Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CFTREx1NM_000492.3:c.-2C>GLRG_663t1:c.-2C>G, NM_000492.3:c.-2C>GVOUS06/28/2019
2CFTREx1NM_000492.3:c.-4G>CLRG_663t1:c.-4G>C, NM_000492.3:c.-4G>CLikely benign05/18/2015 
3CFTREx1NM_000492.3:c.-8G>CLRG_663t1:c.-8G>C, NM_000492.3:c.-8G>CBenign07/06/2017 
4CFTREx1NM_000492.3:c.-9C>AVOUS06/04/2020
5CFTREx1NM_000492.3:c.10T>Cp.Ser4Pro | p.S4PLRG_663t1:c.10T>C, NM_000492.3:c.10T>CVOUS03/05/2019
6CFTREx1NM_000492.3:c.14C>Tp.Pro5Leu | p.P5LLRG_663t1:c.14C>T, NM_000492.3:c.14C>TLikely pathogenic11/20/2017 
7CFTREx1NM_000492.3:c.19G>Tp.Glu7* | p.E7XLRG_663t1:c.19G>T, NM_000492.3:c.19G>TPathogenic05/16/2016 
8CFTREx1NM_000492.3:c.31G>Ap.Val11Ile | p.V11ILRG_663t1:c.31G>A, NM_000492.3:c.31G>AVOUS02/23/2021
9CFTREx1NM_000492.3:c.-34C>TVOUS03/12/2020
10CFTREx1NM_000492.3:c.40A>Gp.Lys14Glu | p.K14ELRG_663t1:c.40A>G, NM_000492.3:c.40A>GVOUS12/28/2017
11CFTREx1NM_000492.3:c.41A>Tp.Lys14Ile | p.K14ILRG_663t1:c.41A>T, NM_000492.3:c.41A>TVOUS02/01/2021
12CFTREx1NM_000492.3:c.41A>Gp.Lys14Arg | p.K14RLRG_663t1:c.41A>G, NM_000492.3:c.41A>GVOUS12/28/2020
13CFTREx1NM_000492.3:c.49_50dupTTp.Trp19Alafs*7 | p.W19AfsX7LRG_663t1:c.49_50dupTT, NM_000492.3:c.49_50dupTTPathogenic04/27/2018 
14CFTREx1NM_000492.3:c.50T>Gp.Phe17Cys | p.F17CLRG_663t1:c.50T>G, NM_000492.3:c.50T>GVOUS12/03/2019
15CFTREx1NM_000492.3:c.53+4A>TVOUS12/17/2020
16CFTREx1NM_000492.3:c.53+9G>TVOUS10/03/2019
17CFTREx1NM_000492.3:c.53+45A>GLRG_663t1:c.53+45A>G, NM_000492.3:c.53+45A>GVOUS**
18CFTREx1NM_000492.3:c.-132-680T>GLRG_663t1:c.-812T>G, NM_000492.3:c.-812T>GLikely benign01/18/2017 
19CFTREx1NM_000492.3:c.-132-470A>TVOUS08/28/2020
20CFTREx1NM_000492.3:c.-132-329A>GLRG_663t1:c.-461A>G, NM_000492.3:c.-461A>GVOUS02/26/2021
21CFTREx1NM_000492.3:c.-132-316A>GLRG_663t1:c.-448A>G, NM_000492.3:c.-448A>GVOUS11/02/2020
22CFTREx1NM_000492.3:c.-132-156G>AVOUS10/04/2019
23CFTREx1NM_000492.3:c.-132-156G>CLRG_663t1:c.-288G>C, NM_000492.3:c.-288G>CLikely benign03/20/2017 
24CFTREx1NM_000492.3:c.-132-94G>TLRG_663t1:c.-226G>T, NM_000492.3:c.-226G>TVOUS10/09/2020
25CFTREx1NM_000492.3:c.-132-33G>ALRG_663t1:c.-165G>A, NM_000492.3:c.-165G>AVOUS04/19/2018
26CFTREx1NM_000492.3:c.-132-20G>CLRG_663t1:c.-152G>C, NM_000492.3:c.-152G>CVOUS03/08/2021
27CFTREx1NM_000492.3:c.-132T>GLRG_663t1:c.-132T>G, NM_000492.3:c.-132T>GVOUS01/09/2017
28CFTREx2NM_000492.3:c.91C>Tp.Arg31Cys | p.R31CLRG_663t1:c.91C>T, NM_000492.3:c.91C>TVOUS08/18/2020
29CFTREx2NM_000492.3:c.92G>Tp.Arg31Leu | p.R31LLRG_663t1:c.92G>T, NM_000492.3:c.92G>TVOUS06/07/2018
30CFTREx2NM_000492.3:c.94C>Ap.Leu32Met | p.L32MLRG_663t1:c.94C>A, NM_000492.3:c.94C>AVOUS06/15/2017
31CFTREx2NM_000492.3:c.104C>Tp.Ser35Leu | p.S35LLRG_663t1:c.104C>T, NM_000492.3:c.104C>TVOUS02/20/2020
32CFTREx2NM_000492.3:c.109A>Gp.Ile37Val | p.I37VLRG_663t1:c.109A>G, NM_000492.3:c.109A>GVOUS03/15/2018
33CFTREx2NM_000492.3:c.117A>Cp.Gln39His | p.Q39HLRG_663t1:c.117A>C, NM_000492.3:c.117A>CVOUS02/12/2020
34CFTREx2NM_000492.3:c.125C>Tp.Ser42Phe | p.S42FLRG_663t1:c.125C>T, NM_000492.3:c.125C>TVOUS06/29/2018
35CFTREx2NM_000492.3:c.137C>Tp.Ala46Val | p.A46VLRG_663t1:c.137C>T, NM_000492.3:c.137C>TVOUS09/04/2018
36CFTREx2NM_000492.3:c.164+3A>GVOUS02/15/2021
37CFTREx2NM_000492.3:c.164+9A>GLRG_663t1:c.164+9A>G, NM_000492.3:c.164+9A>GVOUS12/26/2018
38CFTREx2NM_000492.3:c.164+10delTinsATGALRG_663t1:c.164+10delinsATGA, NM_000492.3:c.164+10delinsATGAVOUS**
39CFTREx2NM_000492.3:c.164+12T>CLRG_663t1:c.164+12T>C, NM_000492.3:c.164+12T>CVOUS10/26/2018
40CFTREx2NM_000492.3:c.164+28A>GLRG_663t1:c.164+28A>G, NM_000492.3:c.164+28A>GBenign11/20/2018 
41CFTREx3NM_000492.3:c.165-3C>TLRG_663t1:c.165-3C>T, NM_000492.3:c.165-3C>TPathogenic12/31/2018 
42CFTREx3NM_000492.3:c.165-1G>ALRG_663t1:c.165-1G>A, NM_000492.3:c.165-1G>APathogenic01/19/2016 
43CFTREx3NM_000492.3:c.166G>Ap.Glu56Lys | p.E56KLRG_663t1:c.166G>A, NM_000492.3:c.166G>ALikely pathogenic08/25/2020 
44CFTREx3NM_000492.3:c.180G>Cp.Glu60Asp | p.E60DLRG_663t1:c.180G>C, NM_000492.3:c.180G>CVOUS03/01/2021
45CFTREx3NM_000492.3:c.181C>Tp.Leu61= | p.L61=LRG_663t1:c.181C>T, NM_000492.3:c.181C>TVOUS12/11/2018
46CFTREx3NM_000492.3:c.200C>Tp.Pro67Leu | p.P67LLRG_663t1:c.200C>TPathogenic01/13/2020 
47CFTREx3NM_000492.3:c.202A>Gp.Lys68Glu | p.K68ELRG_663t1:c.202A>G, NM_000492.3:c.202A>GVOUS08/21/2018
48CFTREx3NM_000492.3:c.204A>Tp.Lys68Asn | p.K68NLRG_663t1:c.204A>T, NM_000492.3:c.204A>TVOUS10/22/2019
49CFTREx3NM_000492.3:c.220C>Tp.Arg74Trp | p.R74WLRG_663t1:c.220C>T, NM_000492.3:c.220C>TVOUS03/09/2021
50CFTREx3NM_000492.3:c.221G>Ap.Arg74Gln | p.R74QLRG_663t1:c.221G>A, NM_000492.3:c.221G>AVOUS12/03/2019
51CFTREx3NM_000492.3:c.224G>Ap.Arg75Gln | p.R75QLRG_663t1:c.224G>A, NM_000492.3:c.224G>ALikely benign10/20/2017 
52CFTREx3NM_000492.3:c.226T>Ap.Cys76Ser | p.C76SLRG_663t1:c.226T>A, NM_000492.3:c.226T>AVOUS09/06/2016
53CFTREx3NM_000492.3:c.233dupTp.Trp79Leufs*32 | p.W79LfsX32LRG_663t1:c.233dupT, NM_000492.3:c.233dupTPathogenic10/10/2018 
54CFTREx3NM_000492.3:c.246G>Ap.Met82Ile | p.M82ILRG_663t1:c.246G>A, NM_000492.3:c.246G>AVOUS03/22/2019
55CFTREx3NM_000492.3:c.250T>Cp.Tyr84His | p.Y84HLRG_663t1:c.250T>C, NM_000492.3:c.250T>CVOUS01/26/2017
56CFTREx3NM_000492.3:c.254G>Ap.Gly85Glu | p.G85ELRG_663t1:c.254G>A, NM_000492.3:c.254G>APathogenic06/18/2020 
57CFTREx3NM_000492.3:c.256A>Gp.Ile86Val | p.I86VLRG_663t1:c.256A>G, NM_000492.3:c.256A>GVOUS09/30/2019
58CFTREx3NM_000492.3:c.262_263delTTp.Leu88Ilefs*22 | p.L88IfsX22LRG_663t1:c.262_263delTT, NM_000492.3:c.262_263delTTPathogenic** 
59CFTREx4NM_000492.3:c.274-8T>CVOUS12/29/2020
60CFTREx4NM_000492.3:c.274-6T>CLRG_663t1:c.274-6T>C, NM_000492.3:c.274-6T>CVOUS02/11/2021
61CFTREx4NM_000492.3:c.274-1G>ALRG_663t1:c.274-1G>A, NM_000492.3:c.274-1G>APathogenic06/24/2014 
62CFTREx4NM_000492.3:c.290T>Cp.Val97Ala | p.V97AVOUS**
63CFTREx4NM_000492.3:c.316A>Gp.Ile106Val | p.I106VLRG_663t1:c.316A>G, NM_000492.3:c.316A>GVOUS10/05/2016
64CFTREx4NM_000492.3:c.326A>Gp.Tyr109Cys | p.Y109CLRG_663t1:c.326A>G, NM_000492.3:c.326A>GLikely pathogenic02/08/2019 
65CFTREx4NM_000492.3:c.328G>Cp.Asp110His | p.D110HLRG_663t1:c.328G>C, NM_000492.3:c.328G>CPathogenic09/11/2020 
66CFTREx4NM_000492.3:c.328G>Tp.Asp110Tyr | p.D110YLRG_663t1:c.328G>T, NM_000492.3:c.328G>TPathogenic** 
67CFTREx4NM_000492.3:c.330C>Ap.Asp110Glu | p.D110ELRG_663t1:c.330C>A, NM_000492.3:c.330C>APathogenic05/23/2017 
68CFTREx4NM_000492.3:c.332C>Tp.Pro111Leu | p.P111LLRG_663t1:c.332C>T, NM_000492.3:c.332C>TVOUS08/07/2019
69CFTREx4NM_000492.3:c.332C>Gp.Pro111Arg | p.P111RLRG_663t1:c.332C>G, NM_000492.3:c.332C>GVOUS08/02/2016
70CFTREx4NM_000492.3:c.335A>Gp.Asp112Gly | p.D112GLRG_663t1:c.335A>G, NM_000492.3:c.335A>GVOUS09/03/2020
71CFTREx4NM_000492.3:c.349C>Tp.Arg117Cys | p.R117CLRG_663t1:c.349C>T, NM_000492.3:c.349C>TPathogenic12/15/2020 
72CFTREx4NM_000492.3:c.350G>Ap.Arg117His | p.R117HLRG_663t1:c.350G>A, NM_000492.3:c.350G>APathogenic08/03/2020 
73CFTREx4NM_000492.3:c.350G>Tp.Arg117Leu | p.R117LLRG_663t1:c.350G>T, NM_000492.3:c.350G>TPathogenic** 
74CFTREx4NM_000492.3:c.358G>Ap.Ala120Thr | p.A120TLRG_663t1:c.358G>A, NM_000492.3:c.358G>AVOUS12/03/2019
75CFTREx4NM_000492.3:c.360G>Ap.Ala120= | p.A120=LRG_663t1:c.360G>A, NM_000492.3:c.360G>AVOUS08/22/2019
76CFTREx4NM_000492.3:c.374T>Cp.Ile125Thr | p.I125TLRG_663t1:c.374T>C, NM_000492.3:c.374T>CLikely benign03/13/2017 
77CFTREx4NM_000492.3:c.377G>Tp.Gly126Val | p.G126VLRG_663t1:c.377G>T, NM_000492.3:c.377G>TVOUS05/25/2018
78CFTREx4NM_000492.3:c.393T>Cp.Phe131= | p.F131=LRG_663t1:c.393T>C, NM_000492.3:c.393T>CVOUS08/30/2018
79CFTREx4NM_000492.3:c.403A>Gp.Thr135Ala | p.T135ALRG_663t1:c.403A>G, NM_000492.3:c.403A>GVOUS12/13/2017
80CFTREx4NM_000492.3:c.416A>Cp.His139Pro | p.H139PLRG_663t1:c.416A>C, NM_000492.3:c.416A>CVOUS03/30/2018
81CFTREx4NM_000492.3:c.418C>Tp.Pro140Ser | p.P140SLRG_663t1:c.418C>T, NM_000492.3:c.418C>TVOUS06/30/2020
82CFTREx4NM_000492.3:c.442delAp.Ile148Leufs*5 | p.I148LfsX5LRG_663t1:c.442delA, NM_000492.3:c.442delAPathogenic09/22/2017 
83CFTREx4NM_000492.3:c.443T>Ap.Ile148Asn | p.I148NLRG_663t1:c.443T>A, NM_000492.3:c.443T>AVOUS02/27/2017
84CFTREx4NM_000492.3:c.443T>Cp.Ile148Thr | p.I148TLRG_663t1:c.443T>C, NM_000492.3:c.443T>CBenign08/06/2012 
85CFTREx4NM_000492.3:c.451C>Ap.Gln151Lys | p.Q151KLRG_663t1:c.451C>A, NM_000492.3:c.451C>AVOUS07/14/2019
86CFTREx4NM_000492.3:c.454A>Tp.Met152Leu | p.M152LLRG_663t1:c.454A>T, NM_000492.3:c.454A>TVOUS01/09/2019
87CFTREx4NM_000492.3:c.473G>Cp.Ser158Thr | p.S158TLRG_663t1:c.473G>C, NM_000492.3:c.473G>CVOUS02/05/2020
88CFTREx4NM_000492.3:c.478A>Gp.Ile160Val | p.I160VLRG_663t1:c.478A>G, NM_000492.3:c.478A>GVOUS07/06/2020
89CFTREx4NM_000492.3:c.489+1G>T 621+1G->T, LRG_663t1:c.489+1G>T, NM_000492.3:c.489+1G>TPathogenic03/11/2021 
90CFTREx4NM_000492.3:c.489+3A>GLRG_663t1:c.489+3A>G, NM_000492.3:c.489+3A>GVOUS01/21/2021
91CFTREx4NM_000492.3:c.489+4A>GVOUS10/20/2020
92CFTREx4NM_000492.3:c.489+7C>TVOUS12/29/2020
93CFTREx4NM_000492.3:c.489+8T>GLRG_663t1:c.489+8T>G, NM_000492.3:c.489+8T>GVOUS02/20/2018
94CFTREx4NM_000492.3:c.489+87A>GLRG_663t1:c.489+87A>G, NM_000492.3:c.489+87A>GVOUS02/15/2018
95CFTREx5NM_000492.3:c.509G>Ap.Arg170His | p.R170HLRG_663t1:c.509G>A, NM_000492.3:c.509G>AVOUS11/17/2020
96CFTREx5NM_000492.3:c.530T>Cp.Ile177Thr | p.I177TLRG_663t1:c.530T>C, NM_000492.3:c.530T>CVOUS11/07/2018
97CFTREx5NM_000492.3:c.538C>Gp.Leu180Val | p.L180VLRG_663t1:c.538C>G, NM_000492.3:c.538C>GVOUS04/08/2019
98CFTREx5NM_000492.3:c.547C>Ap.Leu183Ile | p.L183ILRG_663t1:c.547C>A, NM_000492.3:c.547C>AVOUS03/26/2019
99CFTREx5NM_000492.3:c.561C>Tp.Asn187= | p.N187=LRG_663t1:c.561C>T, NM_000492.3:c.561C>TVOUS06/26/2018
100CFTREx5NM_000492.3:c.571T>Gp.Phe191Val | p.F191VLRG_663t1:c.571T>G, NM_000492.3:c.571T>GLikely pathogenic02/06/2020 
101CFTREx5NM_000492.3:c.577G>Tp.Glu193* | p.E193XNM_000492.3:c.577G>TPathogenic08/18/2014 
102CFTREx5NM_000492.3:c.579+1G>TLRG_663t1:c.579+1G>T, NM_000492.3:c.579+1G>TPathogenic05/19/2016 
103CFTREx5NM_000492.3:c.579+4delTVOUS**
104CFTREx5NM_000492.3:c.579+4T>CVOUS08/06/2020
105CFTREx6NM_000492.3:c.581G>Tp.Gly194Val | p.G194VLRG_663t1:c.581G>T, NM_000492.3:c.581G>TVOUS11/07/2017
106CFTREx6NM_000492.3:c.592G>Cp.Ala198Pro | p.A198PLRG_663t1:c.592G>C, NM_000492.3:c.592G>CVOUS03/14/2016
107CFTREx6NM_000492.3:c.592G>Ap.Ala198Thr | p.A198TLRG_663t1:c.592G>A, NM_000492.3:c.592G>AVOUS01/27/2017
108CFTREx6NM_000492.3:c.598T>Ap.Phe200Ile | p.F200ILRG_663t1:c.598T>A, NM_000492.3:c.598T>AVOUS08/06/2020
109CFTREx6NM_000492.3:c.601G>Ap.Val201Met | p.V201MLRG_663t1:c.601G>A, NM_000492.3:c.601G>AVOUS01/11/2021
110CFTREx6NM_000492.3:c.610G>Ap.Ala204Thr | p.A204TLRG_663t1:c.610G>A, NM_000492.3:c.610G>AVOUS10/07/2020
111CFTREx6NM_000492.3:c.613C>Tp.Pro205Ser | p.P205SLRG_663t1:c.613C>T, NM_000492.3:c.613C>TPathogenic03/12/2019 
112CFTREx6NM_000492.3:c.617T>Gp.Leu206Trp | p.L206WLRG_663t1:c.617T>G, NM_000492.3:c.617T>GPathogenic03/19/2020 
113CFTREx6NM_000492.3:c.625G>Tp.Ala209Ser | p.A209SLRG_663t1:c.625G>T, NM_000492.3:c.625G>TVOUS01/20/2021
114CFTREx6NM_000492.3:c.638G>Tp.Gly213Val | p.G213VLRG_663t1:c.638G>T, NM_000492.3:c.638G>TVOUS03/05/2020
115CFTREx6NM_000492.3:c.648G>Tp.Trp216Cys | p.W216CLRG_663t1:c.648G>T, NM_000492.3:c.648G>TVOUS06/12/2018
116CFTREx6NM_000492.3:c.650A>Gp.Glu217Gly | p.E217GLRG_663t1:c.650A>G, NM_000492.3:c.650A>GVOUS12/15/2020
117CFTREx6NM_000492.3:c.663G>Ap.Ala221= | p.A221=LRG_663t1:c.663G>A, NM_000492.3:c.663G>AVOUS08/25/2016
118CFTREx6NM_000492.3:c.688C>Tp.Leu230= | p.L230=LRG_663t1:c.688C>T, NM_000492.3:c.688C>TVOUS04/17/2018
119CFTREx6NM_000492.3:c.695T>Ap.Val232Asp | p.V232DLRG_663t1:c.695T>A, NM_000492.3:c.695T>APathogenic04/04/2018 
120CFTREx6NM_000492.3:c.708delTPathogenic** 
121CFTREx6NM_000492.3:c.709C>Gp.Gln237Glu | p.Q237ELRG_663t1:c.709C>G, NM_000492.3:c.709C>GLikely pathogenic01/08/2019 
122CFTREx6NM_000492.3:c.710A>Tp.Gln237Leu | p.Q237LLRG_663t1:c.710A>T, NM_000492.3:c.710A>TVOUS01/08/2019
123CFTREx6NM_000492.3:c.710A>Gp.Gln237Arg | p.Q237RLRG_663t1:c.710A>G, NM_000492.3:c.710A>GVOUS01/08/2019
124CFTREx6NM_000492.3:c.711G>Tp.Gln237His | p.Q237HLRG_663t1:c.711G>T, NM_000492.3:c.711G>TVOUS12/28/2018
125CFTREx6NM_000492.3:c.711G>Cp.Gln237His | p.Q237HLRG_663t1:c.711G>C, NM_000492.3:c.711G>CVOUS01/08/2019
126CFTREx6NM_000492.3:c.715G>Ap.Gly239Arg | p.G239RLRG_663t1:c.715G>A, NM_000492.3:c.715G>AVOUS10/04/2019
127CFTREx6NM_000492.3:c.738G>Ap.Lys246= | p.K246=LRG_663t1:c.738G>A, NM_000492.3:c.738G>ALikely benign12/07/2016 
128CFTREx6NM_000492.3:c.743+1G>ALRG_663t1:c.743+1G>A, NM_000492.3:c.743+1G>APathogenic07/06/2016 
129CFTREx6NM_000492.3:c.743+40A>GNM_000492.3:c.743+40A>GBenign** 
130CFTREx7NM_000492.3:c.744-33GATT(6_9)Benign01/29/2021 
131CFTREx7NM_000492.3:c.744-9_744-6dupGATTLRG_663t1:c.744-9_744-6dupGATT, NM_000492.3:c.744-9_744-6dupGATTBenign06/23/2017 
132CFTREx7NM_000492.3:c.757G>Ap.Gly253Arg | p.G253RLRG_663t1:c.757G>A, NM_000492.3:c.757G>AVOUS12/30/2020
133CFTREx7NM_000492.3:c.770A>Gp.Glu257Gly | p.E257GLRG_663t1:c.770A>G, NM_000492.3:c.770A>GVOUS02/15/2021
134CFTREx7NM_000492.3:c.772A>Gp.Arg258Gly | p.R258GLRG_663t1:c.772A>G, NM_000492.3:c.772A>GVOUS10/02/2019
135CFTREx7NM_000492.3:c.780G>Cp.Val260= | p.V260=LRG_663t1:c.780G>C, NM_000492.3:c.780G>CVOUS10/07/2020
136CFTREx7NM_000492.3:c.794T>Gp.Met265Arg | p.M265RLRG_663t1:c.794T>G, NM_000492.3:c.794T>GVOUS02/11/2019
137CFTREx7NM_000492.3:c.803delAp.Asn268Ilefs*17 | p.N268IfsX17LRG_663t1:c.803delA, NM_000492.3:c.803delAPathogenic07/25/2019 
138CFTREx7NM_000492.3:c.806T>Cp.Ile269Thr | p.I269TLRG_663t1:c.806T>C, NM_000492.3:c.806T>CVOUS06/26/2020
139CFTREx7NM_000492.3:c.837A>Tp.Glu279Asp | p.E279DLRG_663t1:c.837A>T, NM_000492.3:c.837A>TVOUS03/27/2017
140CFTREx7NM_000492.3:c.842T>Cp.Met281Thr | p.M281TLRG_663t1:c.842T>C, NM_000492.3:c.842T>CVOUS08/19/2019
141CFTREx7NM_000492.3:c.846A>Tp.Glu282Asp | p.E282DLRG_663t1:c.846A>T, NM_000492.3:c.846A>TVOUS12/13/2019
142CFTREx7NM_000492.3:c.848_860delAAATGATTGAAAAinsTGNM_000492.3:c.848_860delinsTGPathogenic10/27/2014 
143CFTREx7NM_000492.3:c.850dupALRG_663t1:c.850_851insA, NM_000492.3:c.850_851insAPathogenic03/28/2016 
144CFTREx7NM_000492.3:c.853A>Tp.Ile285Phe | p.I285FLRG_663t1:c.853A>T, NM_000492.3:c.853A>TLikely benign06/23/2017 
145CFTREx7NM_000492.3:c.860A>Gp.Asn287Ser | p.N287SLRG_663t1:c.860A>G, NM_000492.3:c.860A>GVOUS02/20/2020
146CFTREx7NM_000492.3:c.861C>Gp.Asn287Lys | p.N287KLRG_663t1:c.861C>G, NM_000492.3:c.861C>GVOUS09/25/2018
147CFTREx7NM_000492.3:c.869+1G>CLRG_663t1:c.869+1G>C, NM_000492.3:c.869+1G>CPathogenic06/14/2018 
148CFTREx7NM_000492.3:c.869+11C>TLRG_663t1:c.869+11C>T, NM_000492.3:c.869+11C>TBenign05/19/2016 
149CFTREx7NM_000492.3:c.869+40A>GNM_000492.3:c.869+40A>GBenign** 
150CFTREx8NM_000492.3:c.870-7_870-5delTTTLRG_663t1:c.870-7_870-5delTTT, NM_000492.3:c.870-7_870-5delTTTLikely benign05/30/2017 
151CFTREx8NM_000492.3:c.870-2A>GPathogenic01/28/2021 
152CFTREx8NM_000492.3:c.889C>Tp.Arg297Trp | p.R297WLRG_663t1:c.889C>T, NM_000492.3:c.889C>TVOUS06/18/2020
153CFTREx8NM_000492.3:c.890G>Ap.Arg297Gln | p.R297QLRG_663t1:c.890G>A, NM_000492.3:c.890G>ALikely benign09/26/2014 
154CFTREx8NM_000492.3:c.902A>Gp.Tyr301Cys | p.Y301CLRG_663t1:c.902A>G, NM_000492.3:c.902A>GVOUS09/03/2019
155CFTREx8NM_000492.3:c.925G>Tp.Ala309Ser | p.A309SLRG_663t1:c.925G>T, NM_000492.3:c.925G>TVOUS02/07/2019
156CFTREx8NM_000492.3:c.926C>Gp.Ala309Gly | p.A309GLRG_663t1:c.926C>G, NM_000492.3:c.926C>GVOUS11/14/2017
157CFTREx8NM_000492.3:c.935_937delTCTp.Phe312del | p.F312delLRG_663t1:c.935_937delTCT, NM_000492.3:c.935_937delTCTPathogenic11/19/2013 
158CFTREx8NM_000492.3:c.944T>Cp.Phe315Ser | p.F315SLRG_663t1:c.944T>C, NM_000492.3:c.944T>CVOUS09/15/2017
159CFTREx8NM_000492.3:c.948delTp.Phe316Leufs*12 | p.F316LfsX12LRG_663t1:c.948delT, NM_000492.3:c.948delTPathogenic08/15/2017 
160CFTREx8NM_000492.3:c.948T>Gp.Phe316Leu | p.F316LLRG_663t1:c.948T>G, NM_000492.3:c.948T>GVOUS11/09/2017
161CFTREx8NM_000492.3:c.958T>Gp.Leu320Val | p.L320VLRG_663t1:c.958T>G, NM_000492.3:c.958T>GVOUS10/27/2020
162CFTREx8NM_000492.3:c.960A>Gp.Leu320= | p.L320=LRG_663t1:c.960A>G, NM_000492.3:c.960A>GVOUS06/18/2019
163CFTREx8NM_000492.3:c.974A>Gp.Tyr325Cys | p.Y325CLRG_663t1:c.974A>G, NM_000492.3:c.974A>GVOUS09/13/2018
164CFTREx8NM_000492.3:c.1000C>Tp.Arg334Trp | p.R334WLRG_663t1:c.1000C>T, NM_000492.3:c.1000C>TPathogenic** 
165CFTREx8NM_000492.3:c.1001G>Ap.Arg334Gln | p.R334QLRG_663t1:c.1001G>A, NM_000492.3:c.1001G>AVOUS04/22/2021
166CFTREx8NM_000492.3:c.1007T>Ap.Ile336Lys | p.I336KLRG_663t1:c.1007T>A, NM_000492.3:c.1007T>APathogenic03/15/2017 
167CFTREx8NM_000492.3:c.1021T>Cp.Ser341Pro | p.S341PLRG_663t1:c.1021T>C, NM_000492.3:c.1021T>CPathogenic10/10/2016 
168CFTREx8NM_000492.3:c.1022_1023insTC1157InsTC, NM_000492.3:c.1022_1023insTCPathogenic07/10/2014 
169CFTREx8NM_000492.3:c.1039C>Tp.Arg347Cys | p.R347CLRG_663t1:c.1039C>T, NM_000492.3:c.1039C>TVOUS09/27/2017
170CFTREx8NM_000492.3:c.1040G>Cp.Arg347Pro | p.R347PLRG_663t1:c.1040G>C, NM_000492.3:c.1040G>CPathogenic10/17/2018 
171CFTREx8NM_000492.3:c.1043T>Ap.Met348Lys | p.M348KLRG_663t1:c.1043T>A, NM_000492.3:c.1043T>ALikely benign06/08/2020 
172CFTREx8NM_000492.3:c.1046C>Tp.Ala349Val | p.A349VLRG_663t1:c.1046C>T, NM_000492.3:c.1046C>TVOUS01/29/2021
173CFTREx8NM_000492.3:c.1047G>Ap.Ala349= | p.A349=LRG_663t1:c.1047G>A, NM_000492.3:c.1047G>AVOUS12/15/2017
174CFTREx8NM_000492.3:c.1052C>Gp.Thr351Ser | p.T351SLRG_663t1:c.1052C>G, NM_000492.3:c.1052C>GVOUS06/04/2020
175CFTREx8NM_000492.3:c.1054C>Tp.Arg352Trp | p.R352WLRG_663t1:c.1054C>T, NM_000492.3:c.1054C>TVOUS11/30/2020
176CFTREx8NM_000492.3:c.1055G>Ap.Arg352Gln | p.R352QLRG_663t1:c.1055G>A, NM_000492.3:c.1055G>APathogenic** 
177CFTREx8NM_000492.3:c.1066_1072delTGGGCTGinsANM_000492.3:c.1066_1072delinsAVOUS05/29/2015
178CFTREx8NM_000492.3:c.1083delGp.Trp361Cysfs*8 | p.W361CfsX8LRG_663t1:c.1083delG, NM_000492.3:c.1083delGPathogenic04/18/2017 
179CFTREx8NM_000492.3:c.1116+6G>CLRG_663t1:c.1116+6G>C, NM_000492.3:c.1116+6G>CVOUS03/21/2017
180CFTREx9NM_000492.3:c.1118A>Tp.Asp373Val | p.D373VLRG_663t1:c.1118A>T, NM_000492.3:c.1118A>TVOUS08/21/2019
181CFTREx9NM_000492.3:c.1125A>Cp.Leu375Phe | p.L375FLRG_663t1:c.1125A>C, NM_000492.3:c.1125A>CLikely pathogenic09/18/2019 
182CFTREx9NM_000492.3:c.1139A>Gp.Tyr380Cys | p.Y380CLRG_663t1:c.1139A>G, NM_000492.3:c.1139A>GVOUS05/20/2020
183CFTREx9NM_000492.3:c.1149G>Ap.Leu383= | p.L383=LRG_663t1:c.1149G>A, NM_000492.3:c.1149G>AVOUS10/09/2017
184CFTREx9NM_000492.3:c.1163C>Tp.Thr388Met | p.T388MLRG_663t1:c.1163C>T, NM_000492.3:c.1163C>TVOUS07/24/2019
185CFTREx9NM_000492.3:c.1164G>Ap.Thr388= | p.T388=LRG_663t1:c.1164G>A, NM_000492.3:c.1164G>AVOUS05/19/2017
186CFTREx9NM_000492.3:c.1196C>Tp.Ala399Val | p.A399VLRG_663t1:c.1196C>T, NM_000492.3:c.1196C>TVOUS07/27/2020
187CFTREx10NM_000492.3:c.1210-32T>GLRG_663t1:c.1210-32T>G, NM_000492.3:c.1210-32T>GVOUS09/23/2016
188CFTREx10NM_000492.3:c.1210-17_1210-12delGTGTGTNM_000492.3:c.1210-17_1210-12delGTGTGTVOUS02/10/2021
189CFTREx10NM_000492.3:c.1210-15G>TLRG_663t1:c.1210-15G>T, NM_000492.3:c.1210-15G>TVOUS06/26/2017
190CFTREx10NM_000492.3:c.1210-14_1210-13insTGLRG_663t1:c.1210-14_1210-13insTG, NM_000492.3:c.1210-14_1210-13insTGBenign07/02/2014 
191CFTREx10NM_000492.3:c.1210-13GT(10_12)Benign** 
192CFTREx10NM_000492.3:c.1210-13G>TNM_000492.3:c.1210-13G>TBenign01/31/2014 
193CFTREx10NM_000492.3:c.1210-13_1210-10delGTTTLRG_663t1:c.1210-13_1210-10delGTTT, NM_000492.3:c.1210-13_1210-10delGTTTVOUS09/23/2016
194CFTREx10NM_000492.3:c.1210-12T(5_9)Other Reportable01/29/2021 
195CFTREx10NM_000492.3:c.1210-11T>GLRG_663t1:c.1210-11T>G, NM_000492.3:c.1210-11T>GOther Reportable05/19/2016 
196CFTREx10NM_000492.3:c.1210-7_1210-6dupTTLRG_663t1:c.1210-7_1210-6dupTT, NM_000492.3:c.1210-6_1210-5insTT, NM_000492.3:c.1210-7_1210-6dupTTBenign09/29/2014 
197CFTREx10NM_000492.3:c.1210-7_1210-6delTTLRG_663t1:c.1210-7_1210-6delTT, NM_000492.3:c.1210-7_1210-6delTTOther Reportable05/06/2019 
198CFTREx10NM_000492.3:c.1210-6T>AVOUS05/29/2020
199CFTREx10NM_000492.3:c.1210-2_1210-1delAGLRG_663t1:c.1210-2_1210-1delAG, NM_000492.3:c.1210-2_1210-1delAGPathogenic10/04/2019 
200CFTREx10NM_000492.3:c.1227T>Cp.Phe409= | p.F409=LRG_663t1:c.1227T>C, NM_000492.3:c.1227T>CVOUS03/29/2019
201CFTREx10NM_000492.3:c.1231A>Gp.Lys411Glu | p.K411ELRG_663t1:c.1231A>G, NM_000492.3:c.1231A>GVOUS04/19/2019
202CFTREx10NM_000492.3:c.1234_1238delGCAAAp.Ala412Thrfs*4 | p.A412TfsX4LRG_663t1:c.1234_1238delGCAAA, NM_000492.3:c.1234_1238delGCAAAPathogenic09/22/2016 
203CFTREx10NM_000492.3:c.1251C>Ap.Asn417Lys | p.N417KLRG_663t1:c.1251C>A, NM_000492.3:c.1251C>ABenign03/21/2015 
204CFTREx10NM_000492.3:c.1254T>Cp.Asn418= | p.N418=NM_000492.3:c.1254T>CBenign08/19/2014 
205CFTREx10NM_000492.3:c.1270G>Ap.Gly424Ser | p.G424SLRG_663t1:c.1270G>A, NM_000492.3:c.1270G>AVOUS04/18/2019
206CFTREx10NM_000492.3:c.1301_1307delCACTTCTPathogenic** 
207CFTREx10NM_000492.3:c.1312A>Gp.Thr438Ala | p.T438ALRG_663t1:c.1312A>G, NM_000492.3:c.1312A>GVOUS08/31/2018
208CFTREx10NM_000492.3:c.1327G>Tp.Asp443Tyr | p.D443YLRG_663t1:c.1327G>T, NM_000492.3:c.1327G>TPathogenic12/14/2020 
209CFTREx10NM_000492.3:c.1327_1330dupGATAp.Ile444Argfs*3 | p.I444RfsX3LRG_663t1:c.1327_1330dupGATA, NM_000492.3:c.1327_1330dupGATAPathogenic11/08/2019 
210CFTREx10NM_000492.3:c.1331T>Cp.Ile444Thr | p.I444TLRG_663t1:c.1331T>C, NM_000492.3:c.1331T>CVOUS12/21/2017
211CFTREx10NM_000492.3:c.1340delANM_000492.3:c.1340delAPathogenic** 
212CFTREx10NM_000492.3:c.1343T>Ap.Ile448Lys | p.I448KVOUS**
213CFTREx10NM_000492.3:c.1360_1362delTTGp.Leu454del | p.L454delLRG_663t1:c.1360_1362delTTG, NM_000492.3:c.1360_1362delTTGLikely benign01/11/2017 
214CFTREx10NM_000492.3:c.1364C>Ap.Ala455Glu | p.A455ELRG_663t1:c.1364C>A, NM_000492.3:c.1364C>APathogenic** 
215CFTREx10NM_000492.3:c.1364C>Tp.Ala455Val | p.A455VLRG_663t1:c.1364C>T, NM_000492.3:c.1364C>TVOUS08/06/2020
216CFTREx10NM_000492.3:c.1365G>Ap.Ala455= | p.A455=LRG_663t1:c.1365G>A, NM_000492.3:c.1365G>ALikely benign02/23/2021 
217CFTREx10NM_000492.3:c.1365G>Tp.Ala455= | p.A455=LRG_663t1:c.1365G>T, NM_000492.3:c.1365G>TVOUS01/12/2016
218CFTREx10NM_000492.3:c.1367T>Cp.Val456Ala | p.V456ALRG_663t1:c.1367T>C, NM_000492.3:c.1367T>CPathogenic07/26/2019 
219CFTREx11NM_000492.3:c.1393-42G>ALRG_663t1:c.1393-42G>A, NM_000492.3:c.1393-42G>ABenign01/19/2017 
220CFTREx11NM_000492.3:c.1393-3C>AVOUS05/07/2020
221CFTREx11NM_000492.3:c.1397C>Gp.Ser466* | p.S466XLRG_663t1:c.1397C>G, NM_000492.3:c.1397C>GPathogenic02/24/2017 
222CFTREx11NM_000492.3:c.1400T>Cp.Leu467Pro | p.L467PLRG_663t1:c.1400T>C, NM_000492.3:c.1400T>CPathogenic04/24/2017 
223CFTREx11NM_000492.3:c.1408A>Gp.Met470Val | p.M470VLRG_663t1:c.1408A>G, NM_000492.3:c.1408A>GBenign12/03/2020 
224CFTREx11NM_000492.3:c.1408G>Ap.Val470Met | p.V470MLRG_663t1:c.1408G>A, NM_000492.3:c.1408G>ABenign12/03/2020 
225CFTREx11NM_000492.3:c.1414A>Gp.Met472Val | p.M472VLRG_663t1:c.1414A>G, NM_000492.3:c.1414A>GVOUS11/05/2019
226CFTREx11NM_000492.3:c.1430C>Ap.Pro477His | p.P477HLRG_663t1:c.1430C>A, NM_000492.3:c.1430C>AVOUS07/28/2016
227CFTREx11NM_000492.3:c.1436A>Cp.Glu479Ala | p.E479ALRG_663t1:c.1436A>C, NM_000492.3:c.1436A>CVOUS04/07/2016
228CFTREx11NM_000492.3:c.1438G>Tp.Gly480Cys | p.G480CLRG_663t1:c.1438G>T, NM_000492.3:c.1438G>TPathogenic09/30/2013 
229CFTREx11NM_000492.3:c.1446T>Ap.Ile482= | p.I482=LRG_663t1:c.1446T>A, NM_000492.3:c.1446T>AVOUS04/27/2018
230CFTREx11NM_000492.3:c.1450C>Tp.His484Tyr | p.H484YLRG_663t1:c.1450C>T, NM_000492.3:c.1450C>TVOUS05/08/2017
231CFTREx11NM_000492.3:c.1454G>Cp.Ser485Thr | p.S485TLRG_663t1:c.1454G>C, NM_000492.3:c.1454G>CVOUS02/18/2019
232CFTREx11NM_000492.3:c.1457G>Ap.Gly486Glu | p.G486ELRG_663t1:c.1457G>A, NM_000492.3:c.1457G>AVOUS05/20/2020
233CFTREx11NM_000492.3:c.1477C>Tp.Gln493* | p.Q493XLRG_663t1:c.1477C>T, NM_000492.3:c.1477C>TPathogenic07/21/2020 
234CFTREx11NM_000492.3:c.1479G>Cp.Gln493His | p.Q493HLRG_663t1:c.1479G>C, NM_000492.3:c.1479G>CVOUS11/04/2016
235CFTREx11NM_000492.3:c.1499G>Ap.Gly500Asp | p.G500DLRG_663t1:c.1499G>A, NM_000492.3:c.1499G>AVOUS08/12/2016
236CFTREx11NM_000492.3:c.1516A>Gp.Ile506Val | p.I506VLRG_663t1:c.1516A>G, NM_000492.3:c.1516A>GBenign07/06/2016 
237CFTREx11NM_000492.3:c.1517T>Cp.Ile506Thr | p.I506TLRG_663t1:c.1517T>C, NM_000492.3:c.1517T>CLikely pathogenic07/30/2018 
238CFTREx11NM_000492.3:c.1519_1521delATCp.Ile507del | p.I507delLRG_663t1:c.1519_1521delATC, NM_000492.3:c.1519_1521delATCPathogenic11/30/2018 
239CFTREx11NM_000492.3:c.1521_1523delCTTp.Phe508del | p.F508deldelF508, DeltaF508, dF508, LRG_663t1:c.1521_1523delCTT, NM_000492.3:c.1521_1523delCTTPathogenic10/08/2020 
240CFTREx11NM_000492.3:c.1523T>Gp.Phe508Cys | p.F508CLRG_663t1:c.1523T>G, NM_000492.3:c.1523T>GBenign04/14/2016 
241CFTREx11NM_000492.3:c.1534T>Ap.Tyr512Asn | p.Y512NLRG_663t1:c.1534T>A, NM_000492.3:c.1534T>AVOUS11/15/2017
242CFTREx11NM_000492.3:c.1552A>Gp.Arg518Gly | p.R518GLRG_663t1:c.1552A>G, NM_000492.3:c.1552A>GVOUS04/26/2018
243CFTREx11NM_000492.3:c.1558G>Ap.Val520Ile | p.V520ILRG_663t1:c.1558G>A, NM_000492.3:c.1558G>AVOUS10/05/2020
244CFTREx11NM_000492.3:c.1561A>Cp.Ile521Leu | p.I521LLRG_663t1:c.1561A>C, NM_000492.3:c.1561A>CVOUS07/31/2020
245CFTREx11NM_000492.3:c.1567G>Tp.Ala523Ser | p.A523SLRG_663t1:c.1567G>T, NM_000492.3:c.1567G>TVOUS02/20/2020
246CFTREx11NM_000492.3:c.1582G>Ap.Glu528Lys | p.E528KLRG_663t1:c.1582G>A, NM_000492.3:c.1582G>AVOUS05/21/2018
247CFTREx11NM_000492.3:c.1584G>Tp.Glu528Asp | p.E528DLRG_663t1:c.1584G>T, NM_000492.3:c.1584G>TVOUS12/20/2017
248CFTREx11NM_000492.3:c.1584G>Ap.Glu528= | p.E528=LRG_663t1:c.1584G>A, NM_000492.3:c.1584G>ABenign12/03/2019 
249CFTREx12NM_000492.3:c.1585-8G>ALikely pathogenic02/24/2021 
250CFTREx12NM_000492.3:c.1585-1G>ALRG_663t1:c.1585-1G>A, NM_000492.3:c.1585-1G>APathogenic10/01/2019 
251CFTREx12NM_000492.3:c.1586A>Gp.Asp529Gly | p.D529GLRG_663t1:c.1586A>G, NM_000492.3:c.1586A>GVOUS12/04/2017
252CFTREx12NM_000492.3:c.1606A>Gp.Lys536Glu | p.K536ELRG_663t1:c.1606A>G, NM_000492.3:c.1606A>GVOUS12/03/2019
253CFTREx12NM_000492.3:c.1612A>Cp.Asn538His | p.N538HLRG_663t1:c.1612A>C, NM_000492.3:c.1612A>CVOUS05/13/2019
254CFTREx12NM_000492.3:c.1616T>Cp.Ile539Thr | p.I539TLRG_663t1:c.1616T>C, NM_000492.3:c.1616T>CVOUS08/10/2020
255CFTREx12NM_000492.3:c.1624G>Tp.Gly542* | p.G542XLRG_663t1:c.1624G>T, NM_000492.3:c.1624G>TPathogenic05/28/2020 
256CFTREx12NM_000492.3:c.1630G>Ap.Gly544Ser | p.G544SLRG_663t1:c.1630G>A, NM_000492.3:c.1630G>AVOUS09/11/2019
257CFTREx12NM_000492.3:c.1645A>Cp.Ser549Arg | p.S549RLRG_663t1:c.1645A>C, NM_000492.3:c.1645A>CPathogenic** 
258CFTREx12NM_000492.3:c.1646G>Ap.Ser549Asn | p.S549NLRG_663t1:c.1646G>A, NM_000492.3:c.1646G>APathogenic09/17/2020 
259CFTREx12NM_000492.3:c.1651G>Ap.Gly551Ser | p.G551SLRG_663t1:c.1651G>A, NM_000492.3:c.1651G>APathogenic** 
260CFTREx12NM_000492.3:c.1652G>Ap.Gly551Asp | p.G551DLRG_663t1:c.1652G>A, NM_000492.3:c.1652G>APathogenic02/02/2021 
261CFTREx12NM_000492.3:c.1655A>Cp.Gln552Pro | p.Q552PLRG_663t1:c.1655A>C, NM_000492.3:c.1655A>CVOUS07/17/2019
262CFTREx12NM_000492.3:c.1657C>Tp.Arg553* | p.R553XLRG_663t1:c.1657C>T, NM_000492.3:c.1657C>TPathogenic08/15/2017 
263CFTREx12NM_000492.3:c.1666A>Gp.Ile556Val | p.I556VLRG_663t1:c.1666A>G, NM_000492.3:c.1666A>GBenign10/17/2014 
264CFTREx12NM_000492.3:c.1674A>Gp.Leu558= | p.L558=LRG_663t1:c.1674A>G, NM_000492.3:c.1674A>GVOUS08/07/2019
265CFTREx12NM_000492.3:c.1675G>Ap.Ala559Thr | p.A559TLRG_663t1:c.1675G>A, NM_000492.3:c.1675G>APathogenic02/22/2018 
266CFTREx12NM_000492.3:c.1675G>Cp.Ala559Pro | p.A559PVOUS**
267CFTREx12NM_000492.3:c.1679G>Cp.Arg560Thr | p.R560TLRG_663t1:c.1679G>C, NM_000492.3:c.1679G>CPathogenic05/09/2019 
268CFTREx12NM_000492.3:c.1679G>Ap.Arg560Lys | p.R560KLRG_663t1:c.1679G>A, NM_000492.3:c.1679G>APathogenic** 
269CFTREx12NM_000492.3:c.1679+1G>ALRG_663t1:c.1679+1G>A, NM_000492.3:c.1679+1G>APathogenic04/28/2016 
270CFTREx12NM_000492.3:c.1679+16T>CVOUS07/16/2019
271CFTREx12NM_000492.3:c.1679+18G>CVOUS10/02/2020
272CFTREx13NM_000492.3:c.1680-886A>GLRG_663t1:c.1680-886A>G, NM_000492.3:c.1680-886A>GPathogenic05/06/2020 
273CFTREx13NM_000492.3:c.1680-877G>TLikely pathogenic05/19/2020 
274CFTREx13NM_000492.3:c.1680-8C>ALRG_663t1:c.1680-8C>A, NM_000492.3:c.1680-8C>AVOUS07/17/2018
275CFTREx13NM_000492.3:c.1680-6T>GLRG_663t1:c.1680-6T>G, NM_000492.3:c.1680-6T>GVOUS06/13/2019
276CFTREx13NM_000492.3:c.1681G>Ap.Ala561Thr | p.A561TLRG_663t1:c.1681G>A, NM_000492.3:c.1681G>AVOUS09/10/2020
277CFTREx13NM_000492.3:c.1682C>Tp.Ala561Val | p.A561VLRG_663t1:c.1682C>T, NM_000492.3:c.1682C>TVOUS03/20/2020
278CFTREx13NM_000492.3:c.1684G>Ap.Val562Ile | p.V562ILRG_663t1:c.1684G>A, NM_000492.3:c.1684G>AVOUS11/08/2019
279CFTREx13NM_000492.3:c.1692delAp.Asp565Metfs*7 | p.D565MfsX7LRG_663t1:c.1692delA, NM_000492.3:c.1692delAPathogenic** 
280CFTREx13NM_000492.3:c.1706A>Gp.Tyr569Cys | p.Y569CPathogenic** 
281CFTREx13NM_000492.3:c.1707T>Cp.Tyr569= | p.Y569=VOUS12/16/2019
282CFTREx13NM_000492.3:c.1718C>Tp.Ser573Phe | p.S573FLRG_663t1:c.1718C>T, NM_000492.3:c.1718C>TVOUS03/13/2020
283CFTREx13NM_000492.3:c.1721C>Ap.Pro574His | p.P574HPathogenic** 
284CFTREx13NM_000492.3:c.1727G>Cp.Gly576Ala | p.G576ALRG_663t1:c.1727G>C, NM_000492.3:c.1727G>CVOUS10/12/2020
285CFTREx13NM_000492.3:c.1753G>Tp.Glu585* | p.E585XLRG_663t1:c.1753G>T, NM_000492.3:c.1753G>TPathogenic08/07/2017 
286CFTREx13NM_000492.3:c.1763A>Gp.Glu588Gly | p.E588GLRG_663t1:c.1763A>G, NM_000492.3:c.1763A>GVOUS06/30/2017
287CFTREx13NM_000492.3:c.1766+1G>APathogenic10/27/2020 
288CFTREx13NM_000492.3:c.1766+2T>ALRG_663t1:c.1766+2T>A, NM_000492.3:c.1766+2T>APathogenic08/31/2018 
289CFTREx13NM_000492.3:c.1766+3A>GLRG_663t1:c.1766+3A>G, NM_000492.3:c.1766+3A>GPathogenic05/23/2016 
290CFTREx13NM_000492.3:c.1766+26T>CVOUS**
291CFTREx13NM_000492.3:c.1766+73T>GLRG_663t1:c.1766+73T>G, NM_000492.3:c.1766+73T>GVOUS02/01/2021
292CFTREx14NM_000492.3:c.1801A>Gp.Ile601Val | p.I601VLRG_663t1:c.1801A>G, NM_000492.3:c.1801A>GVOUS03/25/2020
293CFTREx14NM_000492.3:c.1807G>Ap.Val603Ile | p.V603ILRG_663t1:c.1807G>A, NM_000492.3:c.1807G>AVOUS11/14/2019
294CFTREx14NM_000492.3:c.1811C>Gp.Thr604Ser | p.T604SLRG_663t1:c.1811C>G, NM_000492.3:c.1811C>GVOUS04/19/2019
295CFTREx14NM_000492.3:c.1820_1903delp.Met607_Gln634del | p.M607_Q634delLRG_663t1:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA, NM_000492.3:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAPathogenic11/09/2018 
296CFTREx14NM_000492.3:c.1821G>Ap.Met607Ile | p.M607ILRG_663t1:c.1821G>A, NM_000492.3:c.1821G>AVOUS05/19/2020
297CFTREx14NM_000492.3:c.1826A>Gp.His609Arg | p.H609RLRG_663t1:c.1826A>G, NM_000492.3:c.1826A>GPathogenic07/14/2019 
298CFTREx14NM_000492.3:c.1853T>Cp.Ile618Thr | p.I618TLRG_663t1:c.1853T>C, NM_000492.3:c.1853T>CPathogenic02/02/2021 
299CFTREx14NM_000492.3:c.1865G>Ap.Gly622Asp | p.G622DLRG_663t1:c.1865G>APathogenic09/17/2020 
300CFTREx14NM_000492.3:c.1882G>Cp.Gly628Arg | p.G628RLRG_663t1:c.1882G>C, NM_000492.3:c.1882G>CLikely pathogenic12/22/2017 
301CFTREx14NM_000492.3:c.1885A>Gp.Thr629Ala | p.T629ALRG_663t1:c.1885A>G, NM_000492.3:c.1885A>GVOUS11/13/2019
302CFTREx14NM_000492.3:c.1897C>Ap.Leu633Ile | p.L633ILRG_663t1:c.1897C>A, NM_000492.3:c.1897C>AVOUS05/11/2020
303CFTREx14NM_000492.3:c.1920T>Cp.Phe640= | p.F640=LRG_663t1:c.1920T>C, NM_000492.3:c.1920T>CVOUS01/11/2021
304CFTREx14NM_000492.3:c.1970delGPathogenic** 
305CFTREx14NM_000492.3:c.2002C>Tp.Arg668Cys | p.R668CLRG_663t1:c.2002C>T, NM_000492.3:c.2002C>TVOUS11/19/2020
306CFTREx14NM_000492.3:c.2042A>Tp.Glu681Val | p.E681VLRG_663t1:c.2042A>T, NM_000492.3:c.2042A>TVOUS03/25/2016
307CFTREx14NM_000492.3:c.2051_2052delAAinsGp.Lys684Serfs*38 | p.K684SfsX38LRG_663t1:c.2051_2052delinsG, NM_000492.3:c.2051_2052delinsGPathogenic01/02/2020 
308CFTREx14NM_000492.3:c.2052delAp.Lys684Asnfs*38 | p.K684NfsX38LRG_663t1:c.2052delA, NM_000492.3:c.2052delAPathogenic07/14/2020 
309CFTREx14NM_000492.3:c.2052dupAp.Gln685Thrfs*4 | p.Q685TfsX4LRG_663t1:c.2052dupA, NM_000492.3:c.2052dup, NM_000492.3:c.2052dupAPathogenic12/03/2013 
310CFTREx14NM_000492.3:c.2052_2053insAPathogenic** 
311CFTREx14NM_000492.3:c.2055A>Gp.Gln685= | p.Q685=LRG_663t1:c.2055A>G, NM_000492.3:c.2055A>GVOUS09/04/2018
312CFTREx14NM_000492.3:c.2079T>Gp.Phe693Leu | p.F693LLRG_663t1:c.2079T>G, NM_000492.3:c.2079T>GVOUS02/20/2020
313CFTREx14NM_000492.3:c.2125C>Tp.Arg709* | p.R709XLRG_663t1:c.2125C>T, NM_000492.3:c.2125C>TPathogenic05/31/2018 
314CFTREx14NM_000492.3:c.2145A>Cp.Gln715His | p.Q715HLRG_663t1:c.2145A>C, NM_000492.3:c.2145A>CVOUS07/26/2017
315CFTREx14NM_000492.3:c.2153C>Gp.Pro718Arg | p.P718RLRG_663t1:c.2153C>G, NM_000492.3:c.2153C>GVOUS11/04/2020
316CFTREx14NM_000492.3:c.2168G>Tp.Gly723Val | p.G723VLRG_663t1:c.2168G>T, NM_000492.3:c.2168G>TVOUS11/06/2020
317CFTREx14NM_000492.3:c.2169C>Tp.Gly723= | p.G723=LRG_663t1:c.2169C>T, NM_000492.3:c.2169C>TVOUS10/02/2020
318CFTREx14NM_000492.3:c.2173G>Ap.Glu725Lys | p.E725KLRG_663t1:c.2173G>A, NM_000492.3:c.2173G>AVOUS12/27/2016
319CFTREx14NM_000492.3:c.2175dupAp.Glu726Argfs*4 | p.E726RfsX4c2307dupA, LRG_663t1:c.2175dupA, NM_000492.3:c.2175dupAPathogenic01/19/2018 
320CFTREx14NM_000492.3:c.2191C>Tp.Pro731Ser | p.P731SLRG_663t1:c.2191C>T, NM_000492.3:c.2191C>TVOUS05/28/2020
321CFTREx14NM_000492.3:c.2193T>Cp.Pro731= | p.P731=LRG_663t1:c.2193T>C, NM_000492.3:c.2193T>CVOUS05/09/2016
322CFTREx14NM_000492.3:c.2205G>Cp.Arg735Ser | p.R735SLRG_663t1:c.2205G>C, NM_000492.3:c.2205G>CVOUS10/31/2018
323CFTREx14NM_000492.3:c.2210C>Tp.Ser737Phe | p.S737FLRG_663t1:c.2210C>T, NM_000492.3:c.2210C>TPathogenic** 
324CFTREx14NM_000492.3:c.2245C>Tp.Leu749= | p.L749=LRG_663t1:c.2245C>T, NM_000492.3:c.2245C>TVOUS08/07/2020
325CFTREx14NM_000492.3:c.2249C>Tp.Pro750Leu | p.P750LLRG_663t1:c.2249C>T, NM_000492.3:c.2249C>TVOUS01/12/2021
326CFTREx14NM_000492.3:c.2251C>Tp.Arg751Cys | p.R751CLRG_663t1:c.2251C>T, NM_000492.3:c.2251C>TVOUS12/27/2017
327CFTREx14NM_000492.3:c.2260G>Ap.Val754Met | p.V754MLRG_663t1:c.2260G>A, NM_000492.3:c.2260G>AVOUS12/09/2020
328CFTREx14NM_000492.3:c.2280G>Ap.Thr760= | p.T760=LRG_663t1:c.2280G>A, NM_000492.3:c.2280G>AVOUS01/21/2019
329CFTREx14NM_000492.3:c.2347A>Gp.Ile783Val | p.I783VLRG_663t1:c.2347A>G, NM_000492.3:c.2347A>GVOUS04/16/2019
330CFTREx14NM_000492.3:c.2353C>Tp.Arg785* | p.R785XLRG_663t1:c.2353C>T, NM_000492.3:c.2353C>TPathogenic09/24/2019 
331CFTREx14NM_000492.3:c.2372_2377delCACGAAp.Thr791_Arg792del | p.T791_R792delLRG_663t1:c.2372_2377delCACGAA, NM_000492.3:c.2372_2377delCACGAAVOUS08/11/2017
332CFTREx14NM_000492.3:c.2374C>Ap.Arg792= | p.R792=VOUS**
333CFTREx14NM_000492.3:c.2374C>Gp.Arg792Gly | p.R792GLRG_663t1:c.2374C>G, NM_000492.3:c.2374C>GVOUS08/18/2020
334CFTREx14NM_000492.3:c.2392C>Tp.Pro798Ser | p.P798SLRG_663t1:c.2392C>T, NM_000492.3:c.2392C>TVOUS01/27/2017
335CFTREx14NM_000492.3:c.2393C>Gp.Pro798Arg | p.P798RLRG_663t1:c.2393C>G, NM_000492.3:c.2393C>GVOUS12/02/2019
336CFTREx14NM_000492.3:c.2421A>Gp.Ile807Met | p.I807MLRG_663t1:c.2421A>G, NM_000492.3:c.2421A>GVOUS07/03/2020
337CFTREx14NM_000492.3:c.2424T>Cp.Tyr808= | p.Y808=LRG_663t1:c.2424T>C, NM_000492.3:c.2424T>CVOUS01/30/2020
338CFTREx14NM_000492.3:c.2450G>Tp.Gly817Val | p.G817VLRG_663t1:c.2450G>T, NM_000492.3:c.2450G>TVOUS12/03/2019
339CFTREx14NM_000492.3:c.2458A>Tp.Ile820Leu | p.I820LVOUS12/19/2019
340CFTREx14NM_000492.3:c.2475C>Tp.Asn825= | p.N825=LRG_663t1:c.2475C>T, NM_000492.3:c.2475C>TVOUS10/11/2019
341CFTREx14NM_000492.3:c.2482G>Ap.Asp828Asn | p.D828NLRG_663t1:c.2482G>A, NM_000492.3:c.2482G>AVOUS08/21/2019
342CFTREx14NM_000492.3:c.2490+5G>TLRG_663t1:c.2490+5G>T, NM_000492.3:c.2490+5G>TVOUS06/17/2016
343CFTREx15NM_000492.3:c.2506G>Tp.Asp836Tyr | p.D836YLRG_663t1:c.2506G>T, NM_000492.3:c.2506G>TVOUS01/28/2021
344CFTREx15NM_000492.3:c.2531C>Tp.Thr844Ile | p.T844ILRG_663t1:c.2531C>T, NM_000492.3:c.2531C>TVOUS12/14/2020
345CFTREx15NM_000492.3:c.2537G>Ap.Trp846* | p.W846XPathogenic** 
346CFTREx15NM_000492.3:c.2540A>Gp.Asn847Ser | p.N847SLRG_663t1:c.2540A>G, NM_000492.3:c.2540A>GVOUS01/07/2020
347CFTREx15NM_000492.3:c.2544A>Tp.Thr848= | p.T848=LRG_663t1:c.2544A>T, NM_000492.3:c.2544A>TVOUS01/16/2017
348CFTREx15NM_000492.3:c.2552G>Ap.Arg851Gln | p.R851QLRG_663t1:c.2552G>A, NM_000492.3:c.2552G>AVOUS10/27/2020
349CFTREx15NM_000492.3:c.2559T>Cp.Ile853= | p.I853=LRG_663t1:c.2559T>C, NM_000492.3:c.2559T>CVOUS01/15/2020
350CFTREx15NM_000492.3:c.2561_2562delCTinsTGp.Thr854Met | p.T854MLRG_663t1:c.2561_2562delinsTG, NM_000492.3:c.2561_2562delinsTGVOUS12/04/2018
351CFTREx15NM_000492.3:c.2562T>Gp.Thr854= | p.T854=LRG_663t1:c.2562T>G, NM_000492.3:c.2562T>GBenign11/20/2018 
352CFTREx15NM_000492.3:c.2583delTp.Phe861Leufs*3 | p.F861LfsX3LRG_663t1:c.2583delT, NM_000492.3:c.2583delTPathogenic10/30/2018 
353CFTREx15NM_000492.3:c.2597G>Ap.Cys866Tyr | p.C866YLRG_663t1:c.2597G>A, NM_000492.3:c.2597G>AVOUS12/03/2019
354CFTREx15NM_000492.3:c.2604A>Gp.Val868= | p.V868=LRG_663t1:c.2604A>G, NM_000492.3:c.2604A>GLikely benign06/30/2020 
355CFTREx15NM_000492.3:c.2619+1G>ALRG_663t1:c.2619+1G>A, NM_000492.3:c.2619+1G>APathogenic05/18/2017 
356CFTREx16NM_000492.3:c.2620-26A>GLRG_663t1:c.2620-26A>G, NM_000492.3:c.2620-26A>GLikely benign04/23/2019 
357CFTREx16NM_000492.3:c.2620-15C>GLRG_663t1:c.2620-15C>G, NM_000492.3:c.2620-15C>GBenign11/29/2016 
358CFTREx16NM_000492.3:c.2620-6T>CLRG_663t1:c.2620-6T>C, NM_000492.3:c.2620-6T>CVOUS06/09/2016
359CFTREx16NM_000492.3:c.2627C>Tp.Ala876Val | p.A876VLRG_663t1:c.2627C>T, NM_000492.3:c.2627C>TVOUS04/09/2020
360CFTREx16NM_000492.3:c.2657+2_2657+3insAc.2789insA, LRG_663t1:c.2657+2_2657+3insA, NM_000492.3:c.2657+2_2657+3insAPathogenic12/11/2020 
361CFTREx16NM_000492.3:c.2657+5G>ALRG_663t1:c.2657+5G>A, NM_000492.3:c.2657+5G>APathogenic12/04/2019 
362CFTREx17NM_000492.3:c.2658-2A>GLRG_663t1:c.2658-2A>G, NM_000492.3:c.2658-2A>GPathogenic10/17/2016 
363CFTREx17NM_000492.3:c.2659A>Cp.Thr887Pro | p.T887PLRG_663t1:c.2659A>C, NM_000492.3:c.2659A>CVOUS05/07/2019
364CFTREx17NM_000492.3:c.2665C>Tp.Leu889Phe | p.L889FLRG_663t1:c.2665C>T, NM_000492.3:c.2665C>TVOUS06/27/2018
365CFTREx17NM_000492.3:c.2672A>Gp.Asp891Gly | p.D891GLRG_663t1:c.2672A>G, NM_000492.3:c.2672A>GVOUS04/23/2020
366CFTREx17NM_000492.3:c.2673C>Gp.Asp891Glu | p.D891ELRG_663t1:c.2673C>G, NM_000492.3:c.2673C>GVOUS12/05/2016
367CFTREx17NM_000492.3:c.2684G>Ap.Ser895Asn | p.S895NLRG_663t1:c.2684G>A, NM_000492.3:c.2684G>AVOUS07/30/2020
368CFTREx17NM_000492.3:c.2709T>Cp.Tyr903= | p.Y903=LRG_663t1:c.2709T>C, NM_000492.3:c.2709T>CVOUS05/16/2019
369CFTREx17NM_000492.3:c.2723C>Ap.Thr908Asn | p.T908NLRG_663t1:c.2723C>A, NM_000492.3:c.2723C>AVOUS11/08/2019
370CFTREx17NM_000492.3:c.2724C>Tp.Thr908= | p.T908=LRG_663t1:c.2724C>T, NM_000492.3:c.2724C>TVOUS12/21/2020
371CFTREx17NM_000492.3:c.2732G>Cp.Ser911Thr | p.S911TVOUS01/13/2020
372CFTREx17NM_000492.3:c.2735C>Tp.Ser912Leu | p.S912LLRG_663t1:c.2735C>T, NM_000492.3:c.2735C>TVOUS03/21/2019
373CFTREx17NM_000492.3:c.2736G>Ap.Ser912= | p.S912=LRG_663t1:c.2736G>A, NM_000492.3:c.2736G>AVOUS01/02/2019
374CFTREx17NM_000492.3:c.2736G>Cp.Ser912= | p.S912=LRG_663t1:c.2736G>C, NM_000492.3:c.2736G>CVOUS08/22/2017
375CFTREx17NM_000492.3:c.2739T>Ap.Tyr913* | p.Y913XNM_000492.3:c.2739T>APathogenic** 
376CFTREx17NM_000492.3:c.2756A>Gp.Tyr919Cys | p.Y919CLRG_663t1:c.2756A>G, NM_000492.3:c.2756A>GVOUS07/06/2018
377CFTREx17NM_000492.3:c.2757C>Tp.Tyr919= | p.Y919=LRG_663t1:c.2757C>T, NM_000492.3:c.2757C>TVOUS11/02/2018
378CFTREx17NM_000492.3:c.2758G>Ap.Val920Met | p.V920MLRG_663t1:c.2758G>A, NM_000492.3:c.2758G>AVOUS01/08/2018
379CFTREx17NM_000492.3:c.2758G>Tp.Val920Leu | p.V920LLRG_663t1:c.2758G>T, NM_000492.3:c.2758G>TVOUS03/13/2017
380CFTREx17NM_000492.3:c.2769C>Tp.Ala923= | p.A923=LRG_663t1:c.2769C>T, NM_000492.3:c.2769C>TVOUS04/14/2017
381CFTREx17NM_000492.3:c.2770G>Ap.Asp924Asn | p.D924NLRG_663t1:c.2770G>A, NM_000492.3:c.2770G>AVOUS12/05/2016
382CFTREx17NM_000492.3:c.2772C>Ap.Asp924Glu | p.D924ELRG_663t1:c.2772C>A, NM_000492.3:c.2772C>AVOUS11/29/2017
383CFTREx17NM_000492.3:c.2797A>Gp.Arg933Gly | p.R933GLRG_663t1:c.2797A>G, NM_000492.3:c.2797A>GVOUS06/08/2017
384CFTREx17NM_000492.3:c.2805A>Gp.Leu935= | p.L935=LRG_663t1:c.2805A>G, NM_000492.3:c.2805A>GVOUS08/29/2019
385CFTREx17NM_000492.3:c.2813T>Gp.Val938Gly | p.V938GLRG_663t1:c.2813T>G, NM_000492.3:c.2813T>GVOUS10/19/2017
386CFTREx17NM_000492.3:c.2820T>Gp.Thr940= | p.T940=LRG_663t1:c.2820T>G, NM_000492.3:c.2820T>GLikely benign12/15/2016 
387CFTREx17NM_000492.3:c.2822delTp.Leu941Glnfs*27 | p.L941QfsX27LRG_663t1:c.2822delT, NM_000492.3:c.2822delTPathogenic10/25/2018 
388CFTREx17NM_000492.3:c.2832G>Ap.Val944= | p.V944=LRG_663t1:c.2832G>A, NM_000492.3:c.2832G>AVOUS12/11/2019
389CFTREx17NM_000492.3:c.2834C>Tp.Ser945Leu | p.S945LLRG_663t1:c.2834C>T, NM_000492.3:c.2834C>TPathogenic04/13/2015 
390CFTREx17NM_000492.3:c.2855T>Cp.Met952Thr | p.M952TLRG_663t1:c.2855T>C, NM_000492.3:c.2855T>CVOUS10/07/2016
391CFTREx17NM_000492.3:c.2856G>Cp.Met952Ile | p.M952ILRG_663t1:c.2856G>C, NM_000492.3:c.2856G>CLikely pathogenic01/12/2021 
392CFTREx17NM_000492.3:c.2856G>Ap.Met952Ile | p.M952ILRG_663t1:c.2856G>A, NM_000492.3:c.2856G>AVOUS05/17/2018
393CFTREx17NM_000492.3:c.2882T>Cp.Met961Thr | p.M961TLRG_663t1:c.2882T>C, NM_000492.3:c.2882T>CVOUS03/28/2017
394CFTREx17NM_000492.3:c.2895C>Ap.Asn965Lys | p.N965KLRG_663t1:c.2895C>A, NM_000492.3:c.2895C>AVOUS01/22/2020
395CFTREx17NM_000492.3:c.2898G>Ap.Thr966= | p.T966=LRG_663t1:c.2898G>A, NM_000492.3:c.2898G>ABenign10/12/2017 
396CFTREx17NM_000492.3:c.2900T>Cp.Leu967Ser | p.L967SLRG_663t1:c.2900T>C, NM_000492.3:c.2900T>CVOUS12/03/2020
397CFTREx17NM_000492.3:c.2908+4C>ALRG_663t1:c.2908+4C>A, NM_000492.3:c.2908+4C>AVOUS04/12/2018
398CFTREx17NM_000492.3:c.2908+19G>CVOUS**
399CFTREx18NM_000492.3:c.2909-4A>GLRG_663t1:c.2909-4A>G, NM_000492.3:c.2909-4A>GVOUS11/23/2016
400CFTREx18NM_000492.3:c.2909_2924dupGTGGGATTCTTAATAGp.Phe976Trpfs*4 | p.F976WfsX4LRG_663t1:c.2909_2924dupGTGGGATTCTTAATAG, NM_000492.3:c.2909_2924dupGTGGGATTCTTAATAGPathogenic11/05/2019 
401CFTREx18NM_000492.3:c.2946T>Gp.Ile982Met | p.I982MLRG_663t1:c.2946T>G, NM_000492.3:c.2946T>GVOUS07/22/2019
402CFTREx18NM_000492.3:c.2981T>Gp.Phe994Cys | p.F994CLRG_663t1:c.2981T>G, NM_000492.3:c.2981T>GVOUS08/09/2018
403CFTREx18NM_000492.3:c.2988G>Ap.Gln996= | p.Q996=LRG_663t1:c.2988G>A, NM_000492.3:c.2988G>APathogenic06/15/2017 
404CFTREx18NM_000492.3:c.2988+1G>A3120+1 G>A, LRG_663t1:c.2988+1G>A, NM_000492.3:c.2988+1G>APathogenic02/08/2021 
405CFTREx19NM_000492.3:c.2991G>Cp.Leu997Phe | p.L997FLRG_663t1:c.2991G>C, NM_000492.3:c.2991G>CVOUS10/09/2020
406CFTREx19NM_000492.3:c.2998A>Tp.Ile1000Phe | p.I1000FLRG_663t1:c.2998A>T, NM_000492.3:c.2998A>TVOUS12/11/2018
407CFTREx19NM_000492.3:c.3001G>Ap.Val1001Met | p.V1001MLRG_663t1:c.3001G>A, NM_000492.3:c.3001G>AVOUS09/06/2018
408CFTREx19NM_000492.3:c.3024C>Tp.Val1008= | p.V1008=NM_000492.3:c.3024C>TVOUS02/12/2015
409CFTREx19NM_000492.3:c.3025G>Ap.Ala1009Thr | p.A1009TLRG_663t1:c.3025G>A, NM_000492.3:c.3025G>AVOUS10/22/2019
410CFTREx19NM_000492.3:c.3036A>Gp.Gln1012= | p.Q1012=LRG_663t1:c.3036A>G, NM_000492.3:c.3036A>GVOUS09/19/2019
411CFTREx19NM_000492.3:c.3038C>Tp.Pro1013Leu | p.P1013LLRG_663t1:c.3038C>T, NM_000492.3:c.3038C>TVOUS12/26/2019
412CFTREx19NM_000492.3:c.3038C>Ap.Pro1013His | p.P1013HLRG_663t1:c.3038C>A, NM_000492.3:c.3038C>AVOUS08/27/2020
413CFTREx19NM_000492.3:c.3041A>Gp.Tyr1014Cys | p.Y1014CLRG_663t1:c.3041A>G, NM_000492.3:c.3041A>GVOUS02/24/2021
414CFTREx19NM_000492.3:c.3062C>Tp.Pro1021Leu | p.P1021LLRG_663t1:c.3062C>T, NM_000492.3:c.3062C>TVOUS12/01/2020
415CFTREx19NM_000492.3:c.3067_3072delATAGTGp.Ile1023_Val1024del | p.I1023_V1024delLRG_663t1:c.3067_3072delATAGTG, NM_000492.3:c.3067_3072delATAGTGPathogenic04/03/2020 
416CFTREx19NM_000492.3:c.3073G>Tp.Ala1025Ser | p.A1025SLRG_663t1:c.3073G>T, NM_000492.3:c.3073G>TVOUS12/13/2018
417CFTREx19NM_000492.3:c.3080T>Cp.Ile1027Thr | p.I1027TLRG_663t1:c.3080T>C, NM_000492.3:c.3080T>CBenign12/18/2012 
418CFTREx19NM_000492.3:c.3083T>Gp.Met1028Arg | p.M1028RLRG_663t1:c.3083T>G, NM_000492.3:c.3083T>GVOUS08/27/2019
419CFTREx19NM_000492.3:c.3095A>Gp.Tyr1032Cys | p.Y1032CLRG_663t1:c.3095A>G, NM_000492.3:c.3095A>GLikely pathogenic06/11/2018 
420CFTREx19NM_000492.3:c.3100C>Tp.Leu1034Phe | p.L1034FLRG_663t1:c.3100C>T, NM_000492.3:c.3100C>TVOUS03/08/2017
421CFTREx19NM_000492.3:c.3121A>Cp.Lys1041Gln | p.K1041QLRG_663t1:c.3121A>C, NM_000492.3:c.3121A>CVOUS11/14/2019
422CFTREx19NM_000492.3:c.3139G>Tp.Gly1047Cys | p.G1047CLRG_663t1:c.3139G>T, NM_000492.3:c.3139G>TVOUS10/02/2015
423CFTREx19NM_000492.3:c.3139delGPathogenic** 
424CFTREx19NM_000492.3:c.3139+1delGPathogenic** 
425CFTREx19NM_000492.3:c.3139+8A>GLRG_663t1:c.3139+8A>G, NM_000492.3:c.3139+8A>GVOUS10/01/2018
426CFTREx19NM_000492.3:c.3139+18C>TVOUS**
427CFTREx19NM_000492.3:c.3139+42A>TBenign** 
428CFTREx20NM_000492.3:c.3140-26A>GLRG_663t1:c.3140-26A>G, NM_000492.3:c.3140-26A>GPathogenic04/27/2017 
429CFTREx20NM_000492.3:c.3154T>Gp.Phe1052Val | p.F1052VLRG_663t1:c.3154T>G, NM_000492.3:c.3154T>GVOUS07/06/2020
430CFTREx20NM_000492.3:c.3169A>Gp.Thr1057Ala | p.T1057ALRG_663t1:c.3169A>G, NM_000492.3:c.3169A>GVOUS08/06/2020
431CFTREx20NM_000492.3:c.3177A>Gp.Leu1059= | p.L1059=LRG_663t1:c.3177A>G, NM_000492.3:c.3177A>GVOUS09/17/2019
432CFTREx20NM_000492.3:c.3181G>Cp.Gly1061Arg | p.G1061RLRG_663t1:c.3181G>C, NM_000492.3:c.3181G>CLikely pathogenic03/02/2018 
433CFTREx20NM_000492.3:c.3194T>Cp.Leu1065Pro | p.L1065PNM_000492.3:c.3194T>CPathogenic12/16/2015 
434CFTREx20NM_000492.3:c.3196C>Tp.Arg1066Cys | p.R1066CLRG_663t1:c.3196C>T, NM_000492.3:c.3196C>TPathogenic06/30/2020 
435CFTREx20NM_000492.3:c.3197G>Ap.Arg1066His | p.R1066HLRG_663t1:c.3197G>A, NM_000492.3:c.3197G>APathogenic12/10/2018 
436CFTREx20NM_000492.3:c.3199G>Ap.Ala1067Thr | p.A1067TNM_000492.3:c.3199G>AVOUS04/16/2013
437CFTREx20NM_000492.3:c.3200C>Tp.Ala1067Val | p.A1067VNM_000492.3:c.3200C>TVOUS02/11/2016
438CFTREx20NM_000492.3:c.3204C>Tp.Phe1068= | p.F1068=LRG_663t1:c.3204C>T, NM_000492.3:c.3204C>TVOUS08/03/2020
439CFTREx20NM_000492.3:c.3205G>Ap.Gly1069Arg | p.G1069RLRG_663t1:c.3205G>A, NM_000492.3:c.3205G>AVOUS08/27/2019
440CFTREx20NM_000492.3:c.3208C>Tp.Arg1070Trp | p.R1070WLRG_663t1:c.3208C>T, NM_000492.3:c.3208C>TLikely pathogenic01/27/2021 
441CFTREx20NM_000492.3:c.3209G>Ap.Arg1070Gln | p.R1070QLRG_663t1:c.3209G>A, NM_000492.3:c.3209G>APathogenic03/11/2020 
442CFTREx20NM_000492.3:c.3222T>Ap.Phe1074Leu | p.F1074LLRG_663t1:c.3222T>A, NM_000492.3:c.3222T>ALikely pathogenic05/23/2018 
443CFTREx20NM_000492.3:c.3256A>Tp.Thr1086Ser | p.T1086SLRG_663t1:c.3256A>T, NM_000492.3:c.3256A>TVOUS06/12/2017
444CFTREx20NM_000492.3:c.3256A>Gp.Thr1086Ala | p.T1086ALRG_663t1:c.3256A>G, NM_000492.3:c.3256A>GVOUS03/12/2019
445CFTREx20NM_000492.3:c.3273G>Cp.Leu1091Phe | p.L1091FLRG_663t1:c.3273G>C, NM_000492.3:c.3273G>CVOUS01/20/2020
446CFTREx20NM_000492.3:c.3274T>Cp.Tyr1092His | p.Y1092HLRG_663t1:c.3274T>C, NM_000492.3:c.3274T>CVOUS01/22/2018
447CFTREx20NM_000492.3:c.3275A>Gp.Tyr1092Cys | p.Y1092CLRG_663t1:c.3275A>G, NM_000492.3:c.3275A>GVOUS03/01/2017
448CFTREx20NM_000492.3:c.3276C>Ap.Tyr1092* | p.Y1092XLRG_663t1:c.3276C>A, NM_000492.3:c.3276C>APathogenic08/14/2018 
449CFTREx20NM_000492.3:c.3285A>Tp.Thr1095= | p.T1095=LRG_663t1:c.3285A>T, NM_000492.3:c.3285A>TBenign12/21/2015 
450CFTREx20NM_000492.3:c.3289C>Tp.Arg1097Cys | p.R1097CLRG_663t1:c.3289C>T, NM_000492.3:c.3289C>TVOUS05/16/2019
451CFTREx20NM_000492.3:c.3297C>Ap.Phe1099Leu | p.F1099LLRG_663t1:c.3297C>A, NM_000492.3:c.3297C>AVOUS04/08/2016
452CFTREx20NM_000492.3:c.3302T>Ap.Met1101Lys | p.M1101KLRG_663t1:c.3302T>A, NM_000492.3:c.3302T>APathogenic08/09/2019 
453CFTREx20NM_000492.3:c.3303G>Ap.Met1101Ile | p.M1101ILRG_663t1:c.3303G>A, NM_000492.3:c.3303G>AVOUS09/24/2018
454CFTREx20NM_000492.3:c.3306A>Gp.Arg1102= | p.R1102=LRG_663t1:c.3306A>G, NM_000492.3:c.3306A>GVOUS08/13/2019
455CFTREx20NM_000492.3:c.3322G>Cp.Val1108Leu | p.V1108LLRG_663t1:c.3322G>C, NM_000492.3:c.3322G>CVOUS08/06/2020
456CFTREx20NM_000492.3:c.3367+45T>CNM_000492.3:c.3367+45T>CVOUS**
457CFTREx21NM_000492.3:c.3368-4A>GLRG_663t1:c.3368-4A>G, NM_000492.3:c.3368-4A>GVOUS07/07/2017
458CFTREx21NM_000492.3:c.3382A>Gp.Arg1128Gly | p.R1128GLRG_663t1:c.3382A>G, NM_000492.3:c.3382A>GVOUS07/28/2016
459CFTREx21NM_000492.3:c.3407C>Tp.Ala1136Val | p.A1136VLRG_663t1:c.3407C>T, NM_000492.3:c.3407C>TVOUS02/02/2018
460CFTREx21NM_000492.3:c.3409A>Gp.Met1137Val | p.M1137VLRG_663t1:c.3409A>G, NM_000492.3:c.3409A>GVOUS10/11/2019
461CFTREx21NM_000492.3:c.3411G>Cp.Met1137Ile | p.M1137ILRG_663t1:c.3411G>C, NM_000492.3:c.3411G>CVOUS12/23/2019
462CFTREx21NM_000492.3:c.3415A>Gp.Ile1139Val | p.I1139VLRG_663t1:c.3415A>G, NM_000492.3:c.3415A>GVOUS07/30/2020
463CFTREx21NM_000492.3:c.3420G>Ap.Met1140Ile | p.M1140ILRG_663t1:c.3420G>A, NM_000492.3:c.3420G>AVOUS03/07/2019
464CFTREx21NM_000492.3:c.3429G>Ap.Leu1143= | p.L1143=LRG_663t1:c.3429G>A, NM_000492.3:c.3429G>AVOUS03/25/2020
465CFTREx21NM_000492.3:c.3454G>Cp.Asp1152His | p.D1152HLRG_663t1:c.3454G>C, NM_000492.3:c.3454G>CPathogenic01/15/2021 
466CFTREx21NM_000492.3:c.3468G>Ap.Leu1156= | p.L1156=LRG_663t1:c.3468G>AVOUS12/11/2014
467CFTREx21NM_000492.3:c.3468G>Tp.Leu1156Phe | p.L1156FLRG_663t1:c.3468G>T, NM_000492.3:c.3468G>TVOUS12/31/2020
468CFTREx21NM_000492.3:c.3468+2dupTLRG_663t1:c.3468+2_3468+3insT, LRG_663t1:c.3468+2dupT, NM_000492.3:c.3468+2_3468+3insT, NM_000492.3:c.3468+2dupTLikely pathogenic12/27/2016 
469CFTREx21NM_000492.3:c.3468+10A>GVOUS12/08/2020
470CFTREx22NM_000492.3:c.3469-20T>CLRG_663t1:c.3469-20T>C, NM_000492.3:c.3469-20T>CBenign03/29/2019 
471CFTREx22NM_000492.3:c.3469-17T>CLRG_663t1:c.3469-17T>C, NM_000492.3:c.3469-17T>CVOUS05/29/2020
472CFTREx22NM_000492.3:c.3472C>Tp.Arg1158* | p.R1158XLRG_663t1:c.3472C>T, NM_000492.3:c.3472C>TPathogenic10/29/2018 
473CFTREx22NM_000492.3:c.3484C>Tp.Arg1162* | p.R1162XLRG_663t1:c.3484C>T, NM_000492.3:c.3484C>TPathogenic10/27/2020 
474CFTREx22NM_000492.3:c.3485G>Tp.Arg1162Leu | p.R1162LLRG_663t1:c.3485G>T, NM_000492.3:c.3485G>TVOUS10/20/2020
475CFTREx22NM_000492.3:c.3485G>Ap.Arg1162Gln | p.R1162QLRG_663t1:c.3485G>A, NM_000492.3:c.3485G>AVOUS04/03/2018
476CFTREx22NM_000492.3:c.3503A>Gp.Asp1168Gly | p.D1168GLRG_663t1:c.3503A>G, NM_000492.3:c.3503A>GVOUS05/30/2017
477CFTREx22NM_000492.3:c.3508C>Tp.Pro1170Ser | p.P1170SLRG_663t1:c.3508C>T, NM_000492.3:c.3508C>TVOUS10/11/2018
478CFTREx22NM_000492.3:c.3517G>Ap.Gly1173Ser | p.G1173SLRG_663t1:c.3517G>A, NM_000492.3:c.3517G>AVOUS02/15/2021
479CFTREx22NM_000492.3:c.3528delCp.Lys1177Serfs*15 | p.K1177SfsX15LRG_663t1:c.3528delC, NM_000492.3:c.3528delCPathogenic04/29/2020 
480CFTREx22NM_000492.3:c.3558A>Gp.Gln1186= | p.Q1186=LRG_663t1:c.3558A>G, NM_000492.3:c.3558A>GVOUS05/20/2020
481CFTREx22NM_000492.3:c.3564G>Ap.Ser1188= | p.S1188=LRG_663t1:c.3564G>A, NM_000492.3:c.3564G>AVOUS06/20/2013
482CFTREx22NM_000492.3:c.3588A>Tp.Ser1196= | p.S1196=LRG_663t1:c.3588A>T, NM_000492.3:c.3588A>TVOUS08/30/2018
483CFTREx22NM_000492.3:c.3607A>Gp.Ile1203Val | p.I1203VNM_000492.3:c.3607A>GVOUS01/23/2014
484CFTREx22NM_000492.3:c.3612G>Ap.Trp1204* | p.W1204XLRG_663t1:c.3612G>A, NM_000492.3:c.3612G>APathogenic01/03/2013 
485CFTREx22NM_000492.3:c.3627A>Gp.Gln1209= | p.Q1209=LRG_663t1:c.3627A>G, NM_000492.3:c.3627A>GVOUS11/09/2020
486CFTREx22NM_000492.3:c.3650C>Tp.Ala1217Val | p.A1217VLRG_663t1:c.3650C>T, NM_000492.3:c.3650C>TVOUS10/20/2020
487CFTREx22NM_000492.3:c.3659C>Tp.Thr1220Ile | p.T1220ILRG_663t1:c.3659C>T, NM_000492.3:c.3659C>TVOUS03/11/2020
488CFTREx22NM_000492.3:c.3665G>Ap.Gly1222Asp | p.G1222DLRG_663t1:c.3665G>A, NM_000492.3:c.3665G>AVOUS09/05/2017
489CFTREx22NM_000492.3:c.3682G>Cp.Glu1228Gln | p.E1228QLRG_663t1:c.3682G>C, NM_000492.3:c.3682G>CVOUS05/29/2019
490CFTREx22NM_000492.3:c.3705T>Gp.Ser1235Arg | p.S1235RLRG_663t1:c.3705T>G, NM_000492.3:c.3705T>GBenign07/24/2012 
491CFTREx22NM_000492.3:c.3710G>Ap.Gly1237Asp | p.G1237DLRG_663t1:c.3710G>A, NM_000492.3:c.3710G>AVOUS09/17/2018
492CFTREx22NM_000492.3:c.3713A>Gp.Gln1238Arg | p.Q1238RLRG_663t1:c.3713A>G, NM_000492.3:c.3713A>GVOUS07/31/2019
493CFTREx22NM_000492.3:c.3717+40A>GLRG_663t1:c.3717+40A>G, NM_000492.3:c.3717+40A>GLikely pathogenic08/31/2017 
494CFTREx22NM_000492.3:c.3717+45G>ALRG_663t1:c.3717+45G>A, NM_000492.3:c.3717+45G>ABenign03/14/2019 
495CFTREx22NM_000492.3:c.3717+12191C>T3849+10kb C>T, LRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic12/03/2020 
496CFTREx23NM_000492.3:c.3718-2530A>GLRG_663t1:c.3718-2530A>G, NM_000492.3:c.3718-2530A>GBenign10/26/2016 
497CFTREx23NM_000492.3:c.3718-2477C>TLRG_663t1:c.3718-2477C>T, NM_000492.3:c.3718-2477C>TPathogenic05/08/2017 
498CFTREx23NM_000492.3:c.3718-24G>ALRG_663t1:c.3718-24G>A, NM_000492.3:c.3718-24G>AVOUS12/21/2020
499CFTREx23NM_000492.3:c.3723C>Ap.Gly1241= | p.G1241=LRG_663t1:c.3723C>A, NM_000492.3:c.3723C>AVOUS02/27/2020
500CFTREx23NM_000492.3:c.3744delAp.Lys1250Argfs*9 | p.K1250RfsX9LRG_663t1:c.3744delA, NM_000492.3:c.3744delAPathogenic10/02/2018 
501CFTREx23NM_000492.3:c.3747G>Ap.Gly1249= | p.G1249=LRG_663t1:c.3747G>A, NM_000492.3:c.3747G>AVOUS01/15/2015
502CFTREx23NM_000492.3:c.3759delGp.Leu1253Phefs*6 | p.L1253FfsX6LRG_663t1:c.3759delG, NM_000492.3:c.3759delGPathogenic12/30/2020 
503CFTREx23NM_000492.3:c.3761T>Gp.Leu1254* | p.L1254XPathogenic** 
504CFTREx23NM_000492.3:c.3762A>Gp.Leu1254= | p.L1254=LRG_663t1:c.3762A>G, NM_000492.3:c.3762A>GVOUS06/19/2019
505CFTREx23NM_000492.3:c.3764C>Ap.Ser1255* | p.S1255XPathogenic** 
506CFTREx23NM_000492.3:c.3772T>Cp.Leu1258= | p.L1258=LRG_663t1:c.3772T>C, NM_000492.3:c.3772T>CVOUS06/26/2017
507CFTREx23NM_000492.3:c.3794G>Tp.Gly1265Val | p.G1265VLRG_663t1:c.3794G>T, NM_000492.3:c.3794G>TVOUS06/08/2017
508CFTREx23NM_000492.3:c.3808G>Ap.Asp1270Asn | p.D1270NLRG_663t1:c.3808G>A, NM_000492.3:c.3808G>AVOUS12/22/2020
509CFTREx23NM_000492.3:c.3811G>Ap.Gly1271Ser | p.G1271SVOUS12/26/2019
510CFTREx23NM_000492.3:c.3815T>Ap.Val1272Glu | p.V1272ENM_000492.3:c.3815T>AVOUS04/23/2015
511CFTREx23NM_000492.3:c.3836T>Cp.Leu1279Ser | p.L1279SLRG_663t1:c.3836T>C, NM_000492.3:c.3836T>CVOUS04/04/2018
512CFTREx23NM_000492.3:c.3844T>Cp.Trp1282Arg | p.W1282RLRG_663t1:c.3844T>C, NM_000492.3:c.3844T>CPathogenic07/02/2020 
513CFTREx23NM_000492.3:c.3846G>Ap.Trp1282* | p.W1282XLRG_663t1:c.3846G>A, NM_000492.3:c.3846G>APathogenic12/05/2019 
514CFTREx23NM_000492.3:c.3846G>Cp.Trp1282Cys | p.W1282CLRG_663t1:c.3846G>C, NM_000492.3:c.3846G>CVOUS08/15/2018
515CFTREx23NM_000492.3:c.3852A>Gp.Lys1284= | p.K1284=LRG_663t1:c.3852A>G, NM_000492.3:c.3852A>GVOUS10/19/2017
516CFTREx23NM_000492.3:c.3853G>Ap.Ala1285Thr | p.A1285TLRG_663t1:c.3853G>A, NM_000492.3:c.3853G>AVOUS10/10/2017
517CFTREx23NM_000492.3:c.3854C>Tp.Ala1285Val | p.A1285VLRG_663t1:c.3854C>T, NM_000492.3:c.3854C>TVOUS02/01/2021
518CFTREx23NM_000492.3:c.3870A>Gp.Pro1290= | p.P1290=LRG_663t1:c.3870A>G, NM_000492.3:c.3870A>GBenign11/01/2018 
519CFTREx23NM_000492.3:c.3873+7A>TLRG_663t1:c.3873+7A>T, NM_000492.3:c.3873+7A>TVOUS09/20/2017
520CFTREx24NM_000492.3:c.3874-4522A>GLRG_663t1:c.3874-4522A>G, NM_000492.3:c.3874-4522A>GLikely pathogenic08/26/2019 
521CFTREx24NM_000492.3:c.3874-21_3874-15dupTTCTTTTLRG_663t1:c.3874-15_3874-14insTTCTTTT, LRG_663t1:c.3874-21_3874-15dupTTCTTTT, LRG_663t1:c.3874-21_3874-15insTTCTTTT, NM_000492.3:c.3874-15_3874-14insTTCTTTT, NM_000492.3:c.3874-21_3874-15dupTTCTTTT, NM_000492.3:c.3874-21_3874-15insTTCTTTTVOUS02/22/2017
522CFTREx24NM_000492.3:c.3874-14_3874-10delCTTTTLRG_663t1:c.3874-14_3874-10delCTTTT, NM_000492.3:c.3874-14_3874-10delCTTTTLikely benign11/27/2018 
523CFTREx24NM_000492.3:c.3874-14C>GVOUS12/10/2019
524CFTREx24NM_000492.3:c.3877G>Ap.Val1293Ile | p.V1293ILRG_663t1:c.3877G>A, NM_000492.3:c.3877G>AVOUS01/13/2021
525CFTREx24NM_000492.3:c.3893G>Tp.Gly1298Val | p.G1298VLRG_663t1:c.3893G>T, NM_000492.3:c.3893G>TVOUS10/13/2017
526CFTREx24NM_000492.3:c.3895A>Gp.Thr1299Ala | p.T1299ALRG_663t1:c.3895A>G, NM_000492.3:c.3895A>GVOUS09/06/2018
527CFTREx24NM_000492.3:c.3897A>Gp.Thr1299= | p.T1299=LRG_663t1:c.3897A>G, NM_000492.3:c.3897A>GLikely benign01/11/2017 
528CFTREx24NM_000492.3:c.3909C>Gp.Asn1303Lys | p.N1303KLRG_663t1:c.3909C>G, NM_000492.3:c.3909C>GPathogenic12/18/2020 
529CFTREx24NM_000492.3:c.3918C>Gp.Pro1306= | p.P1306=LRG_663t1:c.3918C>G, NM_000492.3:c.3918C>GVOUS09/15/2020
530CFTREx24NM_000492.3:c.3925C>Gp.Gln1309Glu | p.Q1309ELRG_663t1:c.3925C>G, NM_000492.3:c.3925C>GVOUS06/04/2020
531CFTREx24NM_000492.3:c.3933T>Gp.Ser1311Arg | p.S1311RLRG_663t1:c.3933T>G, NM_000492.3:c.3933T>GVOUS09/27/2016
532CFTREx24NM_000492.3:c.3963+6G>TVOUS01/21/2020
533CFTREx25NM_000492.3:c.3964-16T>CNM_000492.3:c.3964-16T>CVOUS08/25/2014
534CFTREx25NM_000492.3:c.3983T>Cp.Ile1328Thr | p.I1328TLRG_663t1:c.3983T>C, NM_000492.3:c.3983T>CVOUS04/09/2019
535CFTREx25NM_000492.3:c.3999delGNM_000492.3:c.3999delGPathogenic09/04/2015 
536CFTREx25NM_000492.3:c.4015C>Tp.Leu1339Phe | p.L1339FLRG_663t1:c.4015C>T, NM_000492.3:c.4015C>TVOUS03/04/2021
537CFTREx25NM_000492.3:c.4036C>Tp.Leu1346= | p.L1346=LRG_663t1:c.4036C>T, NM_000492.3:c.4036C>TVOUS11/15/2017
538CFTREx25NM_000492.3:c.4045G>Ap.Gly1349Ser | p.G1349SLRG_663t1:c.4045G>A, NM_000492.3:c.4045G>AVOUS06/27/2017
539CFTREx25NM_000492.3:c.4053_4054delGCinsAGp.Gln1352Glu | p.Q1352ELRG_663t1:c.4053_4054delinsAG, NM_000492.3:c.4053_4054delinsAGVOUS09/21/2018
540CFTREx25NM_000492.3:c.4056G>Cp.Gln1352His | p.Q1352HLRG_663t1:c.4056G>C, NM_000492.3:c.4056G>CVOUS10/02/2020
541CFTREx25NM_000492.3:c.4058delTp.Leu1353* | p.L1353XLRG_663t1:c.4058delT, NM_000492.3:c.4058delTPathogenic02/23/2018 
542CFTREx25NM_000492.3:c.4077_4080delTGTTinsAAp.Val1360Thrfs*3 | p.V1360TfsX3LRG_663t1:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delinsAAPathogenic** 
543CFTREx25NM_000492.3:c.4092G>Ap.Ala1364= | p.A1364=LRG_663t1:c.4092G>A, NM_000492.3:c.4092G>AVOUS07/12/2019
544CFTREx25NM_000492.3:c.4097T>Cp.Ile1366Thr | p.I1366TLRG_663t1:c.4097T>C, NM_000492.3:c.4097T>CVOUS06/02/2020
545CFTREx25NM_000492.3:c.4121C>Gp.Ala1374Gly | p.A1374GLRG_663t1:c.4121C>G, NM_000492.3:c.4121C>GVOUS02/17/2017
546CFTREx25NM_000492.3:c.4123C>Ap.His1375Asn | p.H1375NLRG_663t1:c.4123C>A, NM_000492.3:c.4123C>AVOUS01/25/2021
547CFTREx25NM_000492.3:c.4129G>Cp.Asp1377His | p.D1377HLRG_663t1:c.4129G>C, NM_000492.3:c.4129G>CVOUS06/23/2016
548CFTREx26NM_000492.3:c.4159A>Gp.Thr1387Ala | p.T1387ALRG_663t1:c.4159A>G, NM_000492.3:c.4159A>GVOUS12/21/2017
549CFTREx26NM_000492.3:c.4195C>Gp.Leu1399Val | p.L1399VLRG_663t1:c.4195C>G, NM_000492.3:c.4195C>GVOUS05/11/2018
550CFTREx26NM_000492.3:c.4197_4198delCTp.Cys1400* | p.C1400XLRG_663t1:c.4197_4198delCT, NM_000492.3:c.4197_4198delCTPathogenic06/05/2020 
551CFTREx26NM_000492.3:c.4197C>Gp.Leu1399= | p.L1399=LRG_663t1:c.4197C>G, NM_000492.3:c.4197C>GVOUS03/19/2020
552CFTREx26NM_000492.3:c.4197C>Tp.Leu1399= | p.L1399=LRG_663t1:c.4197C>T, NM_000492.3:c.4197C>TVOUS09/30/2019
553CFTREx26NM_000492.3:c.4209G>Tp.Arg1403Ser | p.R1403SLRG_663t1:c.4209G>T, NM_000492.3:c.4209G>TVOUS05/28/2020
554CFTREx26NM_000492.3:c.4232A>Cp.Gln1411Pro | p.Q1411PLRG_663t1:c.4232A>C, NM_000492.3:c.4232A>CVOUS12/23/2019
555CFTREx26NM_000492.3:c.4241T>Cp.Leu1414Ser | p.L1414SLRG_663t1:c.4241T>C, NM_000492.3:c.4241T>CVOUS02/01/2018
556CFTREx26NM_000492.3:c.4242+10T>CLRG_663t1:c.4242+10T>C, NM_000492.3:c.4242+10T>CBenign05/24/2013 
557CFTREx26NM_000492.3:c.4242+13A>GBenign04/29/2013 
558CFTREx27NM_000492.3:c.*2G>ALRG_663t1:c.*2G>A, NM_000492.3:c.*2G>AVOUS04/16/2020
559CFTREx27NM_000492.3:c.*10T>ALRG_663t1:c.*10T>A, NM_000492.3:c.*10T>AVOUS04/01/2020
560CFTREx27NM_000492.3:c.*1043A>CLRG_663t1:c.*1043A>C, NM_000492.3:c.*1043A>CBenign03/28/2017 
561CFTREx27NM_000492.3:c.4243-20A>GLRG_663t1:c.4243-20A>G, NM_000492.3:c.4243-20A>GVOUS07/14/2020
562CFTREx27NM_000492.3:c.4243-5C>TLRG_663t1:c.4243-5C>T, NM_000492.3:c.4243-5C>TBenign08/25/2015 
563CFTREx27NM_000492.3:c.4251delAp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4251delA, NM_000492.3:c.4251delAPathogenic10/26/2017 
564CFTREx27NM_000492.3:c.4252delGp.Glu1418Argfs*14 | p.E1418RfsX14LRG_663t1:c.4252delG, NM_000492.3:c.4252delGPathogenic12/21/2018 
565CFTREx27NM_000492.3:c.4272C>Tp.Tyr1424= | p.Y1424=LRG_663t1:c.4272C>T, NM_000492.3:c.4272C>TBenign11/14/2017 
566CFTREx27NM_000492.3:c.4296C>Tp.Asn1432= | p.N1432=LRG_663t1:c.4296C>T, NM_000492.3:c.4296C>TVOUS02/07/2020
567CFTREx27NM_000492.3:c.4322T>Cp.Ile1441Thr | p.I1441TNM_000492.3:c.4322T>CVOUS06/26/2015
568CFTREx27NM_000492.3:c.4332C>Tp.Ser1444= | p.S1444=LRG_663t1:c.4332C>T, NM_000492.3:c.4332C>TVOUS05/09/2017
569CFTREx27NM_000492.3:c.4333G>Ap.Asp1445Asn | p.D1445NLRG_663t1:c.4333G>A, NM_000492.3:c.4333G>AVOUS06/30/2020
570CFTREx27NM_000492.3:c.4348T>Ap.Phe1450Ile | p.F1450ILRG_663t1:c.4348T>A, NM_000492.3:c.4348T>AVOUS09/17/2020
571CFTREx27NM_000492.3:c.4357C>Tp.Arg1453Trp | p.R1453WLRG_663t1:c.4357C>T, NM_000492.3:c.4357C>TVOUS12/03/2019
572CFTREx27NM_000492.3:c.4358G>Ap.Arg1453Gln | p.R1453QLRG_663t1:c.4358G>A, NM_000492.3:c.4358G>AVOUS08/21/2019
573CFTREx27NM_000492.3:c.4383G>Tp.Lys1461Asn | p.K1461NLRG_663t1:c.4383G>T, NM_000492.3:c.4383G>TVOUS12/20/2017
574CFTREx27NM_000492.3:c.4387C>Tp.Gln1463* | p.Q1463XLRG_663t1:c.4387C>T, NM_000492.3:c.4387C>TVOUS08/15/2016
575CFTREx27NM_000492.3:c.4389G>Ap.Gln1463= | p.Q1463=LRG_663t1:c.4389G>A, NM_000492.3:c.4389G>ABenign11/20/2018 
576CFTREx27NM_000492.3:c.4417G>Ap.Glu1473Lys | p.E1473KLRG_663t1:c.4417G>A, NM_000492.3:c.4417G>AVOUS05/05/2017
577CFTREx27NM_000492.3:c.4426C>Tp.Gln1476* | p.Q1476XLRG_663t1:c.4426C>T, NM_000492.3:c.4426C>TPathogenic05/15/2018 
578CFTREx27NM_000492.3:c.4427A>Gp.Gln1476Arg | p.Q1476RLRG_663t1:c.4427A>G, NM_000492.3:c.4427A>GVOUS01/30/2020
579CFTREx27NM_000492.3:c.4436G>Ap.Arg1479Lys | p.R1479KLRG_663t1:c.4436G>A, NM_000492.3:c.4436G>AVOUS01/29/2021

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q2.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.