREx14NM_000492.3:c.1807G>Ap.Val603Ile | p.V603ILRG_663t1:c.1807G>A, NM_000492.3:c.1807G>AVOUS11/14/2019
281CFTREx14NM_000492.3:c.1811C>Gp.Thr604Ser | p.T604SLRG_663t1:c.1811C>G, NM_000492.3:c.1811C>GVOUS04/19/2019
282CFTREx14NM_000492.3:c.1820_1903delp.Met607_Gln634del | p.M607_Q634delLRG_663t1:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA, NM_000492.3:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAPathogenic11/09/2018 
283CFTREx14NM_000492.3:c.1821G>Ap.Met607Ile | p.M607ILRG_663t1:c.1821G>A, NM_000492.3:c.1821G>AVOUS05/19/2020
284CFTREx14NM_000492.3:c.1826A>Gp.His609Arg | p.H609RLRG_663t1:c.1826A>G, NM_000492.3:c.1826A>GPathogenic07/14/2019 
285CFTREx14NM_000492.3:c.1853T>Cp.Ile618Thr | p.I618TLRG_663t1:c.1853T>C, NM_000492.3:c.1853T>CPathogenic05/02/2019 
286CFTREx14NM_000492.3:c.1865G>Ap.Gly622Asp | p.G622DLRG_663t1:c.1865G>APathogenic09/17/2020 
287CFTREx14NM_000492.3:c.1882G>Cp.Gly628Arg | p.G628RLRG_663t1:c.1882G>C, NM_000492.3:c.1882G>CLikely pathogenic12/22/2017 
288CFTREx14NM_000492.3:c.1885A>Gp.Thr629Ala | p.T629ALRG_663t1:c.1885A>G, NM_000492.3:c.1885A>GVOUS11/13/2019
289CFTREx14NM_000492.3:c.1897C>Ap.Leu633Ile | p.L633ILRG_663t1:c.1897C>A, NM_000492.3:c.1897C>AVOUS05/11/2020
290CFTREx14NM_000492.3:c.1920T>Cp.Phe640= | p.F640=LRG_663t1:c.1920T>C, NM_000492.3:c.1920T>CVOUS01/22/2020
291CFTREx14NM_000492.3:c.1970delGPathogenic** 
292CFTREx14NM_000492.3:c.2002C>Tp.Arg668Cys | p.R668CLRG_663t1:c.2002C>T, NM_000492.3:c.2002C>TVOUS11/19/2020
293CFTREx14NM_000492.3:c.2042A>Tp.Glu681Val | p.E681VLRG_663t1:c.2042A>T, NM_000492.3:c.2042A>TVOUS03/25/2016
294CFTREx14NM_000492.3:c.2051_2052delAAinsGp.Lys684Serfs*38 | p.K684SfsX38LRG_663t1:c.2051_2052delinsG, NM_000492.3:c.2051_2052delinsGPathogenic01/02/2020 
295CFTREx14NM_000492.3:c.2052_2053insAPathogenic** 
296CFTREx14NM_000492.3:c.2052delAp.Lys684Asnfs*38 | p.K684NfsX38LRG_663t1:c.2052delA, NM_000492.3:c.2052delAPathogenic07/14/2020 
297CFTREx14NM_000492.3:c.2052dupAp.Gln685Thrfs*4 | p.Q685TfsX4LRG_663t1:c.2052dupA, NM_000492.3:c.2052dup, NM_000492.3:c.2052dupAPathogenic12/03/2013 
298CFTREx14NM_000492.3:c.2055A>Gp.Gln685= | p.Q685=LRG_663t1:c.2055A>G, NM_000492.3:c.2055A>GVOUS09/04/2018
299CFTREx14NM_000492.3:c.2079T>Gp.Phe693Leu | p.F693LLRG_663t1:c.2079T>G, NM_000492.3:c.2079T>GVOUS02/20/2020
300CFTREx14NM_000492.3:c.2125C>Tp.Arg709* | p.R709XLRG_663t1:c.2125C>T, NM_000492.3:c.2125C>TPathogenic05/31/2018 
301CFTREx14NM_000492.3:c.2145A>Cp.Gln715His | p.Q715HLRG_663t1:c.2145A>C, NM_000492.3:c.2145A>CVOUS07/26/2017
302CFTREx14NM_000492.3:c.2153C>Gp.Pro718Arg | p.P718RLRG_663t1:c.2153C>G, NM_000492.3:c.2153C>GVOUS11/04/2020
303CFTREx14NM_000492.3:c.2168G>Tp.Gly723Val | p.G723VLRG_663t1:c.2168G>T, NM_000492.3:c.2168G>TVOUS11/06/2020
304CFTREx14NM_000492.3:c.2169C>Tp.Gly723= | p.G723=LRG_663t1:c.2169C>T, NM_000492.3:c.2169C>TVOUS10/02/2020
305CFTREx14NM_000492.3:c.2173G>Ap.Glu725Lys | p.E725KLRG_663t1:c.2173G>A, NM_000492.3:c.2173G>AVOUS12/27/2016
306CFTREx14NM_000492.3:c.2175dupAp.Glu726Argfs*4 | p.E726RfsX4c2307dupA, LRG_663t1:c.2175dupA, NM_000492.3:c.2175dupAPathogenic01/19/2018 
307CFTREx14NM_000492.3:c.2191C>Tp.Pro731Ser | p.P731SLRG_663t1:c.2191C>T, NM_000492.3:c.2191C>TVOUS05/28/2020
308CFTREx14NM_000492.3:c.2193T>Cp.Pro731= | p.P731=LRG_663t1:c.2193T>C, NM_000492.3:c.2193T>CVOUS05/09/2016
309CFTREx14NM_000492.3:c.2205G>Cp.Arg735Ser | p.R735SLRG_663t1:c.2205G>C, NM_000492.3:c.2205G>CVOUS10/31/2018
310CFTREx14NM_000492.3:c.2210C>Tp.Ser737Phe | p.S737FLRG_663t1:c.2210C>T, NM_000492.3:c.2210C>TPathogenic** 
311CFTREx14NM_000492.3:c.2245C>Tp.Leu749= | p.L749=LRG_663t1:c.2245C>T, NM_000492.3:c.2245C>TVOUS08/07/2020
312CFTREx14NM_000492.3:c.2249C>Tp.Pro750Leu | p.P750LLRG_663t1:c.2249C>T, NM_000492.3:c.2249C>TVOUS02/10/2020
313CFTREx14NM_000492.3:c.2251C>Tp.Arg751Cys | p.R751CLRG_663t1:c.2251C>T, NM_000492.3:c.2251C>TVOUS12/27/2017
314CFTREx14NM_000492.3:c.2260G>Ap.Val754Met | p.V754MLRG_663t1:c.2260G>A, NM_000492.3:c.2260G>AVOUS03/24/2020
315CFTREx14NM_000492.3:c.2280G>Ap.Thr760= | p.T760=LRG_663t1:c.2280G>A, NM_000492.3:c.2280G>AVOUS01/21/2019
316CFTREx14NM_000492.3:c.2347A>Gp.Ile783Val | p.I783VLRG_663t1:c.2347A>G, NM_000492.3:c.2347A>GVOUS04/16/2019
317CFTREx14NM_000492.3:c.2353C>Tp.Arg785* | p.R785XLRG_663t1:c.2353C>T, NM_000492.3:c.2353C>TPathogenic09/24/2019 
318CFTREx14NM_000492.3:c.2372_2377delCACGAAp.Thr791_Arg792del | p.T791_R792delLRG_663t1:c.2372_2377delCACGAA, NM_000492.3:c.2372_2377delCACGAAVOUS08/11/2017
319CFTREx14NM_000492.3:c.2374C>Ap.Arg792= | p.R792=VOUS**
320CFTREx14NM_000492.3:c.2374C>Gp.Arg792Gly | p.R792GLRG_663t1:c.2374C>G, NM_000492.3:c.2374C>GVOUS08/18/2020
321CFTREx14NM_000492.3:c.2392C>Tp.Pro798Ser | p.P798SLRG_663t1:c.2392C>T, NM_000492.3:c.2392C>TVOUS01/27/2017
322CFTREx14NM_000492.3:c.2393C>Gp.Pro798Arg | p.P798RLRG_663t1:c.2393C>G, NM_000492.3:c.2393C>GVOUS12/02/2019
323CFTREx14NM_000492.3:c.2421A>Gp.Ile807Met | p.I807MLRG_663t1:c.2421A>G, NM_000492.3:c.2421A>GVOUS07/03/2020
324CFTREx14NM_000492.3:c.2424T>Cp.Tyr808= | p.Y808=LRG_663t1:c.2424T>C, NM_000492.3:c.2424T>CVOUS01/30/2020
325CFTREx14NM_000492.3:c.2450G>Tp.Gly817Val | p.G817VLRG_663t1:c.2450G>T, NM_000492.3:c.2450G>TVOUS12/03/2019
326CFTREx14NM_000492.3:c.2458A>Tp.Ile820Leu | p.I820LVOUS12/19/2019
327CFTREx14NM_000492.3:c.2475C>Tp.Asn825= | p.N825=LRG_663t1:c.2475C>T, NM_000492.3:c.2475C>TVOUS10/11/2019
328CFTREx14NM_000492.3:c.2482G>Ap.Asp828Asn | p.D828NLRG_663t1:c.2482G>A, NM_000492.3:c.2482G>AVOUS08/21/2019
329CFTREx14NM_000492.3:c.2490+5G>TLRG_663t1:c.2490+5G>T, NM_000492.3:c.2490+5G>TVOUS06/17/2016
330CFTREx15NM_000492.3:c.2506G>Tp.Asp836Tyr | p.D836YLRG_663t1:c.2506G>T, NM_000492.3:c.2506G>TVOUS06/20/2019
331CFTREx15NM_000492.3:c.2537G>Ap.Trp846* | p.W846XPathogenic** 
332CFTREx15NM_000492.3:c.2540A>Gp.Asn847Ser | p.N847SLRG_663t1:c.2540A>G, NM_000492.3:c.2540A>GVOUS01/07/2020
333CFTREx15NM_000492.3:c.2544A>Tp.Thr848= | p.T848=LRG_663t1:c.2544A>T, NM_000492.3:c.2544A>TVOUS01/16/2017
334CFTREx15NM_000492.3:c.2552G>Ap.Arg851Gln | p.R851QLRG_663t1:c.2552G>A, NM_000492.3:c.2552G>AVOUS10/27/2020
335CFTREx15NM_000492.3:c.2559T>Cp.Ile853= | p.I853=LRG_663t1:c.2559T>C, NM_000492.3:c.2559T>CVOUS01/15/2020
336CFTREx15NM_000492.3:c.2561_2562delCTinsTGp.Thr854Met | p.T854MLRG_663t1:c.2561_2562delinsTG, NM_000492.3:c.2561_2562delinsTGVOUS12/04/2018
337CFTREx15NM_000492.3:c.2562T>Gp.Thr854= | p.T854=LRG_663t1:c.2562T>G, NM_000492.3:c.2562T>GBenign11/20/2018 
338CFTREx15NM_000492.3:c.2583delTp.Phe861Leufs*3 | p.F861LfsX3LRG_663t1:c.2583delT, NM_000492.3:c.2583delTPathogenic10/30/2018 
339CFTREx15NM_000492.3:c.2597G>Ap.Cys866Tyr | p.C866YLRG_663t1:c.2597G>A, NM_000492.3:c.2597G>AVOUS12/03/2019
340CFTREx15NM_000492.3:c.2604A>Gp.Val868= | p.V868=LRG_663t1:c.2604A>G, NM_000492.3:c.2604A>GLikely benign06/30/2020 
341CFTREx15NM_000492.3:c.2619+1G>ALRG_663t1:c.2619+1G>A, NM_000492.3:c.2619+1G>APathogenic05/18/2017 
342CFTREx16NM_000492.3:c.2620-26A>GLRG_663t1:c.2620-26A>G, NM_000492.3:c.2620-26A>GLikely benign04/23/2019 
343CFTREx16NM_000492.3:c.2620-15C>GLRG_663t1:c.2620-15C>G, NM_000492.3:c.2620-15C>GBenign11/29/2016 
344CFTREx16NM_000492.3:c.2620-6T>CLRG_663t1:c.2620-6T>C, NM_000492.3:c.2620-6T>CVOUS06/09/2016
345CFTREx16NM_000492.3:c.2627C>Tp.Ala876Val | p.A876VLRG_663t1:c.2627C>T, NM_000492.3:c.2627C>TVOUS04/09/2020
346CFTREx16NM_000492.3:c.2657+2_2657+3insAc.2789insA, LRG_663t1:c.2657+2_2657+3insA, NM_000492.3:c.2657+2_2657+3insAPathogenic11/05/2019 
347CFTREx16NM_000492.3:c.2657+5G>ALRG_663t1:c.2657+5G>A, NM_000492.3:c.2657+5G>APathogenic12/04/2019 
348CFTREx17NM_000492.3:c.2658-2A>GLRG_663t1:c.2658-2A>G, NM_000492.3:c.2658-2A>GPathogenic10/17/2016 
349CFTREx17NM_000492.3:c.2659A>Cp.Thr887Pro | p.T887PLRG_663t1:c.2659A>C, NM_000492.3:c.2659A>CVOUS05/07/2019
350CFTREx17NM_000492.3:c.2665C>Tp.Leu889Phe | p.L889FLRG_663t1:c.2665C>T, NM_000492.3:c.2665C>TVOUS06/27/2018
351CFTREx17NM_000492.3:c.2672A>Gp.Asp891Gly | p.D891GLRG_663t1:c.2672A>G, NM_000492.3:c.2672A>GVOUS04/23/2020
352CFTREx17NM_000492.3:c.2673C>Gp.Asp891Glu | p.D891ELRG_663t1:c.2673C>G, NM_000492.3:c.2673C>GVOUS12/05/2016
353CFTREx17NM_000492.3:c.2684G>Ap.Ser895Asn | p.S895NLRG_663t1:c.2684G>A, NM_000492.3:c.2684G>AVOUS07/30/2020
354CFTREx17NM_000492.3:c.2709T>Cp.Tyr903= | p.Y903=LRG_663t1:c.2709T>C, NM_000492.3:c.2709T>CVOUS05/16/2019
355CFTREx17NM_000492.3:c.2723C>Ap.Thr908Asn | p.T908NLRG_663t1:c.2723C>A, NM_000492.3:c.2723C>AVOUS11/08/2019
356CFTREx17NM_000492.3:c.2732G>Cp.Ser911Thr | p.S911TVOUS01/13/2020
357CFTREx17NM_000492.3:c.2735C>Tp.Ser912Leu | p.S912LLRG_663t1:c.2735C>T, NM_000492.3:c.2735C>TVOUS03/21/2019
358CFTREx17NM_000492.3:c.2736G>Ap.Ser912= | p.S912=LRG_663t1:c.2736G>A, NM_000492.3:c.2736G>AVOUS01/02/2019
359CFTREx17NM_000492.3:c.2736G>Cp.Ser912= | p.S912=LRG_663t1:c.2736G>C, NM_000492.3:c.2736G>CVOUS08/22/2017
360CFTREx17NM_000492.3:c.2739T>Ap.Tyr913* | p.Y913XNM_000492.3:c.2739T>APathogenic** 
361CFTREx17NM_000492.3:c.2756A>Gp.Tyr919Cys | p.Y919CLRG_663t1:c.2756A>G, NM_000492.3:c.2756A>GVOUS07/06/2018
362CFTREx17NM_000492.3:c.2757C>Tp.Tyr919= | p.Y919=LRG_663t1:c.2757C>T, NM_000492.3:c.2757C>TVOUS11/02/2018
363CFTREx17NM_000492.3:c.2758G>Ap.Val920Met | p.V920MLRG_663t1:c.2758G>A, NM_000492.3:c.2758G>AVOUS01/08/2018
364CFTREx17NM_000492.3:c.2758G>Tp.Val920Leu | p.V920LLRG_663t1:c.2758G>T, NM_000492.3:c.2758G>TVOUS03/13/2017
365CFTREx17NM_000492.3:c.2769C>Tp.Ala923= | p.A923=LRG_663t1:c.2769C>T, NM_000492.3:c.2769C>TVOUS04/14/2017
366CFTREx17NM_000492.3:c.2770G>Ap.Asp924Asn | p.D924NLRG_663t1:c.2770G>A, NM_000492.3:c.2770G>AVOUS12/05/2016
367CFTREx17NM_000492.3:c.2772C>Ap.Asp924Glu | p.D924ELRG_663t1:c.2772C>A, NM_000492.3:c.2772C>AVOUS11/29/2017
368CFTREx17NM_000492.3:c.2797A>Gp.Arg933Gly | p.R933GLRG_663t1:c.2797A>G, NM_000492.3:c.2797A>GVOUS06/08/2017
369CFTREx17NM_000492.3:c.2805A>Gp.Leu935= | p.L935=LRG_663t1:c.2805A>G, NM_000492.3:c.2805A>GVOUS08/29/2019
370CFTREx17NM_000492.3:c.2813T>Gp.Val938Gly | p.V938GLRG_663t1:c.2813T>G, NM_000492.3:c.2813T>GVOUS10/19/2017
371CFTREx17NM_000492.3:c.2820T>Gp.Thr940= | p.T940=LRG_663t1:c.2820T>G, NM_000492.3:c.2820T>GLikely benign12/15/2016 
372CFTREx17NM_000492.3:c.2822delTp.Leu941Glnfs*27 | p.L941QfsX27LRG_663t1:c.2822delT, NM_000492.3:c.2822delTPathogenic10/25/2018 
373CFTREx17NM_000492.3:c.2832G>Ap.Val944= | p.V944=LRG_663t1:c.2832G>A, NM_000492.3:c.2832G>AVOUS12/11/2019
374CFTREx17NM_000492.3:c.2834C>Tp.Ser945Leu | p.S945LLRG_663t1:c.2834C>T, NM_000492.3:c.2834C>TPathogenic04/13/2015 
375CFTREx17NM_000492.3:c.2855T>Cp.Met952Thr | p.M952TLRG_663t1:c.2855T>C, NM_000492.3:c.2855T>CVOUS10/07/2016
376CFTREx17NM_000492.3:c.2856G>Cp.Met952Ile | p.M952ILRG_663t1:c.2856G>C, NM_000492.3:c.2856G>CLikely pathogenic04/23/2019 
377CFTREx17NM_000492.3:c.2856G>Ap.Met952Ile | p.M952ILRG_663t1:c.2856G>A, NM_000492.3:c.2856G>AVOUS05/17/2018
378CFTREx17NM_000492.3:c.2882T>Cp.Met961Thr | p.M961TLRG_663t1:c.2882T>C, NM_000492.3:c.2882T>CVOUS03/28/2017
379CFTREx17NM_000492.3:c.2895C>Ap.Asn965Lys | p.N965KLRG_663t1:c.2895C>A, NM_000492.3:c.2895C>AVOUS01/22/2020
380CFTREx17NM_000492.3:c.2898G>Ap.Thr966= | p.T966=LRG_663t1:c.2898G>A, NM_000492.3:c.2898G>ABenign10/12/2017 
381CFTREx17NM_000492.3:c.2900T>Cp.Leu967Ser | p.L967SLRG_663t1:c.2900T>C, NM_000492.3:c.2900T>CVOUS03/05/2020
382CFTREx17NM_000492.3:c.2908+4C>ALRG_663t1:c.2908+4C>A, NM_000492.3:c.2908+4C>AVOUS04/12/2018
383CFTREx17NM_000492.3:c.2908+19G>CVOUS**
384CFTREx18NM_000492.3:c.2909-4A>GLRG_663t1:c.2909-4A>G, NM_000492.3:c.2909-4A>GVOUS11/23/2016
385CFTREx18NM_000492.3:c.2909_2924dupGTGGGATTCTTAATAGp.Phe976Trpfs*4 | p.F976WfsX4LRG_663t1:c.2909_2924dupGTGGGATTCTTAATAG, NM_000492.3:c.2909_2924dupGTGGGATTCTTAATAGPathogenic11/05/2019 
386CFTREx18NM_000492.3:c.2946T>Gp.Ile982Met | p.I982MLRG_663t1:c.2946T>G, NM_000492.3:c.2946T>GVOUS07/22/2019
387CFTREx18NM_000492.3:c.2981T>Gp.Phe994Cys | p.F994CLRG_663t1:c.2981T>G, NM_000492.3:c.2981T>GVOUS08/09/2018
388CFTREx18NM_000492.3:c.2988G>Ap.Gln996= | p.Q996=LRG_663t1:c.2988G>A, NM_000492.3:c.2988G>APathogenic06/15/2017 
389CFTREx18NM_000492.3:c.2988+1G>A3120+1 G>A, LRG_663t1:c.2988+1G>A, NM_000492.3:c.2988+1G>APathogenic07/12/2019 
390CFTREx19NM_000492.3:c.2991G>Cp.Leu997Phe | p.L997FLRG_663t1:c.2991G>C, NM_000492.3:c.2991G>CVOUS10/09/2020
391CFTREx19NM_000492.3:c.2998A>Tp.Ile1000Phe | p.I1000FLRG_663t1:c.2998A>T, NM_000492.3:c.2998A>TVOUS12/11/2018
392CFTREx19NM_000492.3:c.3001G>Ap.Val1001Met | p.V1001MLRG_663t1:c.3001G>A, NM_000492.3:c.3001G>AVOUS09/06/2018
393CFTREx19NM_000492.3:c.3024C>Tp.Val1008= | p.V1008=NM_000492.3:c.3024C>TVOUS02/12/2015
394CFTREx19NM_000492.3:c.3025G>Ap.Ala1009Thr | p.A1009TLRG_663t1:c.3025G>A, NM_000492.3:c.3025G>AVOUS10/22/2019
395CFTREx19NM_000492.3:c.3036A>Gp.Gln1012= | p.Q1012=LRG_663t1:c.3036A>G, NM_000492.3:c.3036A>GVOUS09/19/2019
396CFTREx19NM_000492.3:c.3038C>Tp.Pro1013Leu | p.P1013LLRG_663t1:c.3038C>T, NM_000492.3:c.3038C>TVOUS12/26/2019
397CFTREx19NM_000492.3:c.3038C>Ap.Pro1013His | p.P1013HLRG_663t1:c.3038C>A, NM_000492.3:c.3038C>AVOUS08/27/2020
398CFTREx19NM_000492.3:c.3041A>Gp.Tyr1014Cys | p.Y1014CLRG_663t1:c.3041A>G, NM_000492.3:c.3041A>GVOUS07/31/2020
399CFTREx19NM_000492.3:c.3067_3072delATAGTGp.Ile1023_Val1024del | p.I1023_V1024delLRG_663t1:c.3067_3072delATAGTG, NM_000492.3:c.3067_3072delATAGTGPathogenic04/03/2020 
400CFTREx19NM_000492.3:c.3073G>Tp.Ala1025Ser | p.A1025SLRG_663t1:c.3073G>T, NM_000492.3:c.3073G>TVOUS12/13/2018
401CFTREx19NM_000492.3:c.3080T>Cp.Ile1027Thr | p.I1027TLRG_663t1:c.3080T>C, NM_000492.3:c.3080T>CBenign12/18/2012 
402CFTREx19NM_000492.3:c.3083T>Gp.Met1028Arg | p.M1028RLRG_663t1:c.3083T>G, NM_000492.3:c.3083T>GVOUS08/27/2019
403CFTREx19NM_000492.3:c.3095A>Gp.Tyr1032Cys | p.Y1032CLRG_663t1:c.3095A>G, NM_000492.3:c.3095A>GLikely pathogenic06/11/2018 
404CFTREx19NM_000492.3:c.3100C>Tp.Leu1034Phe | p.L1034FLRG_663t1:c.3100C>T, NM_000492.3:c.3100C>TVOUS03/08/2017
405CFTREx19NM_000492.3:c.3121A>Cp.Lys1041Gln | p.K1041QLRG_663t1:c.3121A>C, NM_000492.3:c.3121A>CVOUS11/14/2019
406CFTREx19NM_000492.3:c.3139G>Tp.Gly1047Cys | p.G1047CLRG_663t1:c.3139G>T, NM_000492.3:c.3139G>TVOUS10/02/2015
407CFTREx19NM_000492.3:c.3139delGPathogenic** 
408CFTREx19NM_000492.3:c.3139+1delGPathogenic** 
409CFTREx19NM_000492.3:c.3139+8A>GLRG_663t1:c.3139+8A>G, NM_000492.3:c.3139+8A>GVOUS10/01/2018
410CFTREx19NM_000492.3:c.3139+18C>TVOUS**
411CFTREx19NM_000492.3:c.3139+42A>TBenign** 
412CFTREx20NM_000492.3:c.3140-26A>GLRG_663t1:c.3140-26A>G, NM_000492.3:c.3140-26A>GPathogenic04/27/2017 
413CFTREx20NM_000492.3:c.3154T>Gp.Phe1052Val | p.F1052VLRG_663t1:c.3154T>G, NM_000492.3:c.3154T>GVOUS07/06/2020
414CFTREx20NM_000492.3:c.3169A>Gp.Thr1057Ala | p.T1057ALRG_663t1:c.3169A>G, NM_000492.3:c.3169A>GVOUS08/06/2020
415CFTREx20NM_000492.3:c.3177A>Gp.Leu1059= | p.L1059=LRG_663t1:c.3177A>G, NM_000492.3:c.3177A>GVOUS09/17/2019
416CFTREx20NM_000492.3:c.3181G>Cp.Gly1061Arg | p.G1061RLRG_663t1:c.3181G>C, NM_000492.3:c.3181G>CLikely pathogenic03/02/2018 
417CFTREx20NM_000492.3:c.3194T>Cp.Leu1065Pro | p.L1065PNM_000492.3:c.3194T>CPathogenic12/16/2015 
418CFTREx20NM_000492.3:c.3196C>Tp.Arg1066Cys | p.R1066CLRG_663t1:c.3196C>T, NM_000492.3:c.3196C>TPathogenic06/30/2020 
419CFTREx20NM_000492.3:c.3197G>Ap.Arg1066His | p.R1066HLRG_663t1:c.3197G>A, NM_000492.3:c.3197G>APathogenic12/10/2018 
420CFTREx20NM_000492.3:c.3199G>Ap.Ala1067Thr | p.A1067TNM_000492.3:c.3199G>AVOUS04/16/2013
421CFTREx20NM_000492.3:c.3200C>Tp.Ala1067Val | p.A1067VNM_000492.3:c.3200C>TVOUS02/11/2016
422CFTREx20NM_000492.3:c.3204C>Tp.Phe1068= | p.F1068=LRG_663t1:c.3204C>T, NM_000492.3:c.3204C>TVOUS08/03/2020
423CFTREx20NM_000492.3:c.3205G>Ap.Gly1069Arg | p.G1069RLRG_663t1:c.3205G>A, NM_000492.3:c.3205G>AVOUS08/27/2019
424CFTREx20NM_000492.3:c.3209G>Ap.Arg1070Gln | p.R1070QLRG_663t1:c.3209G>A, NM_000492.3:c.3209G>APathogenic03/11/2020 
425CFTREx20NM_000492.3:c.3222T>Ap.Phe1074Leu | p.F1074LLRG_663t1:c.3222T>A, NM_000492.3:c.3222T>ALikely pathogenic05/23/2018 
426CFTREx20NM_000492.3:c.3256A>Tp.Thr1086Ser | p.T1086SLRG_663t1:c.3256A>T, NM_000492.3:c.3256A>TVOUS06/12/2017
427CFTREx20NM_000492.3:c.3256A>Gp.Thr1086Ala | p.T1086ALRG_663t1:c.3256A>G, NM_000492.3:c.3256A>GVOUS03/12/2019
428CFTREx20NM_000492.3:c.3273G>Cp.Leu1091Phe | p.L1091FLRG_663t1:c.3273G>C, NM_000492.3:c.3273G>CVOUS01/20/2020
429CFTREx20NM_000492.3:c.3274T>Cp.Tyr1092His | p.Y1092HLRG_663t1:c.3274T>C, NM_000492.3:c.3274T>CVOUS01/22/2018
430CFTREx20NM_000492.3:c.3275A>Gp.Tyr1092Cys | p.Y1092CLRG_663t1:c.3275A>G, NM_000492.3:c.3275A>GVOUS03/01/2017
431CFTREx20NM_000492.3:c.3276C>Ap.Tyr1092* | p.Y1092XLRG_663t1:c.3276C>A, NM_000492.3:c.3276C>APathogenic08/14/2018 
432CFTREx20NM_000492.3:c.3285A>Tp.Thr1095= | p.T1095=LRG_663t1:c.3285A>T, NM_000492.3:c.3285A>TBenign12/21/2015 
433CFTREx20NM_000492.3:c.3289C>Tp.Arg1097Cys | p.R1097CLRG_663t1:c.3289C>T, NM_000492.3:c.3289C>TVOUS05/16/2019
434CFTREx20NM_000492.3:c.3297C>Ap.Phe1099Leu | p.F1099LLRG_663t1:c.3297C>A, NM_000492.3:c.3297C>AVOUS04/08/2016
435CFTREx20NM_000492.3:c.3302T>Ap.Met1101Lys | p.M1101KLRG_663t1:c.3302T>A, NM_000492.3:c.3302T>APathogenic08/09/2019 
436CFTREx20NM_000492.3:c.3303G>Ap.Met1101Ile | p.M1101ILRG_663t1:c.3303G>A, NM_000492.3:c.3303G>AVOUS09/24/2018
437CFTREx20NM_000492.3:c.3306A>Gp.Arg1102= | p.R1102=LRG_663t1:c.3306A>G, NM_000492.3:c.3306A>GVOUS08/13/2019
438CFTREx20NM_000492.3:c.3322G>Cp.Val1108Leu | p.V1108LLRG_663t1:c.3322G>C, NM_000492.3:c.3322G>CVOUS08/06/2020
439CFTREx20NM_000492.3:c.3367+45T>CNM_000492.3:c.3367+45T>CVOUS**
440CFTREx21NM_000492.3:c.3368-4A>GLRG_663t1:c.3368-4A>G, NM_000492.3:c.3368-4A>GVOUS07/07/2017
441CFTREx21NM_000492.3:c.3382A>Gp.Arg1128Gly | p.R1128GLRG_663t1:c.3382A>G, NM_000492.3:c.3382A>GVOUS07/28/2016
442CFTREx21NM_000492.3:c.3407C>Tp.Ala1136Val | p.A1136VLRG_663t1:c.3407C>T, NM_000492.3:c.3407C>TVOUS02/02/2018
443CFTREx21NM_000492.3:c.3409A>Gp.Met1137Val | p.M1137VLRG_663t1:c.3409A>G, NM_000492.3:c.3409A>GVOUS10/11/2019
444CFTREx21NM_000492.3:c.3411G>Cp.Met1137Ile | p.M1137ILRG_663t1:c.3411G>C, NM_000492.3:c.3411G>CVOUS12/23/2019
445CFTREx21NM_000492.3:c.3415A>Gp.Ile1139Val | p.I1139VLRG_663t1:c.3415A>G, NM_000492.3:c.3415A>GVOUS07/30/2020
446CFTREx21NM_000492.3:c.3420G>Ap.Met1140Ile | p.M1140ILRG_663t1:c.3420G>A, NM_000492.3:c.3420G>AVOUS03/07/2019
447CFTREx21NM_000492.3:c.3429G>Ap.Leu1143= | p.L1143=LRG_663t1:c.3429G>A, NM_000492.3:c.3429G>AVOUS03/25/2020
448CFTREx21NM_000492.3:c.3454G>Cp.Asp1152His | p.D1152HLRG_663t1:c.3454G>C, NM_000492.3:c.3454G>CPathogenic01/13/2020 
449CFTREx21NM_000492.3:c.3468G>Ap.Leu1156= | p.L1156=LRG_663t1:c.3468G>AVOUS12/11/2014
450CFTREx21NM_000492.3:c.3468G>Tp.Leu1156Phe | p.L1156FLRG_663t1:c.3468G>T, NM_000492.3:c.3468G>TVOUS05/20/2020
451CFTREx21NM_000492.3:c.3468+2dupTLRG_663t1:c.3468+2_3468+3insT, LRG_663t1:c.3468+2dupT, NM_000492.3:c.3468+2_3468+3insT, NM_000492.3:c.3468+2dupTLikely pathogenic12/27/2016 
452CFTREx22NM_000492.3:c.3469-20T>CLRG_663t1:c.3469-20T>C, NM_000492.3:c.3469-20T>CBenign03/29/2019 
453CFTREx22NM_000492.3:c.3469-17T>CLRG_663t1:c.3469-17T>C, NM_000492.3:c.3469-17T>CVOUS05/29/2020
454CFTREx22NM_000492.3:c.3472C>Tp.Arg1158* | p.R1158XLRG_663t1:c.3472C>T, NM_000492.3:c.3472C>TPathogenic10/29/2018 
455CFTREx22NM_000492.3:c.3484C>Tp.Arg1162* | p.R1162XLRG_663t1:c.3484C>T, NM_000492.3:c.3484C>TPathogenic10/27/2020 
456CFTREx22NM_000492.3:c.3485G>Tp.Arg1162Leu | p.R1162LLRG_663t1:c.3485G>T, NM_000492.3:c.3485G>TVOUS10/20/2020
457CFTREx22NM_000492.3:c.3485G>Ap.Arg1162Gln | p.R1162QLRG_663t1:c.3485G>A, NM_000492.3:c.3485G>AVOUS04/03/2018
458CFTREx22NM_000492.3:c.3503A>Gp.Asp1168Gly | p.D1168GLRG_663t1:c.3503A>G, NM_000492.3:c.3503A>GVOUS05/30/2017
459CFTREx22NM_000492.3:c.3508C>Tp.Pro1170Ser | p.P1170SLRG_663t1:c.3508C>T, NM_000492.3:c.3508C>TVOUS10/11/2018
460CFTREx22NM_000492.3:c.3517G>Ap.Gly1173Ser | p.G1173SLRG_663t1:c.3517G>A, NM_000492.3:c.3517G>AVOUS09/26/2016
461CFTREx22NM_000492.3:c.3528delCp.Lys1177Serfs*15 | p.K1177SfsX15LRG_663t1:c.3528delC, NM_000492.3:c.3528delCPathogenic04/29/2020 
462CFTREx22NM_000492.3:c.3558A>Gp.Gln1186= | p.Q1186=LRG_663t1:c.3558A>G, NM_000492.3:c.3558A>GVOUS05/20/2020
463CFTREx22NM_000492.3:c.3564G>Ap.Ser1188= | p.S1188=LRG_663t1:c.3564G>A, NM_000492.3:c.3564G>AVOUS06/20/2013
464CFTREx22NM_000492.3:c.3588A>Tp.Ser1196= | p.S1196=LRG_663t1:c.3588A>T, NM_000492.3:c.3588A>TVOUS08/30/2018
465CFTREx22NM_000492.3:c.3607A>Gp.Ile1203Val | p.I1203VNM_000492.3:c.3607A>GVOUS01/23/2014
466CFTREx22NM_000492.3:c.3612G>Ap.Trp1204* | p.W1204XLRG_663t1:c.3612G>A, NM_000492.3:c.3612G>APathogenic01/03/2013 
467CFTREx22NM_000492.3:c.3627A>Gp.Gln1209= | p.Q1209=LRG_663t1:c.3627A>G, NM_000492.3:c.3627A>GVOUS11/09/2020
468CFTREx22NM_000492.3:c.3650C>Tp.Ala1217Val | p.A1217VLRG_663t1:c.3650C>T, NM_000492.3:c.3650C>TVOUS10/20/2020
469CFTREx22NM_000492.3:c.3659C>Tp.Thr1220Ile | p.T1220ILRG_663t1:c.3659C>T, NM_000492.3:c.3659C>TVOUS03/11/2020
470CFTREx22NM_000492.3:c.3665G>Ap.Gly1222Asp | p.G1222DLRG_663t1:c.3665G>A, NM_000492.3:c.3665G>AVOUS09/05/2017
471CFTREx22NM_000492.3:c.3682G>Cp.Glu1228Gln | p.E1228QLRG_663t1:c.3682G>C, NM_000492.3:c.3682G>CVOUS05/29/2019
472CFTREx22NM_000492.3:c.3705T>Gp.Ser1235Arg | p.S1235RLRG_663t1:c.3705T>G, NM_000492.3:c.3705T>GBenign07/24/2012 
473CFTREx22NM_000492.3:c.3710G>Ap.Gly1237Asp | p.G1237DLRG_663t1:c.3710G>A, NM_000492.3:c.3710G>AVOUS09/17/2018
474CFTREx22NM_000492.3:c.3713A>Gp.Gln1238Arg | p.Q1238RLRG_663t1:c.3713A>G, NM_000492.3:c.3713A>GVOUS07/31/2019
475CFTREx22NM_000492.3:c.3717+40A>GLRG_663t1:c.3717+40A>G, NM_000492.3:c.3717+40A>GLikely pathogenic08/31/2017 
476CFTREx22NM_000492.3:c.3717+45G>ALRG_663t1:c.3717+45G>A, NM_000492.3:c.3717+45G>ABenign03/14/2019 
477CFTREx22NM_000492.3:c.3717+12191C>T3849+10kb C>T, LRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic05/12/2020 
478CFTREx23NM_000492.3:c.3718-2530A>GLRG_663t1:c.3718-2530A>G, NM_000492.3:c.3718-2530A>GBenign10/26/2016 
479CFTREx23NM_000492.3:c.3718-2477C>TLRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic05/08/2017 
480CFTREx23NM_000492.3:c.3718-24G>ALRG_663t1:c.3718-24G>A, NM_000492.3:c.3718-24G>AVOUS12/12/2018
481CFTREx23NM_000492.3:c.3723C>Ap.Gly1241= | p.G1241=LRG_663t1:c.3723C>A, NM_000492.3:c.3723C>AVOUS02/27/2020
482CFTREx23NM_000492.3:c.3744delAp.Lys1250Argfs*9 | p.K1250RfsX9LRG_663t1:c.3744delA, NM_000492.3:c.3744delAPathogenic10/02/2018 
483CFTREx23NM_000492.3:c.3747G>Ap.Gly1249= | p.G1249=LRG_663t1:c.3747G>A, NM_000492.3:c.3747G>AVOUS01/15/2015
484CFTREx23NM_000492.3:c.3761T>Gp.Leu1254* | p.L1254XPathogenic** 
485CFTREx23NM_000492.3:c.3762A>Gp.Leu1254= | p.L1254=LRG_663t1:c.3762A>G, NM_000492.3:c.3762A>GVOUS06/19/2019
486CFTREx23NM_000492.3:c.3764C>Ap.Ser1255* | p.S1255XPathogenic** 
487CFTREx23NM_000492.3:c.3772T>Cp.Leu1258= | p.L1258=LRG_663t1:c.3772T>C, NM_000492.3:c.3772T>CVOUS06/26/2017
488CFTREx23NM_000492.3:c.3794G>Tp.Gly1265Val | p.G1265VLRG_663t1:c.3794G>T, NM_000492.3:c.3794G>TVOUS06/08/2017
489CFTREx23NM_000492.3:c.3808G>Ap.Asp1270Asn | p.D1270NLRG_663t1:c.3808G>A, NM_000492.3:c.3808G>AVOUS05/22/2020
490CFTREx23NM_000492.3:c.3811G>Ap.Gly1271Ser | p.G1271SVOUS12/26/2019
491CFTREx23NM_000492.3:c.3815T>Ap.Val1272Glu | p.V1272ENM_000492.3:c.3815T>AVOUS04/23/2015
492CFTREx23NM_000492.3:c.3836T>Cp.Leu1279Ser | p.L1279SLRG_663t1:c.3836T>C, NM_000492.3:c.3836T>CVOUS04/04/2018
493CFTREx23NM_000492.3:c.3844T>Cp.Trp1282Arg | p.W1282RLRG_663t1:c.3844T>C, NM_000492.3:c.3844T>CPathogenic07/02/2020 
494CFTREx23NM_000492.3:c.3846G>Ap.Trp1282* | p.W1282XLRG_663t1:c.3846G>A, NM_000492.3:c.3846G>APathogenic12/05/2019 
495CFTREx23NM_000492.3:c.3846G>Cp.Trp1282Cys | p.W1282CLRG_663t1:c.3846G>C, NM_000492.3:c.3846G>CVOUS08/15/2018
496CFTREx23NM_000492.3:c.3852A>Gp.Lys1284= | p.K1284=LRG_663t1:c.3852A>G, NM_000492.3:c.3852A>GVOUS10/19/2017
497CFTREx23NM_000492.3:c.3853G>Ap.Ala1285Thr | p.A1285TLRG_663t1:c.3853G>A, NM_000492.3:c.3853G>AVOUS10/10/2017
498CFTREx23NM_000492.3:c.3854C>Tp.Ala1285Val | p.A1285VLRG_663t1:c.3854C>T, NM_000492.3:c.3854C>TVOUS02/01/2020
499CFTREx23NM_000492.3:c.3870A>Gp.Pro1290= | p.P1290=LRG_663t1:c.3870A>G, NM_000492.3:c.3870A>GBenign11/01/2018 
500CFTREx23NM_000492.3:c.3873+7A>TLRG_663t1:c.3873+7A>T, NM_000492.3:c.3873+7A>TVOUS09/20/2017
501CFTREx24NM_000492.3:c.3874-4522A>GLRG_663t1:c.3874-4522A>G, NM_000492.3:c.3874-4522A>GLikely pathogenic08/26/2019 
502CFTREx24NM_000492.3:c.3874-21_3874-15dupTTCTTTTLRG_663t1:c.3874-15_3874-14insTTCTTTT, LRG_663t1:c.3874-21_3874-15dupTTCTTTT, LRG_663t1:c.3874-21_3874-15insTTCTTTT, NM_000492.3:c.3874-15_3874-14insTTCTTTT, NM_000492.3:c.3874-21_3874-15dupTTCTTTT, NM_000492.3:c.3874-21_3874-15insTTCTTTTVOUS02/22/2017
503CFTREx24NM_000492.3:c.3874-14_3874-10delCTTTTLRG_663t1:c.3874-14_3874-10delCTTTT, NM_000492.3:c.3874-14_3874-10delCTTTTLikely benign11/27/2018 
504CFTREx24NM_000492.3:c.3874-14C>GVOUS12/10/2019
505CFTREx24NM_000492.3:c.3893G>Tp.Gly1298Val | p.G1298VLRG_663t1:c.3893G>T, NM_000492.3:c.3893G>TVOUS10/13/2017
506CFTREx24NM_000492.3:c.3895A>Gp.Thr1299Ala | p.T1299ALRG_663t1:c.3895A>G, NM_000492.3:c.3895A>GVOUS09/06/2018
507CFTREx24NM_000492.3:c.3897A>Gp.Thr1299= | p.T1299=LRG_663t1:c.3897A>G, NM_000492.3:c.3897A>GLikely benign01/11/2017 
508CFTREx24NM_000492.3:c.3909C>Gp.Asn1303Lys | p.N1303KLRG_663t1:c.3909C>G, NM_000492.3:c.3909C>GPathogenic09/17/2019 
509CFTREx24NM_000492.3:c.3918C>Gp.Pro1306= | p.P1306=LRG_663t1:c.3918C>G, NM_000492.3:c.3918C>GVOUS09/15/2020
510CFTREx24NM_000492.3:c.3925C>Gp.Gln1309Glu | p.Q1309ELRG_663t1:c.3925C>G, NM_000492.3:c.3925C>GVOUS06/04/2020
511CFTREx24NM_000492.3:c.3933T>Gp.Ser1311Arg | p.S1311RLRG_663t1:c.3933T>G, NM_000492.3:c.3933T>GVOUS09/27/2016
512CFTREx24NM_000492.3:c.3963+6G>TVOUS01/21/2020
513CFTREx25NM_000492.3:c.3964-16T>CNM_000492.3:c.3964-16T>CVOUS08/25/2014
514CFTREx25NM_000492.3:c.3983T>Cp.Ile1328Thr | p.I1328TLRG_663t1:c.3983T>C, NM_000492.3:c.3983T>CVOUS04/09/2019
515CFTREx25NM_000492.3:c.3999delGNM_000492.3:c.3999delGPathogenic09/04/2015 
516CFTREx25NM_000492.3:c.4036C>Tp.Leu1346= | p.L1346=LRG_663t1:c.4036C>T, NM_000492.3:c.4036C>TVOUS11/15/2017
517CFTREx25NM_000492.3:c.4045G>Ap.Gly1349Ser | p.G1349SLRG_663t1:c.4045G>A, NM_000492.3:c.4045G>AVOUS06/27/2017
518CFTREx25NM_000492.3:c.4053_4054delGCinsAGp.Gln1352Glu | p.Q1352ELRG_663t1:c.4053_4054delinsAG, NM_000492.3:c.4053_4054delinsAGVOUS09/21/2018
519CFTREx25NM_000492.3:c.4056G>Cp.Gln1352His | p.Q1352HLRG_663t1:c.4056G>C, NM_000492.3:c.4056G>CVOUS10/02/2020
520CFTREx25NM_000492.3:c.4058delTp.Leu1353* | p.L1353XLRG_663t1:c.4058delT, NM_000492.3:c.4058delTPathogenic02/23/2018 
521CFTREx25NM_000492.3:c.4077_4080delTGTTinsAAp.Val1360Thrfs*3 | p.V1360TfsX3LRG_663t1:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delinsAAPathogenic** 
522CFTREx25NM_000492.3:c.4092G>Ap.Ala1364= | p.A1364=LRG_663t1:c.4092G>A, NM_000492.3:c.4092G>AVOUS07/12/2019
523CFTREx25NM_000492.3:c.4097T>Cp.Ile1366Thr | p.I1366TLRG_663t1:c.4097T>C, NM_000492.3:c.4097T>CVOUS06/02/2020
524CFTREx25NM_000492.3:c.4121C>Gp.Ala1374Gly | p.A1374GLRG_663t1:c.4121C>G, NM_000492.3:c.4121C>GVOUS02/17/2017
525CFTREx25NM_000492.3:c.4123C>Ap.His1375Asn | p.H1375NLRG_663t1:c.4123C>A, NM_000492.3:c.4123C>AVOUS12/28/2017
526CFTREx25NM_000492.3:c.4129G>Cp.Asp1377His | p.D1377HLRG_663t1:c.4129G>C, NM_000492.3:c.4129G>CVOUS06/23/2016
527CFTREx26NM_000492.3:c.4159A>Gp.Thr1387Ala | p.T1387ALRG_663t1:c.4159A>G, NM_000492.3:c.4159A>GVOUS12/21/2017
528CFTREx26NM_000492.3:c.4195C>Gp.Leu1399Val | p.L1399VLRG_663t1:c.4195C>G, NM_000492.3:c.4195C>GVOUS05/11/2018
529CFTREx26NM_000492.3:c.4197_4198delCTp.Cys1400* | p.C1400XLRG_663t1:c.4197_4198delCT, NM_000492.3:c.4197_4198delCTPathogenic06/05/2020 
530CFTREx26NM_000492.3:c.4197C>Gp.Leu1399= | p.L1399=LRG_663t1:c.4197C>G, NM_000492.3:c.4197C>GVOUS03/19/2020
531CFTREx26NM_000492.3:c.4197C>Tp.Leu1399= | p.L1399=LRG_663t1:c.4197C>T, NM_000492.3:c.4197C>TVOUS09/30/2019
532CFTREx26NM_000492.3:c.4209G>Tp.Arg1403Ser | p.R1403SLRG_663t1:c.4209G>T, NM_000492.3:c.4209G>TVOUS05/28/2020
533CFTREx26NM_000492.3:c.4232A>Cp.Gln1411Pro | p.Q1411PLRG_663t1:c.4232A>C, NM_000492.3:c.4232A>CVOUS12/23/2019
534CFTREx26NM_000492.3:c.4241T>Cp.Leu1414Ser | p.L1414SLRG_663t1:c.4241T>C, NM_000492.3:c.4241T>CVOUS02/01/2018
535CFTREx26NM_000492.3:c.4242+10T>CLRG_663t1:c.4242+10T>C, NM_000492.3:c.4242+10T>CBenign05/24/2013 
536CFTREx26NM_000492.3:c.4242+13A>GBenign04/29/2013 
537CFTREx27NM_000492.3:c.*2G>ALRG_663t1:c.*2G>A, NM_000492.3:c.*2G>AVOUS04/16/2020
538CFTREx27NM_000492.3:c.*10T>ALRG_663t1:c.*10T>A, NM_000492.3:c.*10T>AVOUS04/01/2020
539CFTREx27NM_000492.3:c.*1043A>CLRG_663t1:c.*1043A>C, NM_000492.3:c.*1043A>CBenign03/28/2017 
540CFTREx27NM_000492.3:c.4243-20A>GLRG_663t1:c.4243-20A>G, NM_000492.3:c.4243-20A>GVOUS07/14/2020
541CFTREx27NM_000492.3:c.4243-5C>TLRG_663t1:c.4243-5C>T, NM_000492.3:c.4243-5C>TBenign08/25/2015 
542CFTREx27NM_000492.3:c.4251delAp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4251delA, NM_000492.3:c.4251delAPathogenic10/26/2017 
543CFTREx27NM_000492.3:c.4252delGp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4252delG, NM_000492.3:c.4252delGPathogenic12/21/2018 
544CFTREx27NM_000492.3:c.4272C>Tp.Tyr1424= | p.Y1424=LRG_663t1:c.4272C>T, NM_000492.3:c.4272C>TBenign11/14/2017 
545CFTREx27NM_000492.3:c.4296C>Tp.Asn1432= | p.N1432=LRG_663t1:c.4296C>T, NM_000492.3:c.4296C>TVOUS02/07/2020
546CFTREx27NM_000492.3:c.4322T>Cp.Ile1441Thr | p.I1441TNM_000492.3:c.4322T>CVOUS06/26/2015
547CFTREx27NM_000492.3:c.4332C>Tp.Ser1444= | p.S1444=LRG_663t1:c.4332C>T, NM_000492.3:c.4332C>TVOUS05/09/2017
548CFTREx27NM_000492.3:c.4333G>Ap.Asp1445Asn | p.D1445NLRG_663t1:c.4333G>A, NM_000492.3:c.4333G>AVOUS06/30/2020
549CFTREx27NM_000492.3:c.4348T>Ap.Phe1450Ile | p.F1450ILRG_663t1:c.4348T>A, NM_000492.3:c.4348T>AVOUS09/17/2020
550CFTREx27NM_000492.3:c.4357C>Tp.Arg1453Trp | p.R1453WLRG_663t1:c.4357C>T, NM_000492.3:c.4357C>TVOUS12/03/2019
551CFTREx27NM_000492.3:c.4358G>Ap.Arg1453Gln | p.R1453QLRG_663t1:c.4358G>A, NM_000492.3:c.4358G>AVOUS08/21/2019
552CFTREx27NM_000492.3:c.4383G>Tp.Lys1461Asn | p.K1461NLRG_663t1:c.4383G>T, NM_000492.3:c.4383G>TVOUS12/20/2017
553CFTREx27NM_000492.3:c.4387C>Tp.Gln1463* | p.Q1463XLRG_663t1:c.4387C>T, NM_000492.3:c.4387C>TVOUS08/15/2016
554CFTREx27NM_000492.3:c.4389G>Ap.Gln1463= | p.Q1463=LRG_663t1:c.4389G>A, NM_000492.3:c.4389G>ABenign11/20/2018 
555CFTREx27NM_000492.3:c.4417G>Ap.Glu1473Lys | p.E1473KLRG_663t1:c.4417G>A, NM_000492.3:c.4417G>AVOUS05/05/2017
556CFTREx27NM_000492.3:c.4426C>Tp.Gln1476* | p.Q1476XLRG_663t1:c.4426C>T, NM_000492.3:c.4426C>TPathogenic05/15/2018 
557CFTREx27NM_000492.3:c.4427A>Gp.Gln1476Arg | p.Q1476RLRG_663t1:c.4427A>G, NM_000492.3:c.4427A>GVOUS01/30/2020
558CFTREx27NM_000492.3:c.4436G>Ap.Arg1479Lys | p.R1479KLRG_663t1:c.4436G>A, NM_000492.3:c.4436G>AVOUS12/19/2019

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by EGL Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2020-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official EGL clinical report and should be approached with caution. Only variants identified at EGL are listed in the EmVClass. If you intend to use EGL's classification for publication purposes please contact the laboratory for permission.