Loading Data . . .

EmVClass

EGL's Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by EGL Genetics for that gene.
EGL Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CFTREx1NM_000492.3:c.-2C>GLRG_663t1:c.-2C>G, NM_000492.3:c.-2C>GVOUS06/28/2019
2CFTREx1NM_000492.3:c.-4G>CLRG_663t1:c.-4G>C, NM_000492.3:c.-4G>CLikely benign05/18/2015 
3CFTREx1NM_000492.3:c.-8G>CLRG_663t1:c.-8G>C, NM_000492.3:c.-8G>CBenign07/06/2017 
4CFTREx1NM_000492.3:c.10T>Cp.Ser4Pro | p.S4PLRG_663t1:c.10T>C, NM_000492.3:c.10T>CVOUS03/05/2019
5CFTREx1NM_000492.3:c.14C>Tp.Pro5Leu | p.P5LLRG_663t1:c.14C>T, NM_000492.3:c.14C>TLikely pathogenic11/20/2017 
6CFTREx1NM_000492.3:c.19G>Tp.Glu7* | p.E7XLRG_663t1:c.19G>T, NM_000492.3:c.19G>TPathogenic05/16/2016 
7CFTREx1NM_000492.3:c.40A>Gp.Lys14Glu | p.K14ELRG_663t1:c.40A>G, NM_000492.3:c.40A>GVOUS12/28/2017
8CFTREx1NM_000492.3:c.49_50dupTTp.Trp19Alafs*7 | p.W19AfsX7LRG_663t1:c.49_50dupTT, NM_000492.3:c.49_50dupTTPathogenic04/27/2018 
9CFTREx1NM_000492.3:c.53+9G>TVOUS10/03/2019
10CFTREx1NM_000492.3:c.53+45A>GLRG_663t1:c.53+45A>G, NM_000492.3:c.53+45A>GVOUS**
11CFTREx1NM_000492.3:c.-132-680T>GLRG_663t1:c.-812T>G, NM_000492.3:c.-812T>GLikely benign01/18/2017 
12CFTREx1NM_000492.3:c.-132-329A>GLRG_663t1:c.-461A>G, NM_000492.3:c.-461A>GVOUS04/29/2019
13CFTREx1NM_000492.3:c.-132-316A>GLRG_663t1:c.-448A>G, NM_000492.3:c.-448A>GVOUS05/24/2019
14CFTREx1NM_000492.3:c.-132-156G>AVOUS10/04/2019
15CFTREx1NM_000492.3:c.-132-156G>CLRG_663t1:c.-288G>C, NM_000492.3:c.-288G>CLikely benign03/20/2017 
16CFTREx1NM_000492.3:c.-132-94G>TLRG_663t1:c.-226G>T, NM_000492.3:c.-226G>TVOUS07/22/2019
17CFTREx1NM_000492.3:c.-132-33G>ALRG_663t1:c.-165G>A, NM_000492.3:c.-165G>AVOUS04/19/2018
18CFTREx1NM_000492.3:c.-132-20G>CLRG_663t1:c.-152G>C, NM_000492.3:c.-152G>CVOUS03/14/2019
19CFTREx1NM_000492.3:c.-132T>GLRG_663t1:c.-132T>G, NM_000492.3:c.-132T>GVOUS01/09/2017
20CFTREx2NM_000492.3:c.91C>Tp.Arg31Cys | p.R31CLRG_663t1:c.91C>T, NM_000492.3:c.91C>TVOUS11/06/2019
21CFTREx2NM_000492.3:c.92G>Tp.Arg31Leu | p.R31LLRG_663t1:c.92G>T, NM_000492.3:c.92G>TVOUS06/07/2018
22CFTREx2NM_000492.3:c.94C>Ap.Leu32Met | p.L32MLRG_663t1:c.94C>A, NM_000492.3:c.94C>AVOUS06/15/2017
23CFTREx2NM_000492.3:c.109A>Gp.Ile37Val | p.I37VLRG_663t1:c.109A>G, NM_000492.3:c.109A>GVOUS03/15/2018
24CFTREx2NM_000492.3:c.125C>Tp.Ser42Phe | p.S42FLRG_663t1:c.125C>T, NM_000492.3:c.125C>TVOUS06/29/2018
25CFTREx2NM_000492.3:c.137C>Tp.Ala46Val | p.A46VLRG_663t1:c.137C>T, NM_000492.3:c.137C>TVOUS09/04/2018
26CFTREx2NM_000492.3:c.164+9A>GLRG_663t1:c.164+9A>G, NM_000492.3:c.164+9A>GVOUS12/26/2018
27CFTREx2NM_000492.3:c.164+10delTinsATGALRG_663t1:c.164+10delinsATGA, NM_000492.3:c.164+10delinsATGAVOUS**
28CFTREx2NM_000492.3:c.164+12T>CLRG_663t1:c.164+12T>C, NM_000492.3:c.164+12T>CVOUS10/26/2018
29CFTREx2NM_000492.3:c.164+28A>GLRG_663t1:c.164+28A>G, NM_000492.3:c.164+28A>GBenign11/20/2018 
30CFTREx3NM_000492.3:c.165-3C>TLRG_663t1:c.165-3C>T, NM_000492.3:c.165-3C>TPathogenic12/31/2018 
31CFTREx3NM_000492.3:c.165-1G>ALRG_663t1:c.165-1G>A, NM_000492.3:c.165-1G>APathogenic01/19/2016 
32CFTREx3NM_000492.3:c.180G>Cp.Glu60Asp | p.E60DLRG_663t1:c.180G>C, NM_000492.3:c.180G>CVOUS01/11/2018
33CFTREx3NM_000492.3:c.181C>Tp.Leu61= | p.L61=LRG_663t1:c.181C>T, NM_000492.3:c.181C>TVOUS12/11/2018
34CFTREx3NM_000492.3:c.200C>Tp.Pro67Leu | p.P67LLRG_663t1:c.200C>TPathogenic07/09/2018 
35CFTREx3NM_000492.3:c.202A>Gp.Lys68Glu | p.K68ELRG_663t1:c.202A>G, NM_000492.3:c.202A>GVOUS08/21/2018
36CFTREx3NM_000492.3:c.204A>Tp.Lys68Asn | p.K68NLRG_663t1:c.204A>T, NM_000492.3:c.204A>TVOUS10/22/2019
37CFTREx3NM_000492.3:c.220C>Tp.Arg74Trp | p.R74WLRG_663t1:c.220C>T, NM_000492.3:c.220C>TLikely pathogenic11/12/2019 
38CFTREx3NM_000492.3:c.221G>Ap.Arg74Gln | p.R74QLRG_663t1:c.221G>A, NM_000492.3:c.221G>AVOUS07/19/2017
39CFTREx3NM_000492.3:c.224G>Ap.Arg75Gln | p.R75QLRG_663t1:c.224G>A, NM_000492.3:c.224G>ALikely benign10/20/2017 
40CFTREx3NM_000492.3:c.226T>Ap.Cys76Ser | p.C76SLRG_663t1:c.226T>A, NM_000492.3:c.226T>AVOUS09/06/2016
41CFTREx3NM_000492.3:c.233dupTp.Trp79Leufs*32 | p.W79LfsX32LRG_663t1:c.233dupT, NM_000492.3:c.233dupTPathogenic10/10/2018 
42CFTREx3NM_000492.3:c.246G>Ap.Met82Ile | p.M82ILRG_663t1:c.246G>A, NM_000492.3:c.246G>AVOUS03/22/2019
43CFTREx3NM_000492.3:c.250T>Cp.Tyr84His | p.Y84HLRG_663t1:c.250T>C, NM_000492.3:c.250T>CVOUS01/26/2017
44CFTREx3NM_000492.3:c.254G>Ap.Gly85Glu | p.G85ELRG_663t1:c.254G>A, NM_000492.3:c.254G>APathogenic02/07/2017 
45CFTREx3NM_000492.3:c.256A>Gp.Ile86Val | p.I86VLRG_663t1:c.256A>G, NM_000492.3:c.256A>GVOUS09/30/2019
46CFTREx3NM_000492.3:c.262_263delTTp.Leu88Ilefs*22 | p.L88IfsX22LRG_663t1:c.262_263delTT, NM_000492.3:c.262_263delTTPathogenic** 
47CFTREx4NM_000492.3:c.274-6T>CLRG_663t1:c.274-6T>C, NM_000492.3:c.274-6T>CVOUS04/19/2019
48CFTREx4NM_000492.3:c.274-1G>ALRG_663t1:c.274-1G>A, NM_000492.3:c.274-1G>APathogenic06/24/2014 
49CFTREx4NM_000492.3:c.290T>Cp.Val97Ala | p.V97AVOUS**
50CFTREx4NM_000492.3:c.316A>Gp.Ile106Val | p.I106VLRG_663t1:c.316A>G, NM_000492.3:c.316A>GVOUS10/05/2016
51CFTREx4NM_000492.3:c.326A>Gp.Tyr109Cys | p.Y109CLRG_663t1:c.326A>G, NM_000492.3:c.326A>GLikely pathogenic02/08/2019 
52CFTREx4NM_000492.3:c.328G>Cp.Asp110His | p.D110HLRG_663t1:c.328G>C, NM_000492.3:c.328G>CPathogenic12/06/2018 
53CFTREx4NM_000492.3:c.328G>Tp.Asp110Tyr | p.D110YLRG_663t1:c.328G>T, NM_000492.3:c.328G>TPathogenic** 
54CFTREx4NM_000492.3:c.330C>Ap.Asp110Glu | p.D110ELRG_663t1:c.330C>A, NM_000492.3:c.330C>APathogenic05/23/2017 
55CFTREx4NM_000492.3:c.332C>Tp.Pro111Leu | p.P111LLRG_663t1:c.332C>T, NM_000492.3:c.332C>TVOUS08/07/2019
56CFTREx4NM_000492.3:c.332C>Gp.Pro111Arg | p.P111RLRG_663t1:c.332C>G, NM_000492.3:c.332C>GVOUS08/02/2016
57CFTREx4NM_000492.3:c.335A>Gp.Asp112Gly | p.D112GLRG_663t1:c.335A>G, NM_000492.3:c.335A>GVOUS11/01/2019
58CFTREx4NM_000492.3:c.349C>Tp.Arg117Cys | p.R117CLRG_663t1:c.349C>T, NM_000492.3:c.349C>TPathogenic12/06/2017 
59CFTREx4NM_000492.3:c.350G>Ap.Arg117His | p.R117HLRG_663t1:c.350G>A, NM_000492.3:c.350G>APathogenic05/24/2019 
60CFTREx4NM_000492.3:c.350G>Tp.Arg117Leu | p.R117LLRG_663t1:c.350G>T, NM_000492.3:c.350G>TPathogenic** 
61CFTREx4NM_000492.3:c.358G>Ap.Ala120Thr | p.A120TLRG_663t1:c.358G>A, NM_000492.3:c.358G>AVOUS11/14/2018
62CFTREx4NM_000492.3:c.360G>Ap.Ala120= | p.A120=LRG_663t1:c.360G>A, NM_000492.3:c.360G>AVOUS08/22/2019
63CFTREx4NM_000492.3:c.374T>Cp.Ile125Thr | p.I125TLRG_663t1:c.374T>C, NM_000492.3:c.374T>CLikely benign03/13/2017 
64CFTREx4NM_000492.3:c.377G>Tp.Gly126Val | p.G126VLRG_663t1:c.377G>T, NM_000492.3:c.377G>TVOUS05/25/2018
65CFTREx4NM_000492.3:c.393T>Cp.Phe131= | p.F131=LRG_663t1:c.393T>C, NM_000492.3:c.393T>CVOUS08/30/2018
66CFTREx4NM_000492.3:c.403A>Gp.Thr135Ala | p.T135ALRG_663t1:c.403A>G, NM_000492.3:c.403A>GVOUS12/13/2017
67CFTREx4NM_000492.3:c.416A>Cp.His139Pro | p.H139PLRG_663t1:c.416A>C, NM_000492.3:c.416A>CVOUS03/30/2018
68CFTREx4NM_000492.3:c.418C>Tp.Pro140Ser | p.P140SLRG_663t1:c.418C>T, NM_000492.3:c.418C>TVOUS01/21/2019
69CFTREx4NM_000492.3:c.442delAp.Ile148Leufs*5 | p.I148LfsX5LRG_663t1:c.442delA, NM_000492.3:c.442delAPathogenic09/22/2017 
70CFTREx4NM_000492.3:c.443T>Cp.Ile148Thr | p.I148TLRG_663t1:c.443T>C, NM_000492.3:c.443T>CBenign08/06/2012 
71CFTREx4NM_000492.3:c.443T>Ap.Ile148Asn | p.I148NLRG_663t1:c.443T>A, NM_000492.3:c.443T>AVOUS02/27/2017
72CFTREx4NM_000492.3:c.451C>Ap.Gln151Lys | p.Q151KLRG_663t1:c.451C>A, NM_000492.3:c.451C>AVOUS07/14/2019
73CFTREx4NM_000492.3:c.454A>Tp.Met152Leu | p.M152LLRG_663t1:c.454A>T, NM_000492.3:c.454A>TVOUS01/09/2019
74CFTREx4NM_000492.3:c.489+1G>T 621+1G->T, LRG_663t1:c.489+1G>T, NM_000492.3:c.489+1G>TPathogenic11/24/2018 
75CFTREx4NM_000492.3:c.489+3A>GLRG_663t1:c.489+3A>G, NM_000492.3:c.489+3A>GVOUS10/18/2019
76CFTREx4NM_000492.3:c.489+8T>GLRG_663t1:c.489+8T>G, NM_000492.3:c.489+8T>GVOUS02/20/2018
77CFTREx4NM_000492.3:c.489+87A>GLRG_663t1:c.489+87A>G, NM_000492.3:c.489+87A>GVOUS02/15/2018
78CFTREx5NM_000492.3:c.509G>Ap.Arg170His | p.R170HLRG_663t1:c.509G>A, NM_000492.3:c.509G>AVOUS08/29/2019
79CFTREx5NM_000492.3:c.530T>Cp.Ile177Thr | p.I177TLRG_663t1:c.530T>C, NM_000492.3:c.530T>CVOUS11/07/2018
80CFTREx5NM_000492.3:c.538C>Gp.Leu180Val | p.L180VLRG_663t1:c.538C>G, NM_000492.3:c.538C>GVOUS04/08/2019
81CFTREx5NM_000492.3:c.547C>Ap.Leu183Ile | p.L183ILRG_663t1:c.547C>A, NM_000492.3:c.547C>AVOUS03/26/2019
82CFTREx5NM_000492.3:c.561C>Tp.Asn187= | p.N187=LRG_663t1:c.561C>T, NM_000492.3:c.561C>TVOUS06/26/2018
83CFTREx5NM_000492.3:c.571T>Gp.Phe191Val | p.F191VLRG_663t1:c.571T>G, NM_000492.3:c.571T>GLikely pathogenic04/21/2017 
84CFTREx5NM_000492.3:c.577G>Tp.Glu193* | p.E193XNM_000492.3:c.577G>TPathogenic08/18/2014 
85CFTREx5NM_000492.3:c.579+1G>TLRG_663t1:c.579+1G>T, NM_000492.3:c.579+1G>TPathogenic05/19/2016 
86CFTREx5NM_000492.3:c.579+4delTVOUS**
87CFTREx6NM_000492.3:c.581G>Tp.Gly194Val | p.G194VLRG_663t1:c.581G>T, NM_000492.3:c.581G>TVOUS11/07/2017
88CFTREx6NM_000492.3:c.592G>Cp.Ala198Pro | p.A198PLRG_663t1:c.592G>C, NM_000492.3:c.592G>CVOUS03/14/2016
89CFTREx6NM_000492.3:c.592G>Ap.Ala198Thr | p.A198TLRG_663t1:c.592G>A, NM_000492.3:c.592G>AVOUS01/27/2017
90CFTREx6NM_000492.3:c.601G>Ap.Val201Met | p.V201MLRG_663t1:c.601G>A, NM_000492.3:c.601G>AVOUS02/07/2018
91CFTREx6NM_000492.3:c.613C>Tp.Pro205Ser | p.P205SLRG_663t1:c.613C>T, NM_000492.3:c.613C>TPathogenic03/12/2019 
92CFTREx6NM_000492.3:c.617T>Gp.Leu206Trp | p.L206WLRG_663t1:c.617T>G, NM_000492.3:c.617T>GPathogenic05/17/2019 
93CFTREx6NM_000492.3:c.648G>Tp.Trp216Cys | p.W216CLRG_663t1:c.648G>T, NM_000492.3:c.648G>TVOUS06/12/2018
94CFTREx6NM_000492.3:c.650A>Gp.Glu217Gly | p.E217GLRG_663t1:c.650A>G, NM_000492.3:c.650A>GVOUS07/10/2018
95CFTREx6NM_000492.3:c.663G>Ap.Ala221= | p.A221=LRG_663t1:c.663G>A, NM_000492.3:c.663G>AVOUS08/25/2016
96CFTREx6NM_000492.3:c.688C>Tp.Leu230= | p.L230=LRG_663t1:c.688C>T, NM_000492.3:c.688C>TVOUS04/17/2018
97CFTREx6NM_000492.3:c.695T>Ap.Val232Asp | p.V232DLRG_663t1:c.695T>A, NM_000492.3:c.695T>APathogenic04/04/2018 
98CFTREx6NM_000492.3:c.708delTPathogenic** 
99CFTREx6NM_000492.3:c.709C>Gp.Gln237Glu | p.Q237ELRG_663t1:c.709C>G, NM_000492.3:c.709C>GLikely pathogenic01/08/2019 
100CFTREx6NM_000492.3:c.710A>Tp.Gln237Leu | p.Q237LLRG_663t1:c.710A>T, NM_000492.3:c.710A>TVOUS01/08/2019
101CFTREx6NM_000492.3:c.710A>Gp.Gln237Arg | p.Q237RLRG_663t1:c.710A>G, NM_000492.3:c.710A>GVOUS01/08/2019
102CFTREx6NM_000492.3:c.711G>Cp.Gln237His | p.Q237HLRG_663t1:c.711G>C, NM_000492.3:c.711G>CVOUS01/08/2019
103CFTREx6NM_000492.3:c.711G>Tp.Gln237His | p.Q237HLRG_663t1:c.711G>T, NM_000492.3:c.711G>TVOUS12/28/2018
104CFTREx6NM_000492.3:c.715G>Ap.Gly239Arg | p.G239RLRG_663t1:c.715G>A, NM_000492.3:c.715G>AVOUS10/04/2019
105CFTREx6NM_000492.3:c.738G>Ap.Lys246= | p.K246=LRG_663t1:c.738G>A, NM_000492.3:c.738G>ALikely benign12/07/2016 
106CFTREx6NM_000492.3:c.743+1G>ALRG_663t1:c.743+1G>A, NM_000492.3:c.743+1G>APathogenic07/06/2016 
107CFTREx6NM_000492.3:c.743+40A>GNM_000492.3:c.743+40A>GBenign** 
108CFTREx7NM_000492.3:c.744-33GATT(6_9)Benign11/20/2018 
109CFTREx7NM_000492.3:c.744-9_744-6dupGATTLRG_663t1:c.744-9_744-6dupGATT, NM_000492.3:c.744-9_744-6dupGATTBenign06/23/2017 
110CFTREx7NM_000492.3:c.772A>Gp.Arg258Gly | p.R258GLRG_663t1:c.772A>G, NM_000492.3:c.772A>GVOUS10/02/2019
111CFTREx7NM_000492.3:c.794T>Gp.Met265Arg | p.M265RLRG_663t1:c.794T>G, NM_000492.3:c.794T>GVOUS02/11/2019
112CFTREx7NM_000492.3:c.803delAp.Asn268Ilefs*17 | p.N268IfsX17LRG_663t1:c.803delA, NM_000492.3:c.803delAPathogenic07/25/2019 
113CFTREx7NM_000492.3:c.806T>Cp.Ile269Thr | p.I269TLRG_663t1:c.806T>C, NM_000492.3:c.806T>CVOUS08/22/2017
114CFTREx7NM_000492.3:c.837A>Tp.Glu279Asp | p.E279DLRG_663t1:c.837A>T, NM_000492.3:c.837A>TVOUS03/27/2017
115CFTREx7NM_000492.3:c.842T>Cp.Met281Thr | p.M281TLRG_663t1:c.842T>C, NM_000492.3:c.842T>CVOUS08/19/2019
116CFTREx7NM_000492.3:c.846A>Tp.Glu282Asp | p.E282DLRG_663t1:c.846A>T, NM_000492.3:c.846A>TVOUS05/23/2018
117CFTREx7NM_000492.3:c.848_860delAAATGATTGAAAAinsTGNM_000492.3:c.848_860delinsTGPathogenic10/27/2014 
118CFTREx7NM_000492.3:c.850dupALRG_663t1:c.850_851insA, NM_000492.3:c.850_851insAPathogenic03/28/2016 
119CFTREx7NM_000492.3:c.853A>Tp.Ile285Phe | p.I285FLRG_663t1:c.853A>T, NM_000492.3:c.853A>TLikely benign06/23/2017 
120CFTREx7NM_000492.3:c.861C>Gp.Asn287Lys | p.N287KLRG_663t1:c.861C>G, NM_000492.3:c.861C>GVOUS09/25/2018
121CFTREx7NM_000492.3:c.869+1G>CLRG_663t1:c.869+1G>C, NM_000492.3:c.869+1G>CPathogenic06/14/2018 
122CFTREx7NM_000492.3:c.869+11C>TLRG_663t1:c.869+11C>T, NM_000492.3:c.869+11C>TBenign05/19/2016 
123CFTREx7NM_000492.3:c.869+40A>GNM_000492.3:c.869+40A>GBenign** 
124CFTREx8NM_000492.3:c.870-7_870-5delTTTLRG_663t1:c.870-7_870-5delTTT, NM_000492.3:c.870-7_870-5delTTTLikely benign05/30/2017 
125CFTREx8NM_000492.3:c.889C>Tp.Arg297Trp | p.R297WLRG_663t1:c.889C>T, NM_000492.3:c.889C>TVOUS03/29/2019
126CFTREx8NM_000492.3:c.890G>Ap.Arg297Gln | p.R297QLRG_663t1:c.890G>A, NM_000492.3:c.890G>ALikely benign09/26/2014 
127CFTREx8NM_000492.3:c.902A>Gp.Tyr301Cys | p.Y301CLRG_663t1:c.902A>G, NM_000492.3:c.902A>GVOUS09/03/2019
128CFTREx8NM_000492.3:c.925G>Tp.Ala309Ser | p.A309SLRG_663t1:c.925G>T, NM_000492.3:c.925G>TVOUS02/07/2019
129CFTREx8NM_000492.3:c.926C>Gp.Ala309Gly | p.A309GLRG_663t1:c.926C>G, NM_000492.3:c.926C>GVOUS11/14/2017
130CFTREx8NM_000492.3:c.935_937delTCTp.Phe312del | p.F312delLRG_663t1:c.935_937delTCT, NM_000492.3:c.935_937delTCTPathogenic11/19/2013 
131CFTREx8NM_000492.3:c.944T>Cp.Phe315Ser | p.F315SLRG_663t1:c.944T>C, NM_000492.3:c.944T>CVOUS09/15/2017
132CFTREx8NM_000492.3:c.948delTp.Phe316Leufs*12 | p.F316LfsX12LRG_663t1:c.948delT, NM_000492.3:c.948delTPathogenic08/15/2017 
133CFTREx8NM_000492.3:c.948T>Gp.Phe316Leu | p.F316LLRG_663t1:c.948T>G, NM_000492.3:c.948T>GVOUS11/09/2017
134CFTREx8NM_000492.3:c.958T>Gp.Leu320Val | p.L320VLRG_663t1:c.958T>G, NM_000492.3:c.958T>GVOUS04/23/2019
135CFTREx8NM_000492.3:c.960A>Gp.Leu320= | p.L320=LRG_663t1:c.960A>G, NM_000492.3:c.960A>GVOUS06/18/2019
136CFTREx8NM_000492.3:c.974A>Gp.Tyr325Cys | p.Y325CLRG_663t1:c.974A>G, NM_000492.3:c.974A>GVOUS09/13/2018
137CFTREx8NM_000492.3:c.1000C>Tp.Arg334Trp | p.R334WLRG_663t1:c.1000C>T, NM_000492.3:c.1000C>TPathogenic** 
138CFTREx8NM_000492.3:c.1001G>Ap.Arg334Gln | p.R334QLRG_663t1:c.1001G>A, NM_000492.3:c.1001G>AVOUS12/24/2018
139CFTREx8NM_000492.3:c.1007T>Ap.Ile336Lys | p.I336KLRG_663t1:c.1007T>A, NM_000492.3:c.1007T>APathogenic03/15/2017 
140CFTREx8NM_000492.3:c.1021T>Cp.Ser341Pro | p.S341PLRG_663t1:c.1021T>C, NM_000492.3:c.1021T>CPathogenic10/10/2016 
141CFTREx8NM_000492.3:c.1022_1023insTC1157InsTC, NM_000492.3:c.1022_1023insTCPathogenic07/10/2014 
142CFTREx8NM_000492.3:c.1039C>Tp.Arg347Cys | p.R347CLRG_663t1:c.1039C>T, NM_000492.3:c.1039C>TVOUS09/27/2017
143CFTREx8NM_000492.3:c.1040G>Cp.Arg347Pro | p.R347PLRG_663t1:c.1040G>C, NM_000492.3:c.1040G>CPathogenic10/17/2018 
144CFTREx8NM_000492.3:c.1043T>Ap.Met348Lys | p.M348KLRG_663t1:c.1043T>A, NM_000492.3:c.1043T>AVOUS09/16/2016
145CFTREx8NM_000492.3:c.1046C>Tp.Ala349Val | p.A349VLRG_663t1:c.1046C>T, NM_000492.3:c.1046C>TVOUS11/12/2019
146CFTREx8NM_000492.3:c.1047G>Ap.Ala349= | p.A349=LRG_663t1:c.1047G>A, NM_000492.3:c.1047G>AVOUS12/15/2017
147CFTREx8NM_000492.3:c.1052C>Gp.Thr351Ser | p.T351SLRG_663t1:c.1052C>G, NM_000492.3:c.1052C>GVOUS11/05/2019
148CFTREx8NM_000492.3:c.1054C>Tp.Arg352Trp | p.R352WLRG_663t1:c.1054C>T, NM_000492.3:c.1054C>TVOUS05/31/2019
149CFTREx8NM_000492.3:c.1055G>Ap.Arg352Gln | p.R352QLRG_663t1:c.1055G>A, NM_000492.3:c.1055G>APathogenic** 
150CFTREx8NM_000492.3:c.1066_1072delTGGGCTGinsANM_000492.3:c.1066_1072delinsAVOUS05/29/2015
151CFTREx8NM_000492.3:c.1083delGp.Trp361Cysfs*8 | p.W361CfsX8LRG_663t1:c.1083delG, NM_000492.3:c.1083delGPathogenic04/18/2017 
152CFTREx8NM_000492.3:c.1116+6G>CLRG_663t1:c.1116+6G>C, NM_000492.3:c.1116+6G>CVOUS03/21/2017
153CFTREx9NM_000492.3:c.1118A>Tp.Asp373Val | p.D373VLRG_663t1:c.1118A>T, NM_000492.3:c.1118A>TVOUS08/21/2019
154CFTREx9NM_000492.3:c.1125A>Cp.Leu375Phe | p.L375FLRG_663t1:c.1125A>C, NM_000492.3:c.1125A>CLikely pathogenic09/18/2019 
155CFTREx9NM_000492.3:c.1149G>Ap.Leu383= | p.L383=LRG_663t1:c.1149G>A, NM_000492.3:c.1149G>AVOUS10/09/2017
156CFTREx9NM_000492.3:c.1163C>Tp.Thr388Met | p.T388MLRG_663t1:c.1163C>T, NM_000492.3:c.1163C>TVOUS07/24/2019
157CFTREx9NM_000492.3:c.1164G>Ap.Thr388= | p.T388=LRG_663t1:c.1164G>A, NM_000492.3:c.1164G>AVOUS05/19/2017
158CFTREx10NM_000492.3:c.1210-32T>GLRG_663t1:c.1210-32T>G, NM_000492.3:c.1210-32T>GVOUS09/23/2016
159CFTREx10NM_000492.3:c.1210-15G>TLRG_663t1:c.1210-15G>T, NM_000492.3:c.1210-15G>TVOUS06/26/2017
160CFTREx10NM_000492.3:c.1210-14_1210-13insTGLRG_663t1:c.1210-14_1210-13insTG, NM_000492.3:c.1210-14_1210-13insTGBenign07/02/2014 
161CFTREx10NM_000492.3:c.1210-13GT(10_12)Benign** 
162CFTREx10NM_000492.3:c.1210-13G>TNM_000492.3:c.1210-13G>TBenign01/31/2014 
163CFTREx10NM_000492.3:c.1210-13_1210-10delGTTTLRG_663t1:c.1210-13_1210-10delGTTT, NM_000492.3:c.1210-13_1210-10delGTTTVOUS09/23/2016
164CFTREx10NM_000492.3:c.1210-12T(5_9)Other Reportable03/05/2019 
165CFTREx10NM_000492.3:c.1210-11T>GLRG_663t1:c.1210-11T>G, NM_000492.3:c.1210-11T>GOther Reportable05/19/2016 
166CFTREx10NM_000492.3:c.1210-7_1210-6delTTLRG_663t1:c.1210-7_1210-6delTT, NM_000492.3:c.1210-7_1210-6delTTOther Reportable05/06/2019 
167CFTREx10NM_000492.3:c.1210-7_1210-6dupTTLRG_663t1:c.1210-7_1210-6dupTT, NM_000492.3:c.1210-6_1210-5insTT, NM_000492.3:c.1210-7_1210-6dupTTBenign09/29/2014 
168CFTREx10NM_000492.3:c.1210-2_1210-1delAGLRG_663t1:c.1210-2_1210-1delAG, NM_000492.3:c.1210-2_1210-1delAGPathogenic10/04/2019 
169CFTREx10NM_000492.3:c.1227T>Cp.Phe409= | p.F409=LRG_663t1:c.1227T>C, NM_000492.3:c.1227T>CVOUS03/29/2019
170CFTREx10NM_000492.3:c.1231A>Gp.Lys411Glu | p.K411ELRG_663t1:c.1231A>G, NM_000492.3:c.1231A>GVOUS04/19/2019
171CFTREx10NM_000492.3:c.1234_1238delGCAAALRG_663t1:c.1234_1238delGCAAA, NM_000492.3:c.1234_1238delGCAAAPathogenic09/22/2016 
172CFTREx10NM_000492.3:c.1251C>Ap.Asn417Lys | p.N417KLRG_663t1:c.1251C>A, NM_000492.3:c.1251C>ABenign03/21/2015 
173CFTREx10NM_000492.3:c.1254T>Cp.Asn418= | p.N418=NM_000492.3:c.1254T>CBenign08/19/2014 
174CFTREx10NM_000492.3:c.1270G>Ap.Gly424Ser | p.G424SLRG_663t1:c.1270G>A, NM_000492.3:c.1270G>AVOUS04/18/2019
175CFTREx10NM_000492.3:c.1301_1307delCACTTCTPathogenic** 
176CFTREx10NM_000492.3:c.1312A>Gp.Thr438Ala | p.T438ALRG_663t1:c.1312A>G, NM_000492.3:c.1312A>GVOUS08/31/2018
177CFTREx10NM_000492.3:c.1327G>Tp.Asp443Tyr | p.D443YLRG_663t1:c.1327G>T, NM_000492.3:c.1327G>TPathogenic12/05/2018 
178CFTREx10NM_000492.3:c.1327_1330dupGATAp.Ile444Argfs*3 | p.I444RfsX3LRG_663t1:c.1327_1330dupGATA, NM_000492.3:c.1327_1330dupGATAPathogenic11/08/2019 
179CFTREx10NM_000492.3:c.1331T>Cp.Ile444Thr | p.I444TLRG_663t1:c.1331T>C, NM_000492.3:c.1331T>CVOUS12/21/2017
180CFTREx10NM_000492.3:c.1340delANM_000492.3:c.1340delAPathogenic** 
181CFTREx10NM_000492.3:c.1343T>Ap.Ile448Lys | p.I448KVOUS**
182CFTREx10NM_000492.3:c.1360_1362delTTGLRG_663t1:c.1360_1362delTTG, NM_000492.3:c.1360_1362delTTGLikely benign01/11/2017 
183CFTREx10NM_000492.3:c.1364C>Ap.Ala455Glu | p.A455ELRG_663t1:c.1364C>A, NM_000492.3:c.1364C>APathogenic** 
184CFTREx10NM_000492.3:c.1364C>Tp.Ala455Val | p.A455VLRG_663t1:c.1364C>T, NM_000492.3:c.1364C>TVOUS06/13/2019
185CFTREx10NM_000492.3:c.1365G>Tp.Ala455= | p.A455=LRG_663t1:c.1365G>T, NM_000492.3:c.1365G>TVOUS01/12/2016
186CFTREx10NM_000492.3:c.1365G>Ap.Ala455= | p.A455=LRG_663t1:c.1365G>A, NM_000492.3:c.1365G>AVOUS08/02/2019
187CFTREx10NM_000492.3:c.1367T>Cp.Val456Ala | p.V456ALRG_663t1:c.1367T>C, NM_000492.3:c.1367T>CPathogenic07/26/2019 
188CFTREx11NM_000492.3:c.1393-42G>ALRG_663t1:c.1393-42G>A, NM_000492.3:c.1393-42G>ABenign01/19/2017 
189CFTREx11NM_000492.3:c.1397C>Gp.Ser466* | p.S466XLRG_663t1:c.1397C>G, NM_000492.3:c.1397C>GPathogenic02/24/2017 
190CFTREx11NM_000492.3:c.1400T>Cp.Leu467Pro | p.L467PLRG_663t1:c.1400T>C, NM_000492.3:c.1400T>CPathogenic04/24/2017 
191CFTREx11NM_000492.3:c.1408A>Gp.Met470Val | p.M470VLRG_663t1:c.1408A>G, NM_000492.3:c.1408A>GBenign04/13/2017 
192CFTREx11NM_000492.3:c.1408G>Ap.Val470Met | p.V470MLRG_663t1:c.1408G>A, NM_000492.3:c.1408G>ABenign11/20/2018 
193CFTREx11NM_000492.3:c.1414A>Gp.Met472Val | p.M472VLRG_663t1:c.1414A>G, NM_000492.3:c.1414A>GVOUS11/05/2019
194CFTREx11NM_000492.3:c.1430C>Ap.Pro477His | p.P477HLRG_663t1:c.1430C>A, NM_000492.3:c.1430C>AVOUS07/28/2016
195CFTREx11NM_000492.3:c.1436A>Cp.Glu479Ala | p.E479ALRG_663t1:c.1436A>C, NM_000492.3:c.1436A>CVOUS04/07/2016
196CFTREx11NM_000492.3:c.1438G>Tp.Gly480Cys | p.G480CLRG_663t1:c.1438G>T, NM_000492.3:c.1438G>TPathogenic09/30/2013 
197CFTREx11NM_000492.3:c.1446T>Ap.Ile482= | p.I482=LRG_663t1:c.1446T>A, NM_000492.3:c.1446T>AVOUS04/27/2018
198CFTREx11NM_000492.3:c.1450C>Tp.His484Tyr | p.H484YLRG_663t1:c.1450C>T, NM_000492.3:c.1450C>TVOUS05/08/2017
199CFTREx11NM_000492.3:c.1454G>Cp.Ser485Thr | p.S485TLRG_663t1:c.1454G>C, NM_000492.3:c.1454G>CVOUS02/18/2019
200CFTREx11NM_000492.3:c.1477C>Tp.Gln493* | p.Q493XLRG_663t1:c.1477C>T, NM_000492.3:c.1477C>TPathogenic08/15/2018 
201CFTREx11NM_000492.3:c.1479G>Cp.Gln493His | p.Q493HLRG_663t1:c.1479G>C, NM_000492.3:c.1479G>CVOUS11/04/2016
202CFTREx11NM_000492.3:c.1499G>Ap.Gly500Asp | p.G500DLRG_663t1:c.1499G>A, NM_000492.3:c.1499G>AVOUS08/12/2016
203CFTREx11NM_000492.3:c.1516A>Gp.Ile506Val | p.I506VLRG_663t1:c.1516A>G, NM_000492.3:c.1516A>GBenign07/06/2016 
204CFTREx11NM_000492.3:c.1517T>Cp.Ile506Thr | p.I506TLRG_663t1:c.1517T>C, NM_000492.3:c.1517T>CLikely pathogenic07/30/2018 
205CFTREx11NM_000492.3:c.1519_1521delATCp.Ile507del | p.I507delLRG_663t1:c.1519_1521delATC, NM_000492.3:c.1519_1521delATCPathogenic11/30/2018 
206CFTREx11NM_000492.3:c.1521_1523delCTTp.Phe508del | p.F508deldelF508, DeltaF508, dF508, LRG_663t1:c.1521_1523delCTT, NM_000492.3:c.1521_1523delCTTPathogenic09/17/2019 
207CFTREx11NM_000492.3:c.1523T>Gp.Phe508Cys | p.F508CLRG_663t1:c.1523T>G, NM_000492.3:c.1523T>GBenign04/14/2016 
208CFTREx11NM_000492.3:c.1534T>Ap.Tyr512Asn | p.Y512NLRG_663t1:c.1534T>A, NM_000492.3:c.1534T>AVOUS11/15/2017
209CFTREx11NM_000492.3:c.1552A>Gp.Arg518Gly | p.R518GLRG_663t1:c.1552A>G, NM_000492.3:c.1552A>GVOUS04/26/2018
210CFTREx11NM_000492.3:c.1558G>Ap.Val520Ile | p.V520ILRG_663t1:c.1558G>A, NM_000492.3:c.1558G>AVOUS08/05/2019
211CFTREx11NM_000492.3:c.1582G>Ap.Glu528Lys | p.E528KLRG_663t1:c.1582G>A, NM_000492.3:c.1582G>AVOUS05/21/2018
212CFTREx11NM_000492.3:c.1584G>Tp.Glu528Asp | p.E528DLRG_663t1:c.1584G>T, NM_000492.3:c.1584G>TVOUS12/20/2017
213CFTREx11NM_000492.3:c.1584G>Ap.Glu528= | p.E528=LRG_663t1:c.1584G>A, NM_000492.3:c.1584G>ABenign10/17/2014 
214CFTREx12NM_000492.3:c.1585-1G>ALRG_663t1:c.1585-1G>A, NM_000492.3:c.1585-1G>APathogenic10/01/2019 
215CFTREx12NM_000492.3:c.1586A>Gp.Asp529Gly | p.D529GLRG_663t1:c.1586A>G, NM_000492.3:c.1586A>GVOUS12/04/2017
216CFTREx12NM_000492.3:c.1606A>Gp.Lys536Glu | p.K536ELRG_663t1:c.1606A>G, NM_000492.3:c.1606A>GVOUS12/05/2017
217CFTREx12NM_000492.3:c.1612A>Cp.Asn538His | p.N538HLRG_663t1:c.1612A>C, NM_000492.3:c.1612A>CVOUS05/13/2019
218CFTREx12NM_000492.3:c.1616T>Cp.Ile539Thr | p.I539TLRG_663t1:c.1616T>C, NM_000492.3:c.1616T>CVOUS07/19/2018
219CFTREx12NM_000492.3:c.1624G>Tp.Gly542* | p.G542XLRG_663t1:c.1624G>T, NM_000492.3:c.1624G>TPathogenic12/27/2018 
220CFTREx12NM_000492.3:c.1630G>Ap.Gly544Ser | p.G544SLRG_663t1:c.1630G>A, NM_000492.3:c.1630G>AVOUS09/11/2019
221CFTREx12NM_000492.3:c.1645A>Cp.Ser549Arg | p.S549RLRG_663t1:c.1645A>C, NM_000492.3:c.1645A>CPathogenic** 
222CFTREx12NM_000492.3:c.1646G>Ap.Ser549Asn | p.S549NLRG_663t1:c.1646G>A, NM_000492.3:c.1646G>APathogenic07/30/2018 
223CFTREx12NM_000492.3:c.1651G>Ap.Gly551Ser | p.G551SLRG_663t1:c.1651G>A, NM_000492.3:c.1651G>APathogenic** 
224CFTREx12NM_000492.3:c.1652G>Ap.Gly551Asp | p.G551DLRG_663t1:c.1652G>A, NM_000492.3:c.1652G>APathogenic10/23/2019 
225CFTREx12NM_000492.3:c.1655A>Cp.Gln552Pro | p.Q552PLRG_663t1:c.1655A>C, NM_000492.3:c.1655A>CVOUS07/17/2019
226CFTREx12NM_000492.3:c.1657C>Tp.Arg553* | p.R553XLRG_663t1:c.1657C>T, NM_000492.3:c.1657C>TPathogenic08/15/2017 
227CFTREx12NM_000492.3:c.1666A>Gp.Ile556Val | p.I556VLRG_663t1:c.1666A>G, NM_000492.3:c.1666A>GBenign10/17/2014 
228CFTREx12NM_000492.3:c.1674A>Gp.Leu558= | p.L558=LRG_663t1:c.1674A>G, NM_000492.3:c.1674A>GVOUS08/07/2019
229CFTREx12NM_000492.3:c.1675G>Ap.Ala559Thr | p.A559TLRG_663t1:c.1675G>A, NM_000492.3:c.1675G>APathogenic02/22/2018 
230CFTREx12NM_000492.3:c.1675G>Cp.Ala559Pro | p.A559PVOUS**
231CFTREx12NM_000492.3:c.1679G>Cp.Arg560Thr | p.R560TLRG_663t1:c.1679G>C, NM_000492.3:c.1679G>CPathogenic05/09/2019 
232CFTREx12NM_000492.3:c.1679G>Ap.Arg560Lys | p.R560KLRG_663t1:c.1679G>A, NM_000492.3:c.1679G>APathogenic** 
233CFTREx12NM_000492.3:c.1679+1G>ALRG_663t1:c.1679+1G>A, NM_000492.3:c.1679+1G>APathogenic04/28/2016 
234CFTREx12NM_000492.3:c.1679+16T>CVOUS07/16/2019
235CFTREx13NM_000492.3:c.1680-886A>GLRG_663t1:c.1680-886A>G, NM_000492.3:c.1680-886A>GPathogenic02/28/2017 
236CFTREx13NM_000492.3:c.1680-8C>ALRG_663t1:c.1680-8C>A, NM_000492.3:c.1680-8C>AVOUS07/17/2018
237CFTREx13NM_000492.3:c.1680-6T>GLRG_663t1:c.1680-6T>G, NM_000492.3:c.1680-6T>GVOUS06/13/2019
238CFTREx13NM_000492.3:c.1684G>Ap.Val562Ile | p.V562ILRG_663t1:c.1684G>A, NM_000492.3:c.1684G>AVOUS11/08/2019
239CFTREx13NM_000492.3:c.1692delAp.Asp565Metfs*7 | p.D565MfsX7LRG_663t1:c.1692delA, NM_000492.3:c.1692delAPathogenic** 
240CFTREx13NM_000492.3:c.1706A>Gp.Tyr569Cys | p.Y569CPathogenic** 
241CFTREx13NM_000492.3:c.1718C>Tp.Ser573Phe | p.S573FLRG_663t1:c.1718C>T, NM_000492.3:c.1718C>TVOUS06/07/2017
242CFTREx13NM_000492.3:c.1721C>Ap.Pro574His | p.P574HPathogenic** 
243CFTREx13NM_000492.3:c.1727G>Cp.Gly576Ala | p.G576ALRG_663t1:c.1727G>C, NM_000492.3:c.1727G>CVOUS05/21/2019
244CFTREx13NM_000492.3:c.1753G>Tp.Glu585* | p.E585XLRG_663t1:c.1753G>T, NM_000492.3:c.1753G>TPathogenic08/07/2017 
245CFTREx13NM_000492.3:c.1763A>Gp.Glu588Gly | p.E588GLRG_663t1:c.1763A>G, NM_000492.3:c.1763A>GVOUS06/30/2017
246CFTREx13NM_000492.3:c.1766+2T>ALRG_663t1:c.1766+2T>A, NM_000492.3:c.1766+2T>APathogenic08/31/2018 
247CFTREx13NM_000492.3:c.1766+3A>GLRG_663t1:c.1766+3A>G, NM_000492.3:c.1766+3A>GPathogenic05/23/2016 
248CFTREx13NM_000492.3:c.1766+26T>CVOUS**
249CFTREx13NM_000492.3:c.1766+73T>GLRG_663t1:c.1766+73T>G, NM_000492.3:c.1766+73T>GVOUS09/18/2017
250CFTREx14NM_000492.3:c.1807G>Ap.Val603Ile | p.V603ILRG_663t1:c.1807G>A, NM_000492.3:c.1807G>AVOUS11/14/2019
251CFTREx14NM_000492.3:c.1811C>Gp.Thr604Ser | p.T604SLRG_663t1:c.1811C>G, NM_000492.3:c.1811C>GVOUS04/19/2019
252CFTREx14NM_000492.3:c.1820_1903delp.Met607_Gln634del | p.M607_Q634delLRG_663t1:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA, NM_000492.3:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAPathogenic11/09/2018 
253CFTREx14NM_000492.3:c.1826A>Gp.His609Arg | p.H609RLRG_663t1:c.1826A>G, NM_000492.3:c.1826A>GPathogenic07/14/2019 
254CFTREx14NM_000492.3:c.1853T>Cp.Ile618Thr | p.I618TLRG_663t1:c.1853T>C, NM_000492.3:c.1853T>CPathogenic05/02/2019 
255CFTREx14NM_000492.3:c.1865G>Ap.Gly622Asp | p.G622DLRG_663t1:c.1865G>APathogenic11/13/2019 
256CFTREx14NM_000492.3:c.1882G>Cp.Gly628Arg | p.G628RLRG_663t1:c.1882G>C, NM_000492.3:c.1882G>CLikely pathogenic12/22/2017 
257CFTREx14NM_000492.3:c.1885A>Gp.Thr629Ala | p.T629ALRG_663t1:c.1885A>G, NM_000492.3:c.1885A>GVOUS11/13/2019
258CFTREx14NM_000492.3:c.1920T>Cp.Phe640= | p.F640=LRG_663t1:c.1920T>C, NM_000492.3:c.1920T>CVOUS02/06/2018
259CFTREx14NM_000492.3:c.1970delGPathogenic** 
260CFTREx14NM_000492.3:c.2002C>Tp.Arg668Cys | p.R668CLRG_663t1:c.2002C>T, NM_000492.3:c.2002C>TVOUS11/08/2019
261CFTREx14NM_000492.3:c.2042A>Tp.Glu681Val | p.E681VLRG_663t1:c.2042A>T, NM_000492.3:c.2042A>TVOUS03/25/2016
262CFTREx14NM_000492.3:c.2051_2052delAAinsGLRG_663t1:c.2051_2052delinsG, NM_000492.3:c.2051_2052delinsGPathogenic04/28/2016 
263CFTREx14NM_000492.3:c.2052dupAp.Gln685Thrfs*4 | p.Q685TfsX4LRG_663t1:c.2052dupA, NM_000492.3:c.2052dup, NM_000492.3:c.2052dupAPathogenic12/03/2013 
264CFTREx14NM_000492.3:c.2052_2053insAPathogenic** 
265CFTREx14NM_000492.3:c.2055A>Gp.Gln685= | p.Q685=LRG_663t1:c.2055A>G, NM_000492.3:c.2055A>GVOUS09/04/2018
266CFTREx14NM_000492.3:c.2079T>Gp.Phe693Leu | p.F693LLRG_663t1:c.2079T>G, NM_000492.3:c.2079T>GVOUS09/06/2018
267CFTREx14NM_000492.3:c.2125C>Tp.Arg709* | p.R709XLRG_663t1:c.2125C>T, NM_000492.3:c.2125C>TPathogenic05/31/2018 
268CFTREx14NM_000492.3:c.2145A>Cp.Gln715His | p.Q715HLRG_663t1:c.2145A>C, NM_000492.3:c.2145A>CVOUS07/26/2017
269CFTREx14NM_000492.3:c.2153C>Gp.Pro718Arg | p.P718RLRG_663t1:c.2153C>G, NM_000492.3:c.2153C>GVOUS10/02/2018
270CFTREx14NM_000492.3:c.2169C>Tp.Gly723= | p.G723=LRG_663t1:c.2169C>T, NM_000492.3:c.2169C>TVOUS12/14/2018
271CFTREx14NM_000492.3:c.2173G>Ap.Glu725Lys | p.E725KLRG_663t1:c.2173G>A, NM_000492.3:c.2173G>AVOUS12/27/2016
272CFTREx14NM_000492.3:c.2175dupAp.Glu726Argfs*4 | p.E726RfsX4c2307dupA, LRG_663t1:c.2175dupA, NM_000492.3:c.2175dupAPathogenic01/19/2018 
273CFTREx14NM_000492.3:c.2191C>Tp.Pro731Ser | p.P731SLRG_663t1:c.2191C>T, NM_000492.3:c.2191C>TVOUS06/20/2018
274CFTREx14NM_000492.3:c.2193T>Cp.Pro731= | p.P731=LRG_663t1:c.2193T>C, NM_000492.3:c.2193T>CVOUS05/09/2016
275CFTREx14NM_000492.3:c.2205G>Cp.Arg735Ser | p.R735SLRG_663t1:c.2205G>C, NM_000492.3:c.2205G>CVOUS10/31/2018
276CFTREx14NM_000492.3:c.2210C>Tp.Ser737Phe | p.S737FLRG_663t1:c.2210C>T, NM_000492.3:c.2210C>TPathogenic** 
277CFTREx14NM_000492.3:c.2245C>Tp.Leu749= | p.L749=LRG_663t1:c.2245C>T, NM_000492.3:c.2245C>TVOUS02/04/2019
278CFTREx14NM_000492.3:c.2249C>Tp.Pro750Leu | p.P750LLRG_663t1:c.2249C>T, NM_000492.3:c.2249C>TVOUS06/25/2019
279CFTREx14NM_000492.3:c.2251C>Tp.Arg751Cys | p.R751CLRG_663t1:c.2251C>T, NM_000492.3:c.2251C>TVOUS12/27/2017
280CFTREx14NM_000492.3:c.2260G>Ap.Val754Met | p.V754MLRG_663t1:c.2260G>A, NM_000492.3:c.2260G>AVOUS06/19/2019
281CFTREx14NM_000492.3:c.2280G>Ap.Thr760= | p.T760=LRG_663t1:c.2280G>A, NM_000492.3:c.2280G>AVOUS01/21/2019
282CFTREx14NM_000492.3:c.2347A>Gp.Ile783Val | p.I783VLRG_663t1:c.2347A>G, NM_000492.3:c.2347A>GVOUS04/16/2019
283CFTREx14NM_000492.3:c.2353C>Tp.Arg785* | p.R785XLRG_663t1:c.2353C>T, NM_000492.3:c.2353C>TPathogenic09/24/2019 
284CFTREx14NM_000492.3:c.2372_2377delCACGAAp.Thr791_Arg792del | p.T791_R792delLRG_663t1:c.2372_2377delCACGAA, NM_000492.3:c.2372_2377delCACGAAVOUS08/11/2017
285CFTREx14NM_000492.3:c.2374C>Ap.Arg792= | p.R792=VOUS**
286CFTREx14NM_000492.3:c.2374C>Gp.Arg792Gly | p.R792GLRG_663t1:c.2374C>G, NM_000492.3:c.2374C>GVOUS02/18/2019
287CFTREx14NM_000492.3:c.2392C>Tp.Pro798Ser | p.P798SLRG_663t1:c.2392C>T, NM_000492.3:c.2392C>TVOUS01/27/2017
288CFTREx14NM_000492.3:c.2421A>Gp.Ile807Met | p.I807MLRG_663t1:c.2421A>G, NM_000492.3:c.2421A>GVOUS10/24/2019
289CFTREx14NM_000492.3:c.2424T>Cp.Tyr808= | p.Y808=LRG_663t1:c.2424T>C, NM_000492.3:c.2424T>CVOUS01/02/2019
290CFTREx14NM_000492.3:c.2450G>Tp.Gly817Val | p.G817VLRG_663t1:c.2450G>T, NM_000492.3:c.2450G>TVOUS04/09/2019
291CFTREx14NM_000492.3:c.2475C>Tp.Asn825= | p.N825=LRG_663t1:c.2475C>T, NM_000492.3:c.2475C>TVOUS10/11/2019
292CFTREx14NM_000492.3:c.2482G>Ap.Asp828Asn | p.D828NLRG_663t1:c.2482G>A, NM_000492.3:c.2482G>AVOUS08/21/2019
293CFTREx14NM_000492.3:c.2490+5G>TLRG_663t1:c.2490+5G>T, NM_000492.3:c.2490+5G>TVOUS06/17/2016
294CFTREx15NM_000492.3:c.2506G>Tp.Asp836Tyr | p.D836YLRG_663t1:c.2506G>T, NM_000492.3:c.2506G>TVOUS06/20/2019
295CFTREx15NM_000492.3:c.2537G>Ap.Trp846* | p.W846XPathogenic** 
296CFTREx15NM_000492.3:c.2544A>Tp.Thr848= | p.T848=LRG_663t1:c.2544A>T, NM_000492.3:c.2544A>TVOUS01/16/2017
297CFTREx15NM_000492.3:c.2559T>Cp.Ile853= | p.I853=LRG_663t1:c.2559T>C, NM_000492.3:c.2559T>CVOUS10/19/2018
298CFTREx15NM_000492.3:c.2561_2562delCTinsTGp.Thr854Met | p.T854MLRG_663t1:c.2561_2562delinsTG, NM_000492.3:c.2561_2562delinsTGVOUS12/04/2018
299CFTREx15NM_000492.3:c.2562T>Gp.Thr854= | p.T854=LRG_663t1:c.2562T>G, NM_000492.3:c.2562T>GBenign11/20/2018 
300CFTREx15NM_000492.3:c.2583delTp.Phe861Leufs*3 | p.F861LfsX3LRG_663t1:c.2583delT, NM_000492.3:c.2583delTPathogenic10/30/2018 
301CFTREx15NM_000492.3:c.2619+1G>ALRG_663t1:c.2619+1G>A, NM_000492.3:c.2619+1G>APathogenic05/18/2017 
302CFTREx16NM_000492.3:c.2620-26A>GLRG_663t1:c.2620-26A>G, NM_000492.3:c.2620-26A>GLikely benign04/23/2019 
303CFTREx16NM_000492.3:c.2620-15C>GLRG_663t1:c.2620-15C>G, NM_000492.3:c.2620-15C>GBenign11/29/2016 
304CFTREx16NM_000492.3:c.2620-6T>CLRG_663t1:c.2620-6T>C, NM_000492.3:c.2620-6T>CVOUS06/09/2016
305CFTREx16NM_000492.3:c.2657+2_2657+3insAc.2789insA, LRG_663t1:c.2657+2_2657+3insA, NM_000492.3:c.2657+2_2657+3insAPathogenic11/05/2019 
306CFTREx16NM_000492.3:c.2657+5G>ALRG_663t1:c.2657+5G>A, NM_000492.3:c.2657+5G>APathogenic12/06/2017 
307CFTREx17NM_000492.3:c.2658-2A>GLRG_663t1:c.2658-2A>G, NM_000492.3:c.2658-2A>GPathogenic10/17/2016 
308CFTREx17NM_000492.3:c.2659A>Cp.Thr887Pro | p.T887PLRG_663t1:c.2659A>C, NM_000492.3:c.2659A>CVOUS05/07/2019
309CFTREx17NM_000492.3:c.2665C>Tp.Leu889Phe | p.L889FLRG_663t1:c.2665C>T, NM_000492.3:c.2665C>TVOUS06/27/2018
310CFTREx17NM_000492.3:c.2673C>Gp.Asp891Glu | p.D891ELRG_663t1:c.2673C>G, NM_000492.3:c.2673C>GVOUS12/05/2016
311CFTREx17NM_000492.3:c.2709T>Cp.Tyr903= | p.Y903=LRG_663t1:c.2709T>C, NM_000492.3:c.2709T>CVOUS05/16/2019
312CFTREx17NM_000492.3:c.2723C>Ap.Thr908Asn | p.T908NLRG_663t1:c.2723C>A, NM_000492.3:c.2723C>AVOUS11/08/2019
313CFTREx17NM_000492.3:c.2735C>Tp.Ser912Leu | p.S912LLRG_663t1:c.2735C>T, NM_000492.3:c.2735C>TVOUS03/21/2019
314CFTREx17NM_000492.3:c.2736G>Ap.Ser912= | p.S912=LRG_663t1:c.2736G>A, NM_000492.3:c.2736G>AVOUS01/02/2019
315CFTREx17NM_000492.3:c.2736G>Cp.Ser912= | p.S912=LRG_663t1:c.2736G>C, NM_000492.3:c.2736G>CVOUS08/22/2017
316CFTREx17NM_000492.3:c.2739T>Ap.Tyr913* | p.Y913XNM_000492.3:c.2739T>APathogenic** 
317CFTREx17NM_000492.3:c.2756A>Gp.Tyr919Cys | p.Y919CLRG_663t1:c.2756A>G, NM_000492.3:c.2756A>GVOUS07/06/2018
318CFTREx17NM_000492.3:c.2757C>Tp.Tyr919= | p.Y919=LRG_663t1:c.2757C>T, NM_000492.3:c.2757C>TVOUS11/02/2018
319CFTREx17NM_000492.3:c.2758G>Ap.Val920Met | p.V920MLRG_663t1:c.2758G>A, NM_000492.3:c.2758G>AVOUS01/08/2018
320CFTREx17NM_000492.3:c.2758G>Tp.Val920Leu | p.V920LLRG_663t1:c.2758G>T, NM_000492.3:c.2758G>TVOUS03/13/2017
321CFTREx17NM_000492.3:c.2769C>Tp.Ala923= | p.A923=LRG_663t1:c.2769C>T, NM_000492.3:c.2769C>TVOUS04/14/2017
322CFTREx17NM_000492.3:c.2770G>Ap.Asp924Asn | p.D924NLRG_663t1:c.2770G>A, NM_000492.3:c.2770G>AVOUS12/05/2016
323CFTREx17NM_000492.3:c.2772C>Ap.Asp924Glu | p.D924ELRG_663t1:c.2772C>A, NM_000492.3:c.2772C>AVOUS11/29/2017
324CFTREx17NM_000492.3:c.2797A>Gp.Arg933Gly | p.R933GLRG_663t1:c.2797A>G, NM_000492.3:c.2797A>GVOUS06/08/2017
325CFTREx17NM_000492.3:c.2805A>Gp.Leu935= | p.L935=LRG_663t1:c.2805A>G, NM_000492.3:c.2805A>GVOUS08/29/2019
326CFTREx17NM_000492.3:c.2813T>Gp.Val938Gly | p.V938GLRG_663t1:c.2813T>G, NM_000492.3:c.2813T>GVOUS10/19/2017
327CFTREx17NM_000492.3:c.2820T>Gp.Thr940= | p.T940=LRG_663t1:c.2820T>G, NM_000492.3:c.2820T>GLikely benign12/15/2016 
328CFTREx17NM_000492.3:c.2822delTp.Leu941Glnfs*27 | p.L941QfsX27LRG_663t1:c.2822delT, NM_000492.3:c.2822delTPathogenic10/25/2018 
329CFTREx17NM_000492.3:c.2834C>Tp.Ser945Leu | p.S945LLRG_663t1:c.2834C>T, NM_000492.3:c.2834C>TPathogenic04/13/2015 
330CFTREx17NM_000492.3:c.2855T>Cp.Met952Thr | p.M952TLRG_663t1:c.2855T>C, NM_000492.3:c.2855T>CVOUS10/07/2016
331CFTREx17NM_000492.3:c.2856G>Cp.Met952Ile | p.M952ILRG_663t1:c.2856G>C, NM_000492.3:c.2856G>CLikely pathogenic04/23/2019 
332CFTREx17NM_000492.3:c.2856G>Ap.Met952Ile | p.M952ILRG_663t1:c.2856G>A, NM_000492.3:c.2856G>AVOUS05/17/2018
333CFTREx17NM_000492.3:c.2882T>Cp.Met961Thr | p.M961TLRG_663t1:c.2882T>C, NM_000492.3:c.2882T>CVOUS03/28/2017
334CFTREx17NM_000492.3:c.2895C>Ap.Asn965Lys | p.N965KLRG_663t1:c.2895C>A, NM_000492.3:c.2895C>AVOUS09/29/2017
335CFTREx17NM_000492.3:c.2898G>Ap.Thr966= | p.T966=LRG_663t1:c.2898G>A, NM_000492.3:c.2898G>ABenign10/12/2017 
336CFTREx17NM_000492.3:c.2900T>Cp.Leu967Ser | p.L967SLRG_663t1:c.2900T>C, NM_000492.3:c.2900T>CVOUS03/11/2019
337CFTREx17NM_000492.3:c.2908+4C>ALRG_663t1:c.2908+4C>A, NM_000492.3:c.2908+4C>AVOUS04/12/2018
338CFTREx17NM_000492.3:c.2908+19G>CVOUS**
339CFTREx18NM_000492.3:c.2909-4A>GLRG_663t1:c.2909-4A>G, NM_000492.3:c.2909-4A>GVOUS11/23/2016
340CFTREx18NM_000492.3:c.2909_2924dupGTGGGATTCTTAATAGp.Phe976Trpfs*4 | p.F976WfsX4LRG_663t1:c.2909_2924dupGTGGGATTCTTAATAG, NM_000492.3:c.2909_2924dupGTGGGATTCTTAATAGPathogenic11/05/2019 
341CFTREx18NM_000492.3:c.2946T>Gp.Ile982Met | p.I982MLRG_663t1:c.2946T>G, NM_000492.3:c.2946T>GVOUS07/22/2019
342CFTREx18NM_000492.3:c.2981T>Gp.Phe994Cys | p.F994CLRG_663t1:c.2981T>G, NM_000492.3:c.2981T>GVOUS08/09/2018
343CFTREx18NM_000492.3:c.2988G>Ap.Gln996= | p.Q996=LRG_663t1:c.2988G>A, NM_000492.3:c.2988G>APathogenic06/15/2017 
344CFTREx18NM_000492.3:c.2988+1G>A3120+1 G>A, LRG_663t1:c.2988+1G>A, NM_000492.3:c.2988+1G>APathogenic07/12/2019 
345CFTREx19NM_000492.3:c.2991G>Cp.Leu997Phe | p.L997FLRG_663t1:c.2991G>C, NM_000492.3:c.2991G>CVOUS08/05/2019
346CFTREx19NM_000492.3:c.2998A>Tp.Ile1000Phe | p.I1000FLRG_663t1:c.2998A>T, NM_000492.3:c.2998A>TVOUS12/11/2018
347CFTREx19NM_000492.3:c.3001G>Ap.Val1001Met | p.V1001MLRG_663t1:c.3001G>A, NM_000492.3:c.3001G>AVOUS09/06/2018
348CFTREx19NM_000492.3:c.3024C>Tp.Val1008= | p.V1008=NM_000492.3:c.3024C>TVOUS02/12/2015
349CFTREx19NM_000492.3:c.3025G>Ap.Ala1009Thr | p.A1009TLRG_663t1:c.3025G>A, NM_000492.3:c.3025G>AVOUS10/22/2019
350CFTREx19NM_000492.3:c.3036A>Gp.Gln1012= | p.Q1012=LRG_663t1:c.3036A>G, NM_000492.3:c.3036A>GVOUS09/19/2019
351CFTREx19NM_000492.3:c.3041A>Gp.Tyr1014Cys | p.Y1014CLRG_663t1:c.3041A>G, NM_000492.3:c.3041A>GVOUS08/15/2019
352CFTREx19NM_000492.3:c.3067_3072delATAGTGPathogenic08/06/2012 
353CFTREx19NM_000492.3:c.3073G>Tp.Ala1025Ser | p.A1025SLRG_663t1:c.3073G>T, NM_000492.3:c.3073G>TVOUS12/13/2018
354CFTREx19NM_000492.3:c.3080T>Cp.Ile1027Thr | p.I1027TLRG_663t1:c.3080T>C, NM_000492.3:c.3080T>CBenign12/18/2012 
355CFTREx19NM_000492.3:c.3083T>Gp.Met1028Arg | p.M1028RLRG_663t1:c.3083T>G, NM_000492.3:c.3083T>GVOUS08/27/2019
356CFTREx19NM_000492.3:c.3095A>Gp.Tyr1032Cys | p.Y1032CLRG_663t1:c.3095A>G, NM_000492.3:c.3095A>GLikely pathogenic06/11/2018 
357CFTREx19NM_000492.3:c.3100C>Tp.Leu1034Phe | p.L1034FLRG_663t1:c.3100C>T, NM_000492.3:c.3100C>TVOUS03/08/2017
358CFTREx19NM_000492.3:c.3121A>Cp.Lys1041Gln | p.K1041QLRG_663t1:c.3121A>C, NM_000492.3:c.3121A>CVOUS11/14/2019
359CFTREx19NM_000492.3:c.3139G>Tp.Gly1047Cys | p.G1047CLRG_663t1:c.3139G>T, NM_000492.3:c.3139G>TVOUS10/02/2015
360CFTREx19NM_000492.3:c.3139delGPathogenic** 
361CFTREx19NM_000492.3:c.3139+1delGPathogenic** 
362CFTREx19NM_000492.3:c.3139+8A>GLRG_663t1:c.3139+8A>G, NM_000492.3:c.3139+8A>GVOUS10/01/2018
363CFTREx19NM_000492.3:c.3139+18C>TVOUS**
364CFTREx19NM_000492.3:c.3139+42A>TBenign** 
365CFTREx20NM_000492.3:c.3140-26A>GLRG_663t1:c.3140-26A>G, NM_000492.3:c.3140-26A>GPathogenic04/27/2017 
366CFTREx20NM_000492.3:c.3154T>Gp.Phe1052Val | p.F1052VLRG_663t1:c.3154T>G, NM_000492.3:c.3154T>GVOUS07/06/2018
367CFTREx20NM_000492.3:c.3169A>Gp.Thr1057Ala | p.T1057ALRG_663t1:c.3169A>G, NM_000492.3:c.3169A>GVOUS09/02/2015
368CFTREx20NM_000492.3:c.3177A>Gp.Leu1059= | p.L1059=LRG_663t1:c.3177A>G, NM_000492.3:c.3177A>GVOUS09/17/2019
369CFTREx20NM_000492.3:c.3181G>Cp.Gly1061Arg | p.G1061RLRG_663t1:c.3181G>C, NM_000492.3:c.3181G>CLikely pathogenic03/02/2018 
370CFTREx20NM_000492.3:c.3194T>Cp.Leu1065Pro | p.L1065PNM_000492.3:c.3194T>CPathogenic12/16/2015 
371CFTREx20NM_000492.3:c.3196C>Tp.Arg1066Cys | p.R1066CLRG_663t1:c.3196C>T, NM_000492.3:c.3196C>TPathogenic06/12/2017 
372CFTREx20NM_000492.3:c.3197G>Ap.Arg1066His | p.R1066HLRG_663t1:c.3197G>A, NM_000492.3:c.3197G>APathogenic12/10/2018 
373CFTREx20NM_000492.3:c.3199G>Ap.Ala1067Thr | p.A1067TNM_000492.3:c.3199G>AVOUS04/16/2013
374CFTREx20NM_000492.3:c.3200C>Tp.Ala1067Val | p.A1067VNM_000492.3:c.3200C>TVOUS02/11/2016
375CFTREx20NM_000492.3:c.3205G>Ap.Gly1069Arg | p.G1069RLRG_663t1:c.3205G>A, NM_000492.3:c.3205G>AVOUS08/27/2019
376CFTREx20NM_000492.3:c.3209G>Ap.Arg1070Gln | p.R1070QLRG_663t1:c.3209G>A, NM_000492.3:c.3209G>APathogenic04/28/2015 
377CFTREx20NM_000492.3:c.3222T>Ap.Phe1074Leu | p.F1074LLRG_663t1:c.3222T>A, NM_000492.3:c.3222T>ALikely pathogenic05/23/2018 
378CFTREx20NM_000492.3:c.3256A>Gp.Thr1086Ala | p.T1086ALRG_663t1:c.3256A>G, NM_000492.3:c.3256A>GVOUS03/12/2019
379CFTREx20NM_000492.3:c.3256A>Tp.Thr1086Ser | p.T1086SLRG_663t1:c.3256A>T, NM_000492.3:c.3256A>TVOUS06/12/2017
380CFTREx20NM_000492.3:c.3274T>Cp.Tyr1092His | p.Y1092HLRG_663t1:c.3274T>C, NM_000492.3:c.3274T>CVOUS01/22/2018
381CFTREx20NM_000492.3:c.3275A>Gp.Tyr1092Cys | p.Y1092CLRG_663t1:c.3275A>G, NM_000492.3:c.3275A>GVOUS03/01/2017
382CFTREx20NM_000492.3:c.3276C>Ap.Tyr1092* | p.Y1092XLRG_663t1:c.3276C>A, NM_000492.3:c.3276C>APathogenic08/14/2018 
383CFTREx20NM_000492.3:c.3285A>Tp.Thr1095= | p.T1095=LRG_663t1:c.3285A>T, NM_000492.3:c.3285A>TBenign12/21/2015 
384CFTREx20NM_000492.3:c.3289C>Tp.Arg1097Cys | p.R1097CLRG_663t1:c.3289C>T, NM_000492.3:c.3289C>TVOUS05/16/2019
385CFTREx20NM_000492.3:c.3297C>Ap.Phe1099Leu | p.F1099LLRG_663t1:c.3297C>A, NM_000492.3:c.3297C>AVOUS04/08/2016
386CFTREx20NM_000492.3:c.3302T>Ap.Met1101Lys | p.M1101KLRG_663t1:c.3302T>A, NM_000492.3:c.3302T>APathogenic08/09/2019 
387CFTREx20NM_000492.3:c.3303G>Ap.Met1101Ile | p.M1101ILRG_663t1:c.3303G>A, NM_000492.3:c.3303G>AVOUS09/24/2018
388CFTREx20NM_000492.3:c.3306A>Gp.Arg1102= | p.R1102=LRG_663t1:c.3306A>G, NM_000492.3:c.3306A>GVOUS08/13/2019
389CFTREx20NM_000492.3:c.3367+45T>CNM_000492.3:c.3367+45T>CVOUS**
390CFTREx21NM_000492.3:c.3368-4A>GLRG_663t1:c.3368-4A>G, NM_000492.3:c.3368-4A>GVOUS07/07/2017
391CFTREx21NM_000492.3:c.3382A>Gp.Arg1128Gly | p.R1128GLRG_663t1:c.3382A>G, NM_000492.3:c.3382A>GVOUS07/28/2016
392CFTREx21NM_000492.3:c.3407C>Tp.Ala1136Val | p.A1136VLRG_663t1:c.3407C>T, NM_000492.3:c.3407C>TVOUS02/02/2018
393CFTREx21NM_000492.3:c.3409A>Gp.Met1137Val | p.M1137VLRG_663t1:c.3409A>G, NM_000492.3:c.3409A>GVOUS10/11/2019
394CFTREx21NM_000492.3:c.3415A>Gp.Ile1139Val | p.I1139VLRG_663t1:c.3415A>G, NM_000492.3:c.3415A>GVOUS07/13/2018
395CFTREx21NM_000492.3:c.3420G>Ap.Met1140Ile | p.M1140ILRG_663t1:c.3420G>A, NM_000492.3:c.3420G>AVOUS03/07/2019
396CFTREx21NM_000492.3:c.3429G>Ap.Leu1143= | p.L1143=LRG_663t1:c.3429G>A, NM_000492.3:c.3429G>AVOUS12/04/2018
397CFTREx21NM_000492.3:c.3454G>Cp.Asp1152His | p.D1152HLRG_663t1:c.3454G>C, NM_000492.3:c.3454G>CPathogenic11/15/2018 
398CFTREx21NM_000492.3:c.3468G>Ap.Leu1156= | p.L1156=LRG_663t1:c.3468G>AVOUS12/11/2014
399CFTREx21NM_000492.3:c.3468+2dupTLRG_663t1:c.3468+2_3468+3insT, LRG_663t1:c.3468+2dupT, NM_000492.3:c.3468+2_3468+3insT, NM_000492.3:c.3468+2dupTLikely pathogenic12/27/2016 
400CFTREx22NM_000492.3:c.3469-20T>CLRG_663t1:c.3469-20T>C, NM_000492.3:c.3469-20T>CBenign03/29/2019 
401CFTREx22NM_000492.3:c.3469-17T>CLRG_663t1:c.3469-17T>C, NM_000492.3:c.3469-17T>CVOUS06/27/2019
402CFTREx22NM_000492.3:c.3472C>Tp.Arg1158* | p.R1158XLRG_663t1:c.3472C>T, NM_000492.3:c.3472C>TPathogenic10/29/2018 
403CFTREx22NM_000492.3:c.3485G>Tp.Arg1162Leu | p.R1162LLRG_663t1:c.3485G>T, NM_000492.3:c.3485G>TVOUS11/06/2019
404CFTREx22NM_000492.3:c.3485G>Ap.Arg1162Gln | p.R1162QLRG_663t1:c.3485G>A, NM_000492.3:c.3485G>AVOUS04/03/2018
405CFTREx22NM_000492.3:c.3503A>Gp.Asp1168Gly | p.D1168GLRG_663t1:c.3503A>G, NM_000492.3:c.3503A>GVOUS05/30/2017
406CFTREx22NM_000492.3:c.3508C>Tp.Pro1170Ser | p.P1170SLRG_663t1:c.3508C>T, NM_000492.3:c.3508C>TVOUS10/11/2018
407CFTREx22NM_000492.3:c.3517G>Ap.Gly1173Ser | p.G1173SLRG_663t1:c.3517G>A, NM_000492.3:c.3517G>AVOUS09/26/2016
408CFTREx22NM_000492.3:c.3528delCp.Lys1177Serfs*15 | p.K1177SfsX15LRG_663t1:c.3528delC, NM_000492.3:c.3528delCPathogenic03/13/2017 
409CFTREx22NM_000492.3:c.3558A>Gp.Gln1186= | p.Q1186=LRG_663t1:c.3558A>G, NM_000492.3:c.3558A>GVOUS10/03/2019
410CFTREx22NM_000492.3:c.3564G>Ap.Ser1188= | p.S1188=LRG_663t1:c.3564G>A, NM_000492.3:c.3564G>AVOUS06/20/2013
411CFTREx22NM_000492.3:c.3588A>Tp.Ser1196= | p.S1196=LRG_663t1:c.3588A>T, NM_000492.3:c.3588A>TVOUS08/30/2018
412CFTREx22NM_000492.3:c.3607A>Gp.Ile1203Val | p.I1203VNM_000492.3:c.3607A>GVOUS01/23/2014
413CFTREx22NM_000492.3:c.3612G>Ap.Trp1204* | p.W1204XLRG_663t1:c.3612G>A, NM_000492.3:c.3612G>APathogenic01/03/2013 
414CFTREx22NM_000492.3:c.3659C>Tp.Thr1220Ile | p.T1220ILRG_663t1:c.3659C>T, NM_000492.3:c.3659C>TVOUS04/19/2018
415CFTREx22NM_000492.3:c.3665G>Ap.Gly1222Asp | p.G1222DLRG_663t1:c.3665G>A, NM_000492.3:c.3665G>AVOUS09/05/2017
416CFTREx22NM_000492.3:c.3682G>Cp.Glu1228Gln | p.E1228QLRG_663t1:c.3682G>C, NM_000492.3:c.3682G>CVOUS05/29/2019
417CFTREx22NM_000492.3:c.3705T>Gp.Ser1235Arg | p.S1235RLRG_663t1:c.3705T>G, NM_000492.3:c.3705T>GBenign07/24/2012 
418CFTREx22NM_000492.3:c.3710G>Ap.Gly1237Asp | p.G1237DLRG_663t1:c.3710G>A, NM_000492.3:c.3710G>AVOUS09/17/2018
419CFTREx22NM_000492.3:c.3713A>Gp.Gln1238Arg | p.Q1238RLRG_663t1:c.3713A>G, NM_000492.3:c.3713A>GVOUS07/31/2019
420CFTREx22NM_000492.3:c.3717+40A>GLRG_663t1:c.3717+40A>G, NM_000492.3:c.3717+40A>GLikely pathogenic08/31/2017 
421CFTREx22NM_000492.3:c.3717+45G>ALRG_663t1:c.3717+45G>A, NM_000492.3:c.3717+45G>ABenign03/14/2019 
422CFTREx22NM_000492.3:c.3717+12191C>T3849+10kb C>T, LRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic07/22/2019 
423CFTREx23NM_000492.3:c.3718-2530A>GLRG_663t1:c.3718-2530A>G, NM_000492.3:c.3718-2530A>GBenign10/26/2016 
424CFTREx23NM_000492.3:c.3718-2477C>TLRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic05/08/2017 
425CFTREx23NM_000492.3:c.3718-24G>ALRG_663t1:c.3718-24G>A, NM_000492.3:c.3718-24G>AVOUS12/12/2018
426CFTREx23NM_000492.3:c.3744delAp.Lys1250Argfs*9 | p.K1250RfsX9LRG_663t1:c.3744delA, NM_000492.3:c.3744delAPathogenic10/02/2018 
427CFTREx23NM_000492.3:c.3747G>Ap.Gly1249= | p.G1249=LRG_663t1:c.3747G>A, NM_000492.3:c.3747G>AVOUS01/15/2015
428CFTREx23NM_000492.3:c.3761T>Gp.Leu1254* | p.L1254XPathogenic** 
429CFTREx23NM_000492.3:c.3762A>Gp.Leu1254= | p.L1254=LRG_663t1:c.3762A>G, NM_000492.3:c.3762A>GVOUS06/19/2019
430CFTREx23NM_000492.3:c.3764C>Ap.Ser1255* | p.S1255XPathogenic** 
431CFTREx23NM_000492.3:c.3772T>Cp.Leu1258= | p.L1258=LRG_663t1:c.3772T>C, NM_000492.3:c.3772T>CVOUS06/26/2017
432CFTREx23NM_000492.3:c.3794G>Tp.Gly1265Val | p.G1265VLRG_663t1:c.3794G>T, NM_000492.3:c.3794G>TVOUS06/08/2017
433CFTREx23NM_000492.3:c.3808G>Ap.Asp1270Asn | p.D1270NLRG_663t1:c.3808G>A, NM_000492.3:c.3808G>AVOUS11/12/2019
434CFTREx23NM_000492.3:c.3815T>Ap.Val1272Glu | p.V1272ENM_000492.3:c.3815T>AVOUS04/23/2015
435CFTREx23NM_000492.3:c.3836T>Cp.Leu1279Ser | p.L1279SLRG_663t1:c.3836T>C, NM_000492.3:c.3836T>CVOUS04/04/2018
436CFTREx23NM_000492.3:c.3846G>Cp.Trp1282Cys | p.W1282CLRG_663t1:c.3846G>C, NM_000492.3:c.3846G>CVOUS08/15/2018
437CFTREx23NM_000492.3:c.3846G>Ap.Trp1282* | p.W1282XLRG_663t1:c.3846G>A, NM_000492.3:c.3846G>APathogenic11/20/2018 
438CFTREx23NM_000492.3:c.3852A>Gp.Lys1284= | p.K1284=LRG_663t1:c.3852A>G, NM_000492.3:c.3852A>GVOUS10/19/2017
439CFTREx23NM_000492.3:c.3853G>Ap.Ala1285Thr | p.A1285TLRG_663t1:c.3853G>A, NM_000492.3:c.3853G>AVOUS10/10/2017
440CFTREx23NM_000492.3:c.3854C>Tp.Ala1285Val | p.A1285VLRG_663t1:c.3854C>T, NM_000492.3:c.3854C>TVOUS02/22/2019
441CFTREx23NM_000492.3:c.3870A>Gp.Pro1290= | p.P1290=LRG_663t1:c.3870A>G, NM_000492.3:c.3870A>GBenign11/01/2018 
442CFTREx23NM_000492.3:c.3873+7A>TLRG_663t1:c.3873+7A>T, NM_000492.3:c.3873+7A>TVOUS09/20/2017
443CFTREx24NM_000492.3:c.3874-4522A>GLRG_663t1:c.3874-4522A>G, NM_000492.3:c.3874-4522A>GLikely pathogenic08/26/2019 
444CFTREx24NM_000492.3:c.3874-21_3874-15dupTTCTTTTLRG_663t1:c.3874-15_3874-14insTTCTTTT, LRG_663t1:c.3874-21_3874-15dupTTCTTTT, LRG_663t1:c.3874-21_3874-15insTTCTTTT, NM_000492.3:c.3874-15_3874-14insTTCTTTT, NM_000492.3:c.3874-21_3874-15dupTTCTTTT, NM_000492.3:c.3874-21_3874-15insTTCTTTTVOUS02/22/2017
445CFTREx24NM_000492.3:c.3874-14_3874-10delCTTTTLRG_663t1:c.3874-14_3874-10delCTTTT, NM_000492.3:c.3874-14_3874-10delCTTTTLikely benign11/27/2018 
446CFTREx24NM_000492.3:c.3893G>Tp.Gly1298Val | p.G1298VLRG_663t1:c.3893G>T, NM_000492.3:c.3893G>TVOUS10/13/2017
447CFTREx24NM_000492.3:c.3895A>Gp.Thr1299Ala | p.T1299ALRG_663t1:c.3895A>G, NM_000492.3:c.3895A>GVOUS09/06/2018
448CFTREx24NM_000492.3:c.3897A>Gp.Thr1299= | p.T1299=LRG_663t1:c.3897A>G, NM_000492.3:c.3897A>GLikely benign01/11/2017 
449CFTREx24NM_000492.3:c.3909C>Gp.Asn1303Lys | p.N1303KLRG_663t1:c.3909C>G, NM_000492.3:c.3909C>GPathogenic09/17/2019 
450CFTREx24NM_000492.3:c.3933T>Gp.Ser1311Arg | p.S1311RLRG_663t1:c.3933T>G, NM_000492.3:c.3933T>GVOUS09/27/2016
451CFTREx25NM_000492.3:c.3964-16T>CNM_000492.3:c.3964-16T>CVOUS08/25/2014
452CFTREx25NM_000492.3:c.3983T>Cp.Ile1328Thr | p.I1328TLRG_663t1:c.3983T>C, NM_000492.3:c.3983T>CVOUS04/09/2019
453CFTREx25NM_000492.3:c.3999delGNM_000492.3:c.3999delGPathogenic09/04/2015 
454CFTREx25NM_000492.3:c.4036C>Tp.Leu1346= | p.L1346=LRG_663t1:c.4036C>T, NM_000492.3:c.4036C>TVOUS11/15/2017
455CFTREx25NM_000492.3:c.4045G>Ap.Gly1349Ser | p.G1349SLRG_663t1:c.4045G>A, NM_000492.3:c.4045G>AVOUS06/27/2017
456CFTREx25NM_000492.3:c.4053_4054delGCinsAGp.Gln1352Glu | p.Q1352ELRG_663t1:c.4053_4054delinsAG, NM_000492.3:c.4053_4054delinsAGVOUS09/21/2018
457CFTREx25NM_000492.3:c.4056G>Cp.Gln1352His | p.Q1352HLRG_663t1:c.4056G>C, NM_000492.3:c.4056G>CVOUS04/16/2019
458CFTREx25NM_000492.3:c.4058delTp.Leu1353* | p.L1353XLRG_663t1:c.4058delT, NM_000492.3:c.4058delTPathogenic02/23/2018 
459CFTREx25NM_000492.3:c.4077_4080delTGTTinsAAp.Val1360Thrfs*3 | p.V1360TfsX3LRG_663t1:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delinsAAPathogenic** 
460CFTREx25NM_000492.3:c.4092G>Ap.Ala1364= | p.A1364=LRG_663t1:c.4092G>A, NM_000492.3:c.4092G>AVOUS07/12/2019
461CFTREx25NM_000492.3:c.4121C>Gp.Ala1374Gly | p.A1374GLRG_663t1:c.4121C>G, NM_000492.3:c.4121C>GVOUS02/17/2017
462CFTREx25NM_000492.3:c.4123C>Ap.His1375Asn | p.H1375NLRG_663t1:c.4123C>A, NM_000492.3:c.4123C>AVOUS12/28/2017
463CFTREx25NM_000492.3:c.4129G>Cp.Asp1377His | p.D1377HLRG_663t1:c.4129G>C, NM_000492.3:c.4129G>CVOUS06/23/2016
464CFTREx26NM_000492.3:c.4159A>Gp.Thr1387Ala | p.T1387ALRG_663t1:c.4159A>G, NM_000492.3:c.4159A>GVOUS12/21/2017
465CFTREx26NM_000492.3:c.4195C>Gp.Leu1399Val | p.L1399VLRG_663t1:c.4195C>G, NM_000492.3:c.4195C>GVOUS05/11/2018
466CFTREx26NM_000492.3:c.4197C>Gp.Leu1399= | p.L1399=LRG_663t1:c.4197C>G, NM_000492.3:c.4197C>GVOUS05/02/2017
467CFTREx26NM_000492.3:c.4197C>Tp.Leu1399= | p.L1399=LRG_663t1:c.4197C>T, NM_000492.3:c.4197C>TVOUS09/30/2019
468CFTREx26NM_000492.3:c.4241T>Cp.Leu1414Ser | p.L1414SLRG_663t1:c.4241T>C, NM_000492.3:c.4241T>CVOUS02/01/2018
469CFTREx26NM_000492.3:c.4242+10T>CLRG_663t1:c.4242+10T>C, NM_000492.3:c.4242+10T>CBenign05/24/2013 
470CFTREx26NM_000492.3:c.4242+13A>GBenign04/29/2013 
471CFTREx27NM_000492.3:c.*2G>ALRG_663t1:c.*2G>A, NM_000492.3:c.*2G>AVOUS05/21/2019
472CFTREx27NM_000492.3:c.*10T>ALRG_663t1:c.*10T>A, NM_000492.3:c.*10T>AVOUS**
473CFTREx27NM_000492.3:c.*1043A>CLRG_663t1:c.*1043A>C, NM_000492.3:c.*1043A>CBenign03/28/2017 
474CFTREx27NM_000492.3:c.4243-20A>GLRG_663t1:c.4243-20A>G, NM_000492.3:c.4243-20A>GVOUS06/05/2019
475CFTREx27NM_000492.3:c.4243-5C>TLRG_663t1:c.4243-5C>T, NM_000492.3:c.4243-5C>TBenign08/25/2015 
476CFTREx27NM_000492.3:c.4251delAp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4251delA, NM_000492.3:c.4251delAPathogenic10/26/2017 
477CFTREx27NM_000492.3:c.4252delGp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4252delG, NM_000492.3:c.4252delGPathogenic12/21/2018 
478CFTREx27NM_000492.3:c.4272C>Tp.Tyr1424= | p.Y1424=LRG_663t1:c.4272C>T, NM_000492.3:c.4272C>TBenign11/14/2017 
479CFTREx27NM_000492.3:c.4296C>Tp.Asn1432= | p.N1432=LRG_663t1:c.4296C>T, NM_000492.3:c.4296C>TVOUS04/30/2019
480CFTREx27NM_000492.3:c.4322T>Cp.Ile1441Thr | p.I1441TNM_000492.3:c.4322T>CVOUS06/26/2015
481CFTREx27NM_000492.3:c.4332C>Tp.Ser1444= | p.S1444=LRG_663t1:c.4332C>T, NM_000492.3:c.4332C>TVOUS05/09/2017
482CFTREx27NM_000492.3:c.4333G>Ap.Asp1445Asn | p.D1445NLRG_663t1:c.4333G>A, NM_000492.3:c.4333G>AVOUS04/08/2019
483CFTREx27NM_000492.3:c.4357C>Tp.Arg1453Trp | p.R1453WLRG_663t1:c.4357C>T, NM_000492.3:c.4357C>TVOUS09/24/2018
484CFTREx27NM_000492.3:c.4358G>Ap.Arg1453Gln | p.R1453QLRG_663t1:c.4358G>A, NM_000492.3:c.4358G>AVOUS08/21/2019
485CFTREx27NM_000492.3:c.4383G>Tp.Lys1461Asn | p.K1461NLRG_663t1:c.4383G>T, NM_000492.3:c.4383G>TVOUS12/20/2017
486CFTREx27NM_000492.3:c.4387C>Tp.Gln1463* | p.Q1463XLRG_663t1:c.4387C>T, NM_000492.3:c.4387C>TVOUS08/15/2016
487CFTREx27NM_000492.3:c.4389G>Ap.Gln1463= | p.Q1463=LRG_663t1:c.4389G>A, NM_000492.3:c.4389G>ABenign11/20/2018 
488CFTREx27NM_000492.3:c.4417G>Ap.Glu1473Lys | p.E1473KLRG_663t1:c.4417G>A, NM_000492.3:c.4417G>AVOUS05/05/2017
489CFTREx27NM_000492.3:c.4426C>Tp.Gln1476* | p.Q1476XLRG_663t1:c.4426C>T, NM_000492.3:c.4426C>TPathogenic05/15/2018 
490CFTREx27NM_000492.3:c.4436G>Ap.Arg1479Lys | p.R1479KLRG_663t1:c.4436G>A, NM_000492.3:c.4436G>AVOUS03/13/2019

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by EGL Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2019-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official EGL clinical report and should be approached with caution. Only variants identified at EGL are listed in the EmVClass. If you intend to use EGL's classification for publication purposes please contact the laboratory for permission.