Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1CAPN3Ex1NM_000070.2:c.7A>Gp.Thr3Ala | p.T3ANM_000070.2:c.7A>G, NM_024344.1:c.7A>G, NM_173087.1:c.7A>G, NM_212464.2:c.48+5359A>G, NM_212465.2:c.48+5359A>G, NM_212467.2:c.48+5359A>G, NR_027911.1:n.540+5359A>G, NR_027912.1:n.540+5359A>G, XM_005254703.1:c.7A>G, XM_005254704.1:c.48+5359A>G, XM_005254705.1:c.48+5359A>G, XM_005254706.1:c.48+5359A>GVOUS01/08/2016
2CAPN3Ex1NM_000070.2:c.10G>Ap.Val4Ile | p.V4ILRG_849t1:c.10G>A, NM_000070.2:c.10G>A, NM_024344.1:c.10G>A, NM_173087.1:c.10G>A, NM_212464.2:c.48+5362G>A, NM_212465.2:c.48+5362G>A, NM_212467.2:c.48+5362G>A, NR_027911.1:n.540+5362G>A, NR_027912.1:n.540+5362G>A, XM_005254703.1:c.10G>A, XM_005254704.1:c.48+5362G>A, XM_005254705.1:c.48+5362G>A, XM_005254706.1:c.48+5362G>AVOUS09/26/2018
3CAPN3Ex1NM_000070.2:c.19G>Cp.Ala7Pro | p.A7PLRG_849t1:c.19G>C, NM_000070.2:c.19G>C, NM_024344.1:c.19G>C, NM_173087.1:c.19G>C, NM_212464.2:c.48+5371G>C, NM_212465.2:c.48+5371G>C, NM_212467.2:c.48+5371G>C, NR_027911.1:n.540+5371G>C, NR_027912.1:n.540+5371G>C, XM_005254703.1:c.19G>C, XM_005254704.1:c.48+5371G>C, XM_005254705.1:c.48+5371G>C, XM_005254706.1:c.48+5371G>CVOUS01/31/2018
4CAPN3Ex1NM_000070.2:c.41C>Tp.Ala14Val | p.A14VLRG_849t1:c.41C>T, NM_000070.2:c.41C>T, NM_024344.1:c.41C>T, NM_173087.1:c.41C>T, NM_212464.2:c.48+5393C>T, NM_212465.2:c.48+5393C>T, NM_212467.2:c.48+5393C>T, NR_027911.1:n.540+5393C>T, NR_027912.1:n.540+5393C>T, XM_005254703.1:c.41C>T, XM_005254704.1:c.48+5393C>T, XM_005254705.1:c.48+5393C>T, XM_005254706.1:c.48+5393C>TVOUS02/02/2017
5CAPN3Ex1NM_000070.2:c.61G>Tp.Gly21Trp | p.G21WNM_000070.2:c.61G>T, NM_024344.1:c.61G>T, NM_173087.1:c.61G>T, NM_212464.2:c.48+5413G>T, NM_212465.2:c.48+5413G>T, NM_212467.2:c.48+5413G>T, NR_027911.1:n.540+5413G>T, NR_027912.1:n.540+5413G>T, XM_005254703.1:c.61G>T, XM_005254704.1:c.48+5413G>T, XM_005254705.1:c.48+5413G>T, XM_005254706.1:c.48+5413G>TVOUS01/08/2016
6CAPN3Ex1NM_000070.2:c.62G>Ap.Gly21Glu | p.G21ENM_000070.2:c.62G>A, NM_024344.1:c.62G>A, NM_173087.1:c.62G>A, NM_212464.2:c.48+5414G>A, NM_212465.2:c.48+5414G>A, NM_212467.2:c.48+5414G>A, NR_027911.1:n.540+5414G>A, NR_027912.1:n.540+5414G>ABenign08/24/2012 
7CAPN3Ex1NM_000070.2:c.77C>Tp.Pro26Leu | p.P26LNM_000070.2:c.77C>T, NM_024344.1:c.77C>T, NM_173087.1:c.77C>T, NM_212464.2:c.48+5429C>T, NM_212465.2:c.48+5429C>T, NM_212467.2:c.48+5429C>T, NR_027911.1:n.540+5429C>T, NR_027912.1:n.540+5429C>T, XM_005254703.1:c.77C>T, XM_005254704.1:c.48+5429C>T, XM_005254705.1:c.48+5429C>T, XM_005254706.1:c.48+5429C>TVOUS09/09/2015
8CAPN3Ex1NM_000070.2:c.78G>Ap.Pro26= | p.P26=NM_000070.2:c.78G>A, NM_024344.1:c.78G>A, NM_173087.1:c.78G>A, NM_212464.2:c.48+5430G>A, NM_212465.2:c.48+5430G>A, NM_212467.2:c.48+5430G>A, NR_027911.1:n.540+5430G>A, NR_027912.1:n.540+5430G>A, XM_005254703.1:c.78G>A, XM_005254704.1:c.48+5430G>A, XM_005254705.1:c.48+5430G>A, XM_005254706.1:c.48+5430G>ABenign** 
9CAPN3Ex1NM_000070.2:c.87C>Gp.Ser29Arg | p.S29RLRG_849t1:c.87C>G, NM_000070.2:c.87C>G, NM_024344.1:c.87C>G, NM_173087.1:c.87C>G, NM_212464.2:c.48+5439C>G, NM_212465.2:c.48+5439C>G, NM_212467.2:c.48+5439C>G, NR_027911.1:n.540+5439C>G, NR_027912.1:n.540+5439C>G, XM_005254703.1:c.87C>G, XM_005254704.1:c.48+5439C>G, XM_005254705.1:c.48+5439C>G, XM_005254706.1:c.48+5439C>GVOUS05/24/2017
10CAPN3Ex1NM_000070.2:c.96T>Cp.Thr32= | p.T32=NM_000070.2:c.96T>C, NM_024344.1:c.96T>C, NM_173087.1:c.96T>C, NM_212464.2:c.48+5448T>C, NM_212465.2:c.48+5448T>C, NM_212467.2:c.48+5448T>C, NR_027911.1:n.540+5448T>C, NR_027912.1:n.540+5448T>CBenign11/01/2016 
11CAPN3Ex1NM_000070.2:c.133G>Ap.Ala45Thr | p.A45TNM_000070.2:c.133G>A, NM_024344.1:c.133G>A, NM_173087.1:c.133G>A, NM_212464.2:c.48+5485G>A, NM_212465.2:c.48+5485G>A, NM_212467.2:c.48+5485G>A, NR_027911.1:n.540+5485G>A, NR_027912.1:n.540+5485G>A, XM_005254703.1:c.133G>A, XM_005254704.1:c.48+5485G>A, XM_005254705.1:c.48+5485G>A, XM_005254706.1:c.48+5485G>APathogenic** 
12CAPN3Ex1NM_000070.2:c.145C>Tp.Arg49Cys | p.R49CLRG_849t1:c.145C>T, NM_000070.2:c.145C>T, NM_024344.1:c.145C>T, NM_173087.1:c.145C>T, NM_212464.2:c.48+5497C>T, NM_212465.2:c.48+5497C>T, NM_212467.2:c.48+5497C>T, NR_027911.1:n.540+5497C>T, NR_027912.1:n.540+5497C>T, XM_005254703.1:c.145C>T, XM_005254704.1:c.48+5497C>T, XM_005254705.1:c.48+5497C>T, XM_005254706.1:c.48+5497C>TPathogenic05/12/2016 
13CAPN3Ex1NM_000070.2:c.157A>Gp.Ile53Val | p.I53VNM_000070.2:c.157A>G, NM_024344.1:c.157A>G, NM_173087.1:c.157A>G, NM_212464.2:c.48+5509A>G, NM_212465.2:c.48+5509A>G, NM_212467.2:c.48+5509A>G, NR_027911.1:n.540+5509A>G, NR_027912.1:n.540+5509A>G, XM_005254703.1:c.157A>G, XM_005254704.1:c.48+5509A>G, XM_005254705.1:c.48+5509A>G, XM_005254706.1:c.48+5509A>GVOUS02/08/2017
14CAPN3Ex1NM_000070.2:c.183C>Tp.Phe61= | p.F61=NM_000070.2:c.183C>T, NM_024344.1:c.183C>T, NM_173087.1:c.183C>T, NM_212464.2:c.48+5535C>T, NM_212465.2:c.48+5535C>T, NM_212467.2:c.48+5535C>T, NR_027911.1:n.540+5535C>T, NR_027912.1:n.540+5535C>T, XM_005254703.1:c.183C>T, XM_005254704.1:c.48+5535C>T, XM_005254705.1:c.48+5535C>T, XM_005254706.1:c.48+5535C>TVOUS02/02/2016
15CAPN3Ex1NM_000070.2:c.223dupTp.Tyr75Leufs*5 | p.Y75LfsX5LRG_849t1:c.223dupT, NM_000070.2:c.223_224insT, NM_000070.2:c.223dupT, NM_024344.1:c.223_224insT, NM_024344.1:c.223dupT, NM_173087.1:c.223_224insT, NM_173087.1:c.223dupT, NM_212464.2:c.48+5575_48+5576insT, NM_212464.2:c.48+5575dupT, NM_212465.2:c.48+5575_48+5576insT, NM_212465.2:c.48+5575dupT, NM_212467.2:c.48+5575_48+5576insT, NM_212467.2:c.48+5575dupT, NR_027911.1:n.540+5575_540+5576insT, NR_027911.1:n.540+5575dupT, NR_027912.1:n.540+5575_540+5576insT, NR_027912.1:n.540+5575dupT, XM_005254703.1:c.223_224insT, XM_005254703.1:c.223dupT, XM_005254704.1:c.48+5575_48+5576insT, XM_005254704.1:c.48+5575dupT, XM_005254705.1:c.48+5575_48+5576insT, XM_005254705.1:c.48+5575dupT, XM_005254706.1:c.48+5575_48+5576insT, XM_005254706.1:c.48+5575dupTPathogenic05/16/2018 
16CAPN3Ex1NM_000070.2:c.224A>Gp.Tyr75Cys | p.Y75CLRG_849t1:c.224A>G, NM_000070.2:c.224A>G, NM_024344.1:c.224A>G, NM_173087.1:c.224A>G, NM_212464.2:c.48+5576A>G, NM_212465.2:c.48+5576A>G, NM_212467.2:c.48+5576A>G, NR_027911.1:n.540+5576A>G, NR_027912.1:n.540+5576A>G, XM_005254703.1:c.224A>G, XM_005254704.1:c.48+5576A>G, XM_005254705.1:c.48+5576A>G, XM_005254706.1:c.48+5576A>GVOUS02/28/2017
17CAPN3Ex1NM_000070.2:c.232C>Ap.Pro78Thr | p.P78TLRG_849t1:c.232C>A, NM_000070.2:c.232C>A, NM_024344.1:c.232C>A, NM_173087.1:c.232C>A, NM_212464.2:c.48+5584C>A, NM_212465.2:c.48+5584C>A, NM_212467.2:c.48+5584C>A, NR_027911.1:n.540+5584C>A, NR_027912.1:n.540+5584C>A, XM_005254703.1:c.232C>A, XM_005254704.1:c.48+5584C>A, XM_005254705.1:c.48+5584C>A, XM_005254706.1:c.48+5584C>AVOUS02/14/2018
18CAPN3Ex1NM_000070.2:c.237delGNM_000070.2:c.237delG, NM_024344.1:c.237delG, NM_173087.1:c.237delG, NM_212464.2:c.48+5589delG, NM_212465.2:c.48+5589delG, NM_212467.2:c.48+5589delG, NR_027911.1:n.540+5589delG, NR_027912.1:n.540+5589delG, XM_005254703.1:c.237delG, XM_005254704.1:c.48+5589delG, XM_005254705.1:c.48+5589delG, XM_005254706.1:c.48+5589delGPathogenic01/14/2016 
19CAPN3Ex1NM_000070.2:c.239T>Cp.Phe80Ser | p.F80SNM_000070.2:c.239T>C, NM_024344.1:c.239T>C, NM_173087.1:c.239T>C, NM_212464.2:c.48+5591T>C, NM_212465.2:c.48+5591T>C, NM_212467.2:c.48+5591T>C, NR_027911.1:n.540+5591T>C, NR_027912.1:n.540+5591T>C, XM_005254703.1:c.239T>C, XM_005254704.1:c.48+5591T>C, XM_005254705.1:c.48+5591T>C, XM_005254706.1:c.48+5591T>CVOUS09/20/2018
20CAPN3Ex1NM_000070.2:c.245C>Tp.Pro82Leu | p.P82LLRG_849t1:c.245C>T, NM_000070.2:c.245C>T, NM_024344.1:c.245C>T, NM_173087.1:c.245C>T, NM_212464.2:c.48+5597C>T, NM_212465.2:c.48+5597C>T, NM_212467.2:c.48+5597C>T, NR_027911.1:n.540+5597C>T, NR_027912.1:n.540+5597C>T, XM_005254703.1:c.245C>T, XM_005254704.1:c.48+5597C>T, XM_005254705.1:c.48+5597C>T, XM_005254706.1:c.48+5597C>TPathogenic07/11/2018 
21CAPN3Ex1NM_000070.2:c.246G>Ap.Pro82= | p.P82=NM_000070.2:c.246G>A, NM_024344.1:c.246G>A, NM_173087.1:c.246G>A, NM_212464.2:c.48+5598G>A, NM_212465.2:c.48+5598G>A, NM_212467.2:c.48+5598G>A, NR_027911.1:n.540+5598G>A, NR_027912.1:n.540+5598G>A, XM_005254703.1:c.246G>A, XM_005254704.1:c.48+5598G>A, XM_005254705.1:c.48+5598G>A, XM_005254706.1:c.48+5598G>ALikely benign11/23/2015 
22CAPN3Ex1NM_000070.2:c.258_259dupTNM_000070.2:c.259_260insT, NM_024344.1:c.259_260insT, NM_173087.1:c.259_260insT, NM_212464.2:c.48+5611_48+5612insT, NM_212465.2:c.48+5611_48+5612insT, NM_212467.2:c.48+5611_48+5612insT, NR_027911.1:n.540+5611_540+5612insT, NR_027912.1:n.540+5611_540+5612insT, XM_005254703.1:c.259_260insT, XM_005254704.1:c.48+5611_48+5612insT, XM_005254705.1:c.48+5611_48+5612insT, XM_005254706.1:c.48+5611_48+5612insTPathogenic** 
23CAPN3Ex1NM_000070.2:c.258dupTp.Leu87Serfs*4 | p.L87SfsX4LRG_849t1:c.258dupT, NM_000070.2:c.258_259insT, NM_000070.2:c.258dupT, NM_024344.1:c.258_259insT, NM_024344.1:c.258dupT, NM_173087.1:c.258_259insT, NM_173087.1:c.258dupT, NM_212464.2:c.48+5610_48+5611insT, NM_212464.2:c.48+5610dupT, NM_212465.2:c.48+5610_48+5611insT, NM_212465.2:c.48+5610dupT, NM_212467.2:c.48+5610_48+5611insT, NM_212467.2:c.48+5610dupT, NR_027911.1:n.540+5610_540+5611insT, NR_027911.1:n.540+5610dupT, NR_027912.1:n.540+5610_540+5611insT, NR_027912.1:n.540+5610dupT, XM_005254703.1:c.258_259insT, XM_005254703.1:c.258dupT, XM_005254704.1:c.48+5610_48+5611insT, XM_005254704.1:c.48+5610dupT, XM_005254705.1:c.48+5610_48+5611insT, XM_005254705.1:c.48+5610dupT, XM_005254706.1:c.48+5610_48+5611insT, XM_005254706.1:c.48+5610dupTPathogenic01/03/2017 
24CAPN3Ex1NM_000070.2:c.259_262delCTCTp.Leu87Phefs*39 | p.L87FfsX39LRG_849t1:c.259_262delCTCT, NM_000070.2:c.259_262delCTCT, NM_024344.1:c.259_262delCTCT, NM_173087.1:c.259_262delCTCT, NM_212464.2:c.48+5611_48+5614delCTCT, NM_212465.2:c.48+5611_48+5614delCTCT, NM_212467.2:c.48+5611_48+5614delCTCT, NR_027911.1:n.540+5611_540+5614delCTCT, NR_027912.1:n.540+5611_540+5614delCTCT, XM_005254703.1:c.259_262delCTCT, XM_005254704.1:c.48+5611_48+5614delCTCT, XM_005254705.1:c.48+5611_48+5614delCTCT, XM_005254706.1:c.48+5611_48+5614delCTCTPathogenic03/17/2016 
25CAPN3Ex1NM_000070.2:c.259C>Gp.Leu87Val | p.L87VLRG_849t1:c.259C>G, NM_000070.2:c.259C>G, NM_024344.1:c.259C>G, NM_173087.1:c.259C>G, NM_212464.2:c.48+5611C>G, NM_212465.2:c.48+5611C>G, NM_212467.2:c.48+5611C>G, NR_027911.1:n.540+5611C>G, NR_027912.1:n.540+5611C>G, XM_005254703.1:c.259C>G, XM_005254704.1:c.48+5611C>G, XM_005254705.1:c.48+5611C>G, XM_005254706.1:c.48+5611C>GVOUS12/05/2017
26CAPN3Ex1NM_000070.2:c.264T>Gp.Phe88Leu | p.F88LLRG_849t1:c.264T>G, NM_000070.2:c.264T>G, NM_024344.1:c.264T>G, NM_173087.1:c.264T>G, NM_212464.2:c.48+5616T>G, NM_212465.2:c.48+5616T>G, NM_212467.2:c.48+5616T>G, NR_027911.1:n.540+5616T>G, NR_027912.1:n.540+5616T>G, XM_005254703.1:c.264T>G, XM_005254704.1:c.48+5616T>G, XM_005254705.1:c.48+5616T>G, XM_005254706.1:c.48+5616T>GPathogenic12/01/2017 
27CAPN3Ex1NM_000070.2:c.270C>Tp.Ser90= | p.S90=LRG_849t1:c.270C>T, NM_000070.2:c.270C>T, NM_024344.1:c.270C>T, NM_173087.1:c.270C>T, NM_212464.2:c.48+5622C>T, NM_212465.2:c.48+5622C>T, NM_212467.2:c.48+5622C>T, NR_027911.1:n.540+5622C>T, NR_027912.1:n.540+5622C>T, XM_005254703.1:c.270C>T, XM_005254704.1:c.48+5622C>T, XM_005254705.1:c.48+5622C>T, XM_005254706.1:c.48+5622C>TVOUS10/09/2017
28CAPN3Ex1NM_000070.2:c.288G>Tp.Gln96His | p.Q96HNM_000070.2:c.288G>T, NM_024344.1:c.288G>T, NM_173087.1:c.288G>T, NM_212464.2:c.48+5640G>T, NM_212465.2:c.48+5640G>T, NM_212467.2:c.48+5640G>T, NR_027911.1:n.540+5640G>T, NR_027912.1:n.540+5640G>T, XM_005254703.1:c.288G>T, XM_005254704.1:c.48+5640G>T, XM_005254705.1:c.48+5640G>T, XM_005254706.1:c.48+5640G>TVOUS02/09/2016
29CAPN3Ex1NM_000070.2:c.292G>Ap.Val98Ile | p.V98INM_000070.2:c.292G>A, NM_024344.1:c.292G>A, NM_173087.1:c.292G>A, NM_212464.2:c.48+5644G>A, NM_212465.2:c.48+5644G>A, NM_212467.2:c.48+5644G>A, NR_027911.1:n.540+5644G>A, NR_027912.1:n.540+5644G>A, XM_005254703.1:c.292G>A, XM_005254704.1:c.48+5644G>A, XM_005254705.1:c.48+5644G>A, XM_005254706.1:c.48+5644G>AVOUS12/01/2015
30CAPN3Ex1NM_000070.2:c.294C>Gp.Val98= | p.V98=VOUS**
31CAPN3Ex1NM_000070.2:c.305C>Tp.Pro102Leu | p.P102LNM_000070.2:c.305C>T, NM_024344.1:c.305C>T, NM_173087.1:c.305C>T, NM_212464.2:c.48+5657C>T, NM_212465.2:c.48+5657C>T, NM_212467.2:c.48+5657C>T, NR_027911.1:n.540+5657C>T, NR_027912.1:n.540+5657C>T, XM_005254703.1:c.305C>T, XM_005254704.1:c.48+5657C>T, XM_005254705.1:c.48+5657C>T, XM_005254706.1:c.48+5657C>TVOUS08/04/2015
32CAPN3Ex1NM_000070.2:c.309+41G>AVOUS**
33CAPN3Ex2NM_000070.2:c.318C>Tp.Cys106= | p.C106=NM_000070.2:c.318C>T, NM_024344.1:c.318C>T, NM_173087.1:c.318C>T, NM_212464.2:c.57C>T, NM_212465.2:c.57C>T, NM_212467.2:c.57C>T, NR_027911.1:n.549C>T, NR_027912.1:n.549C>TBenign03/21/2014 
34CAPN3Ex2NM_000070.2:c.319G>Ap.Glu107Lys | p.E107KNM_000070.2:c.319G>A, NM_024344.1:c.319G>A, NM_173087.1:c.319G>A, NM_212464.2:c.58G>A, NM_212465.2:c.58G>A, NM_212467.2:c.58G>A, NR_027911.1:n.550G>A, NR_027912.1:n.550G>A, XM_005254703.1:c.319G>A, XM_005254704.1:c.58G>A, XM_005254705.1:c.58G>A, XM_005254706.1:c.58G>ABenign03/25/2015 
35CAPN3Ex2NM_000070.2:c.319G>Tp.Glu107* | p.E107XLRG_849t1:c.319G>T, NM_000070.2:c.319G>T, NM_024344.1:c.319G>T, NM_173087.1:c.319G>T, NM_212464.2:c.58G>T, NM_212465.2:c.58G>T, NM_212467.2:c.58G>T, NR_027911.1:n.550G>T, NR_027912.1:n.550G>T, XM_005254703.1:c.319G>T, XM_005254704.1:c.58G>T, XM_005254705.1:c.58G>T, XM_005254706.1:c.58G>TPathogenic05/31/2016 
36CAPN3Ex2NM_000070.2:c.327_328dupCCp.Arg110Profs*18 | p.R110PfsX18LRG_849t1:c.327_328dupCC, NM_000070.2:c.327_328dupCC, NM_000070.2:c.328_329insCC, NM_024344.1:c.327_328dupCC, NM_024344.1:c.328_329insCC, NM_173087.1:c.327_328dupCC, NM_173087.1:c.328_329insCC, NM_212464.2:c.66_67dupCC, NM_212464.2:c.67_68insCC, NM_212465.2:c.66_67dupCC, NM_212465.2:c.67_68insCC, NM_212467.2:c.66_67dupCC, NM_212467.2:c.67_68insCC, NR_027911.1:n.558_559dupCC, NR_027911.1:n.559_560insCC, NR_027912.1:n.558_559dupCC, NR_027912.1:n.559_560insCC, XM_005254703.1:c.327_328dupCC, XM_005254703.1:c.328_329insCC, XM_005254704.1:c.66_67dupCC, XM_005254704.1:c.67_68insCC, XM_005254705.1:c.66_67dupCC, XM_005254705.1:c.67_68insCC, XM_005254706.1:c.66_67dupCC, XM_005254706.1:c.67_68insCCPathogenic09/19/2017 
37CAPN3Ex2NM_000070.2:c.331T>Ap.Phe111Ile | p.F111ILRG_849t1:c.331T>A, NM_000070.2:c.331T>A, NM_024344.1:c.331T>A, NM_173087.1:c.331T>A, NM_212464.2:c.70T>A, NM_212465.2:c.70T>A, NM_212467.2:c.70T>A, NR_027911.1:n.562T>A, NR_027912.1:n.562T>A, XM_005254703.1:c.331T>A, XM_005254704.1:c.70T>A, XM_005254705.1:c.70T>A, XM_005254706.1:c.70T>AVOUS10/21/2016
38CAPN3Ex2NM_000070.2:c.338T>Cp.Ile113Thr | p.I113TNM_000070.2:c.338T>C, NM_024344.1:c.338T>C, NM_173087.1:c.338T>C, NM_212464.2:c.77T>C, NM_212465.2:c.77T>C, NM_212467.2:c.77T>C, NR_027911.1:n.569T>C, NR_027912.1:n.569T>C, XM_005254703.1:c.338T>C, XM_005254704.1:c.77T>C, XM_005254705.1:c.77T>C, XM_005254706.1:c.77T>CVOUS07/03/2018
39CAPN3Ex2NM_000070.2:c.347C>Ap.Ala116Asp | p.A116DLRG_849t1:c.347C>A, NM_000070.2:c.347C>A, NM_024344.1:c.347C>A, NM_173087.1:c.347C>A, NM_212464.2:c.86C>A, NM_212465.2:c.86C>A, NM_212467.2:c.86C>A, NR_027911.1:n.578C>A, NR_027912.1:n.578C>A, XM_005254703.1:c.347C>A, XM_005254704.1:c.86C>A, XM_005254705.1:c.86C>A, XM_005254706.1:c.86C>APathogenic11/09/2018 
40CAPN3Ex2NM_000070.2:c.351C>Tp.Asn117= | p.N117=NM_000070.2:c.351C>T, NM_024344.1:c.351C>T, NM_173087.1:c.351C>T, NM_212464.2:c.90C>T, NM_212465.2:c.90C>T, NM_212467.2:c.90C>T, NR_027911.1:n.582C>T, NR_027912.1:n.582C>T, XM_005254703.1:c.351C>T, XM_005254704.1:c.90C>T, XM_005254705.1:c.90C>T, XM_005254706.1:c.90C>TVOUS02/28/2017
41CAPN3Ex2NM_000070.2:c.360C>Ap.Asp120Glu | p.D120ENM_000070.2:c.360C>A, NM_024344.1:c.360C>A, NM_173087.1:c.360C>A, NM_212464.2:c.99C>A, NM_212465.2:c.99C>A, NM_212467.2:c.99C>A, NR_027911.1:n.591C>A, NR_027912.1:n.591C>A, XM_005254703.1:c.360C>A, XM_005254704.1:c.99C>A, XM_005254705.1:c.99C>A, XM_005254706.1:c.99C>AVOUS12/08/2015
42CAPN3Ex2NM_000070.2:c.363C>Gp.Ile121Met | p.I121MLRG_849t1:c.363C>G, NM_000070.2:c.363C>G, NM_024344.1:c.363C>G, NM_173087.1:c.363C>G, NM_212464.2:c.102C>G, NM_212465.2:c.102C>G, NM_212467.2:c.102C>G, NR_027911.1:n.594C>G, NR_027912.1:n.594C>G, XM_005254703.1:c.363C>G, XM_005254704.1:c.102C>G, XM_005254705.1:c.102C>G, XM_005254706.1:c.102C>GVOUS10/10/2016
43CAPN3Ex2NM_000070.2:c.367C>Ap.Gln123Lys | p.Q123KLRG_849t1:c.367C>A, NM_000070.2:c.367C>A, NM_024344.1:c.367C>A, NM_173087.1:c.367C>A, NM_212464.2:c.106C>A, NM_212465.2:c.106C>A, NM_212467.2:c.106C>A, NR_027911.1:n.598C>A, NR_027912.1:n.598C>A, XM_005254703.1:c.367C>A, XM_005254704.1:c.106C>A, XM_005254705.1:c.106C>A, XM_005254706.1:c.106C>AVOUS03/17/2016
44CAPN3Ex2NM_000070.2:c.371G>Cp.Gly124Ala | p.G124ALRG_849t1:c.371G>C, NM_000070.2:c.371G>C, NM_024344.1:c.371G>C, NM_173087.1:c.371G>C, NM_212464.2:c.110G>C, NM_212465.2:c.110G>C, NM_212467.2:c.110G>C, NR_027911.1:n.602G>C, NR_027912.1:n.602G>C, XM_005254703.1:c.371G>C, XM_005254704.1:c.110G>C, XM_005254705.1:c.110G>C, XM_005254706.1:c.110G>CVOUS09/29/2017
45CAPN3Ex2NM_000070.2:c.372A>Tp.Gly124= | p.G124=LRG_849t1:c.372A>T, NM_000070.2:c.372A>T, NM_024344.1:c.372A>T, NM_173087.1:c.372A>T, NM_212464.2:c.111A>T, NM_212465.2:c.111A>T, NM_212467.2:c.111A>T, NR_027911.1:n.603A>T, NR_027912.1:n.603A>T, XM_005254703.1:c.372A>T, XM_005254704.1:c.111A>T, XM_005254705.1:c.111A>T, XM_005254706.1:c.111A>TVOUS06/23/2016
46CAPN3Ex2NM_000070.2:c.379+5G>TNM_000070.2:c.379+5G>T, NM_024344.1:c.379+5G>T, NM_173087.1:c.379+5G>T, NM_212464.2:c.118+5G>T, NM_212465.2:c.118+5G>T, NM_212467.2:c.118+5G>T, NR_027911.1:n.610+5G>T, NR_027912.1:n.610+5G>T, XM_005254703.1:c.379+5G>T, XM_005254704.1:c.118+5G>T, XM_005254705.1:c.118+5G>T, XM_005254706.1:c.118+5G>TVOUS11/06/2015
47CAPN3Ex3NM_000070.2:c.380-27C>TBenign** 
48CAPN3Ex3NM_000070.2:c.380-18_380-3delCCCTGTGTCTGCCTGCNM_000070.2:c.380-18_380-3delCCCTGTGTCTGCCTGC, NM_024344.1:c.380-18_380-3delCCCTGTGTCTGCCTGC, NM_173087.1:c.380-18_380-3delCCCTGTGTCTGCCTGC, NM_212464.2:c.119-18_119-3delCCCTGTGTCTGCCTGC, NM_212465.2:c.119-18_119-3delCCCTGTGTCTGCCTGC, NM_212467.2:c.*73-18_*73-3delCCCTGTGTCTGCCTGC, NR_027911.1:n.611-18_611-3delCCCTGTGTCTGCCTGC, NR_027912.1:n.889-18_889-3delCCCTGTGTCTGCCTGC, XM_005254703.1:c.380-18_380-3delCCCTGTGTCTGCCTGC, XM_005254704.1:c.119-18_119-3delCCCTGTGTCTGCCTGC, XM_005254705.1:c.119-18_119-3delCCCTGTGTCTGCCTGC, XM_005254706.1:c.119-18_119-3delCCCTGTGTCTGCCTGCVOUS12/04/2018
49CAPN3Ex3NM_000070.2:c.387C>Gp.Cys129Trp | p.C129WLRG_849t1:c.387C>G, NM_000070.2:c.387C>G, NM_024344.1:c.387C>G, NM_173087.1:c.387C>G, NM_212464.2:c.126C>G, NM_212465.2:c.126C>G, NM_212467.2:c.*80C>G, NR_027911.1:n.618C>G, NR_027912.1:n.896C>G, XM_005254703.1:c.387C>G, XM_005254704.1:c.126C>G, XM_005254705.1:c.126C>G, XM_005254706.1:c.126C>GVOUS10/05/2018
50CAPN3Ex3NM_000070.2:c.395T>Cp.Leu132Pro | p.L132PLRG_849t1:c.395T>C, NM_000070.2:c.395T>C, NM_024344.1:c.395T>C, NM_173087.1:c.395T>C, NM_212464.2:c.134T>C, NM_212465.2:c.134T>C, NM_212467.2:c.*88T>C, NR_027911.1:n.626T>C, NR_027912.1:n.904T>C, XM_005254703.1:c.395T>C, XM_005254704.1:c.134T>C, XM_005254705.1:c.134T>C, XM_005254706.1:c.134T>CVOUS06/01/2021
51CAPN3Ex3NM_000070.2:c.398C>Tp.Ala133Val | p.A133VLRG_849t1:c.398C>T, NM_000070.2:c.398C>T, NM_024344.1:c.398C>T, NM_173087.1:c.398C>T, NM_212464.2:c.137C>T, NM_212465.2:c.137C>T, NM_212467.2:c.*91C>T, NR_027911.1:n.629C>T, NR_027912.1:n.907C>T, XM_005254703.1:c.398C>T, XM_005254704.1:c.137C>T, XM_005254705.1:c.137C>T, XM_005254706.1:c.137C>TVOUS09/14/2016
52CAPN3Ex3NM_000070.2:c.402delCLRG_849t1:c.402delC, NM_000070.2:c.402delC, NM_024344.1:c.402delC, NM_173087.1:c.402delC, NM_212464.2:c.141delC, NM_212465.2:c.141delC, NM_212467.2:c.*95delC, NR_027911.1:n.633delC, NR_027912.1:n.911delC, XM_005254703.1:c.402delC, XM_005254704.1:c.141delC, XM_005254705.1:c.141delC, XM_005254706.1:c.141delCPathogenic03/03/2016 
53CAPN3Ex3NM_000070.2:c.433C>Gp.Leu145Val | p.L145VLRG_849t1:c.433C>G, NM_000070.2:c.433C>G, NM_024344.1:c.433C>G, NM_173087.1:c.433C>G, NM_212464.2:c.172C>G, NM_212465.2:c.172C>G, NM_212467.2:c.*126C>G, NR_027911.1:n.664C>G, NR_027912.1:n.942C>G, XM_005254703.1:c.433C>G, XM_005254704.1:c.172C>G, XM_005254705.1:c.172C>G, XM_005254706.1:c.172C>GVOUS09/06/2016
54CAPN3Ex3NM_000070.2:c.439C>Tp.Arg147* | p.R147XNM_000070.2:c.439C>T, NM_024344.1:c.439C>T, NM_173087.1:c.439C>T, NM_212464.2:c.178C>T, NM_212465.2:c.178C>T, NM_212467.2:c.*132C>T, NR_027911.1:n.670C>T, NR_027912.1:n.948C>T, XM_005254703.1:c.439C>T, XM_005254704.1:c.178C>T, XM_005254705.1:c.178C>T, XM_005254706.1:c.178C>TPathogenic01/15/2016 
55CAPN3Ex3NM_000070.2:c.442G>Cp.Val148Leu | p.V148LNM_000070.2:c.442G>C, NM_024344.1:c.442G>C, NM_173087.1:c.442G>C, NM_212464.2:c.181G>C, NM_212465.2:c.181G>C, NM_212467.2:c.*135G>C, NR_027911.1:n.673G>C, NR_027912.1:n.951G>C, XM_005254703.1:c.442G>C, XM_005254704.1:c.181G>C, XM_005254705.1:c.181G>C, XM_005254706.1:c.181G>CVOUS10/02/2015
56CAPN3Ex3NM_000070.2:c.466A>Gp.Ile156Val | p.I156VLRG_849t1:c.466A>G, NM_000070.2:c.466A>G, NM_024344.1:c.466A>G, NM_173087.1:c.466A>G, NM_212464.2:c.205A>G, NM_212465.2:c.205A>G, NM_212467.2:c.*159A>G, NR_027911.1:n.697A>G, NR_027912.1:n.975A>G, XM_005254703.1:c.466A>G, XM_005254704.1:c.205A>G, XM_005254705.1:c.205A>G, XM_005254706.1:c.205A>GVOUS03/15/2018
57CAPN3Ex3NM_000070.2:c.476A>Gp.Tyr159Cys | p.Y159CNM_000070.2:c.476A>G, NM_024344.1:c.476A>G, NM_173087.1:c.476A>G, NM_212464.2:c.215A>G, NM_212465.2:c.215A>G, NM_212467.2:c.*169A>G, NR_027911.1:n.707A>G, NR_027912.1:n.985A>G, XM_005254703.1:c.476A>G, XM_005254704.1:c.215A>G, XM_005254705.1:c.215A>G, XM_005254706.1:c.215A>GVOUS12/08/2015
58CAPN3Ex3NM_000070.2:c.478G>Cp.Ala160Pro | p.A160PLRG_849t1:c.478G>C, NM_000070.2:c.478G>C, NM_024344.1:c.478G>C, NM_173087.1:c.478G>C, NM_212464.2:c.217G>C, NM_212465.2:c.217G>C, NM_212467.2:c.*171G>C, NR_027911.1:n.709G>C, NR_027912.1:n.987G>C, XM_005254703.1:c.478G>C, XM_005254704.1:c.217G>C, XM_005254705.1:c.217G>C, XM_005254706.1:c.217G>CVOUS09/23/2016
59CAPN3Ex3NM_000070.2:c.479C>Gp.Ala160Gly | p.A160GNM_000070.2:c.479C>G, NM_024344.1:c.479C>G, NM_173087.1:c.479C>G, NM_212464.2:c.218C>G, NM_212465.2:c.218C>G, NM_212467.2:c.*172C>G, NR_027911.1:n.710C>G, NR_027912.1:n.988C>GBenign03/01/2013 
60CAPN3Ex3NM_000070.2:c.492C>Tp.His164= | p.H164=LRG_849t1:c.492C>T, NM_000070.2:c.492C>T, NM_024344.1:c.492C>T, NM_173087.1:c.492C>T, NM_212464.2:c.231C>T, NM_212465.2:c.231C>T, NM_212467.2:c.*185C>T, NR_027911.1:n.723C>T, NR_027912.1:n.1001C>T, XM_005254703.1:c.492C>T, XM_005254704.1:c.231C>T, XM_005254705.1:c.231C>T, XM_005254706.1:c.231C>TVOUS12/12/2017
61CAPN3Ex3NM_000070.2:c.495C>Tp.Phe165= | p.F165=NM_000070.2:c.495C>T, NM_024344.1:c.495C>T, NM_173087.1:c.495C>T, NM_212464.2:c.234C>T, NM_212465.2:c.234C>T, NM_212467.2:c.*188C>T, NR_027911.1:n.726C>T, NR_027912.1:n.1004C>TBenign01/27/2014 
62CAPN3Ex3NM_000070.2:c.498+35G>TBenign** 
63CAPN3Ex4NM_000070.2:c.500T>Cp.Phe167Ser | p.F167SLRG_849t1:c.500T>C, NM_000070.2:c.500T>C, NM_024344.1:c.500T>C, NM_173087.1:c.500T>C, NM_212464.2:c.239T>C, NM_212465.2:c.239T>C, NM_212467.2:c.*193T>C, NR_027911.1:n.731T>C, NR_027912.1:n.1009T>C, XM_005254703.1:c.500T>C, XM_005254704.1:c.239T>C, XM_005254705.1:c.239T>C, XM_005254706.1:c.239T>CLikely pathogenic05/16/2017 
64CAPN3Ex4NM_000070.2:c.503G>Ap.Trp168* | p.W168XLRG_849t1:c.503G>A, NM_000070.2:c.503G>A, NM_024344.1:c.503G>A, NM_173087.1:c.503G>A, NM_212464.2:c.242G>A, NM_212465.2:c.242G>A, NM_212467.2:c.*196G>A, NR_027911.1:n.734G>A, NR_027912.1:n.1012G>A, XM_005254703.1:c.503G>A, XM_005254704.1:c.242G>A, XM_005254705.1:c.242G>A, XM_005254706.1:c.242G>APathogenic10/26/2016 
65CAPN3Ex4NM_000070.2:c.525C>Tp.Asp175= | p.D175=NM_000070.2:c.525C>T, NM_024344.1:c.525C>T, NM_173087.1:c.525C>T, NM_212464.2:c.264C>T, NM_212465.2:c.264C>T, NM_212467.2:c.*218C>T, NR_027911.1:n.756C>T, NR_027912.1:n.1034C>T, XM_005254703.1:c.525C>T, XM_005254704.1:c.264C>T, XM_005254705.1:c.264C>T, XM_005254706.1:c.264C>TVOUS02/07/2019
66CAPN3Ex4NM_000070.2:c.526G>Tp.Val176Leu | p.V176LNM_000070.2:c.526G>T, NM_024344.1:c.526G>T, NM_173087.1:c.526G>T, NM_212464.2:c.265G>T, NM_212465.2:c.265G>T, NM_212467.2:c.*219G>T, NR_027911.1:n.757G>T, NR_027912.1:n.1035G>T, XM_005254703.1:c.526G>T, XM_005254704.1:c.265G>T, XM_005254705.1:c.265G>T, XM_005254706.1:c.265G>TVOUS02/08/2017
67CAPN3Ex4NM_000070.2:c.533T>Cp.Ile178Thr | p.I178TLRG_849t1:c.533T>C, NM_000070.2:c.533T>C, NM_024344.1:c.533T>C, NM_173087.1:c.533T>C, NM_212464.2:c.272T>C, NM_212465.2:c.272T>C, NM_212467.2:c.*226T>C, NR_027911.1:n.764T>C, NR_027912.1:n.1042T>C, XM_005254703.1:c.533T>C, XM_005254704.1:c.272T>C, XM_005254705.1:c.272T>C, XM_005254706.1:c.272T>CPathogenic10/28/2015 
68CAPN3Ex4NM_000070.2:c.533T>Ap.Ile178Lys | p.I178KNM_000070.2:c.533T>A, NM_024344.1:c.533T>A, NM_173087.1:c.533T>A, NM_212464.2:c.272T>A, NM_212465.2:c.272T>A, NM_212467.2:c.*226T>A, NR_027911.1:n.764T>A, NR_027912.1:n.1042T>A, XM_005254703.1:c.533T>A, XM_005254704.1:c.272T>A, XM_005254705.1:c.272T>A, XM_005254706.1:c.272T>AVOUS05/21/2015
69CAPN3Ex4NM_000070.2:c.534A>Gp.Ile178Met | p.I178MNM_000070.2:c.534A>G, NM_024344.1:c.534A>G, NM_173087.1:c.534A>G, NM_212464.2:c.273A>G, NM_212465.2:c.273A>G, NM_212467.2:c.*227A>G, NR_027911.1:n.765A>G, NR_027912.1:n.1043A>G, XM_005254703.1:c.534A>G, XM_005254704.1:c.273A>G, XM_005254705.1:c.273A>G, XM_005254706.1:c.273A>GVOUS12/01/2015
70CAPN3Ex4NM_000070.2:c.536A>Gp.Asp179Gly | p.D179GLRG_849t1:c.536A>G, NM_000070.2:c.536A>G, NM_024344.1:c.536A>G, NM_173087.1:c.536A>G, NM_212464.2:c.275A>G, NM_212465.2:c.275A>G, NM_212467.2:c.*229A>G, NR_027911.1:n.767A>G, NR_027912.1:n.1045A>G, XM_005254703.1:c.536A>G, XM_005254704.1:c.275A>G, XM_005254705.1:c.275A>G, XM_005254706.1:c.275A>GVOUS03/10/2016
71CAPN3Ex4NM_000070.2:c.544C>Gp.Leu182Val | p.L182VLRG_849t1:c.544C>G, NM_000070.2:c.544C>G, NM_024344.1:c.544C>G, NM_173087.1:c.544C>G, NM_212464.2:c.283C>G, NM_212465.2:c.283C>G, NM_212467.2:c.*237C>G, NR_027911.1:n.775C>G, NR_027912.1:n.1053C>G, XM_005254703.1:c.544C>G, XM_005254704.1:c.283C>G, XM_005254705.1:c.283C>G, XM_005254706.1:c.283C>GVOUS02/08/2017
72CAPN3Ex4NM_000070.2:c.550delAp.Thr184Argfs*36 | p.T184RfsX36NM_000070.2:c.550delA, NM_024344.1:c.550delA, NM_173087.1:c.550delA, NM_212464.2:c.289delA, NM_212465.2:c.289delA, NM_212467.2:c.*243delA, NR_027911.1:n.781delA, NR_027912.1:n.1059delAPathogenic11/30/2018 
73CAPN3Ex4NM_000070.2:c.551C>Tp.Thr184Met | p.T184MNM_000070.2:c.551C>T, NM_024344.1:c.551C>T, NM_173087.1:c.551C>T, NM_212464.2:c.290C>T, NM_212465.2:c.290C>T, NM_212467.2:c.*244C>T, NR_027911.1:n.782C>T, NR_027912.1:n.1060C>T, XM_005254703.1:c.551C>T, XM_005254704.1:c.290C>T, XM_005254705.1:c.290C>T, XM_005254706.1:c.290C>TBenign07/28/2016 
74CAPN3Ex4NM_000070.2:c.552G>Ap.Thr184= | p.T184=LRG_849t1:c.552G>A, NM_000070.2:c.552G>A, NM_024344.1:c.552G>A, NM_173087.1:c.552G>A, NM_212464.2:c.291G>A, NM_212465.2:c.291G>A, NM_212467.2:c.*245G>A, NR_027911.1:n.783G>A, NR_027912.1:n.1061G>A, XM_005254703.1:c.552G>A, XM_005254704.1:c.291G>A, XM_005254705.1:c.291G>A, XM_005254706.1:c.291G>AVOUS10/16/2018
75CAPN3Ex4NM_000070.2:c.553T>Gp.Tyr185Asp | p.Y185DLRG_849t1:c.553T>G, NM_000070.2:c.553T>G, NM_024344.1:c.553T>G, NM_173087.1:c.553T>G, NM_212464.2:c.292T>G, NM_212465.2:c.292T>G, NM_212467.2:c.*246T>G, NR_027911.1:n.784T>G, NR_027912.1:n.1062T>G, XM_005254703.1:c.553T>G, XM_005254704.1:c.292T>G, XM_005254705.1:c.292T>G, XM_005254706.1:c.292T>GVOUS08/13/2018
76CAPN3Ex4NM_000070.2:c.566T>Cp.Leu189Pro | p.L189PLRG_849t1:c.566T>C, NM_000070.2:c.566T>C, NM_024344.1:c.566T>C, NM_173087.1:c.566T>C, NM_212464.2:c.305T>C, NM_212465.2:c.305T>C, NM_212467.2:c.*259T>C, NR_027911.1:n.797T>C, NR_027912.1:n.1075T>C, XM_005254703.1:c.566T>C, XM_005254704.1:c.305T>C, XM_005254705.1:c.305T>C, XM_005254706.1:c.305T>CVOUS09/19/2017
77CAPN3Ex4NM_000070.2:c.580delTNM_000070.2:c.580delT, NM_024344.1:c.580delT, NM_173087.1:c.580delT, NM_212464.2:c.319delT, NM_212465.2:c.319delT, NM_212467.2:c.*273delT, NR_027911.1:n.811delT, NR_027912.1:n.1089delTPathogenic10/04/2013 
78CAPN3Ex4NM_000070.2:c.581C>Tp.Ser194Phe | p.S194FNM_000070.2:c.581C>T, NM_024344.1:c.581C>T, NM_173087.1:c.581C>T, NM_212464.2:c.320C>T, NM_212465.2:c.320C>T, NM_212467.2:c.*274C>T, NR_027911.1:n.812C>T, NR_027912.1:n.1090C>T, XM_005254703.1:c.581C>T, XM_005254704.1:c.320C>T, XM_005254705.1:c.320C>T, XM_005254706.1:c.320C>TVOUS01/23/2016
79CAPN3Ex4NM_000070.2:c.584A>Cp.Asn195Thr | p.N195TNM_000070.2:c.584A>C, NM_024344.1:c.584A>C, NM_173087.1:c.584A>C, NM_212464.2:c.323A>C, NM_212465.2:c.323A>C, NM_212467.2:c.*277A>C, NR_027911.1:n.815A>C, NR_027912.1:n.1093A>C, XM_005254703.1:c.584A>C, XM_005254704.1:c.323A>C, XM_005254705.1:c.323A>C, XM_005254706.1:c.323A>CVOUS08/17/2018
80CAPN3Ex4NM_000070.2:c.584A>Gp.Asn195Ser | p.N195SNM_000070.2:c.584A>G, NM_024344.1:c.584A>G, NM_173087.1:c.584A>G, NM_212464.2:c.323A>G, NM_212465.2:c.323A>G, NM_212467.2:c.*277A>G, NR_027911.1:n.815A>G, NR_027912.1:n.1093A>G, XM_005254703.1:c.584A>G, XM_005254704.1:c.323A>G, XM_005254705.1:c.323A>G, XM_005254706.1:c.323A>GVOUS06/16/2017
81CAPN3Ex4NM_000070.2:c.589C>Tp.Arg197Cys | p.R197CNM_000070.2:c.589C>T, NM_024344.1:c.589C>T, NM_173087.1:c.589C>T, NM_212464.2:c.328C>T, NM_212465.2:c.328C>T, NM_212467.2:c.*282C>T, NR_027911.1:n.820C>T, NR_027912.1:n.1098C>T, XM_005254703.1:c.589C>T, XM_005254704.1:c.328C>T, XM_005254705.1:c.328C>T, XM_005254706.1:c.328C>TVOUS01/16/2018
82CAPN3Ex4NM_000070.2:c.590G>Tp.Arg197Leu | p.R197LLRG_849t1:c.590G>T, NM_000070.2:c.590G>T, NM_024344.1:c.590G>T, NM_173087.1:c.590G>T, NM_212464.2:c.329G>T, NM_212465.2:c.329G>T, NM_212467.2:c.*283G>T, NR_027911.1:n.821G>T, NR_027912.1:n.1099G>T, XM_005254703.1:c.590G>T, XM_005254704.1:c.329G>T, XM_005254705.1:c.329G>T, XM_005254706.1:c.329G>TVOUS12/07/2016
83CAPN3Ex4NM_000070.2:c.593A>Gp.Asn198Ser | p.N198SLRG_849t1:c.593A>G, NM_000070.2:c.593A>G, NM_024344.1:c.593A>G, NM_173087.1:c.593A>G, NM_212464.2:c.332A>G, NM_212465.2:c.332A>G, NM_212467.2:c.*286A>G, NR_027911.1:n.824A>G, NR_027912.1:n.1102A>G, XM_005254703.1:c.593A>G, XM_005254704.1:c.332A>G, XM_005254705.1:c.332A>G, XM_005254706.1:c.332A>GVOUS**
84CAPN3Ex4NM_000070.2:c.598_612delTTCTGGAGTGCTCTGp.Phe200_Leu204del | p.F200_L204delNM_000070.2:c.598_612delTTCTGGAGTGCTCTG, NM_024344.1:c.598_612delTTCTGGAGTGCTCTG, NM_173087.1:c.598_612delTTCTGGAGTGCTCTG, NM_212464.2:c.337_351delTTCTGGAGTGCTCTG, NM_212465.2:c.337_351delTTCTGGAGTGCTCTG, NM_212467.2:c.*291_*305delTTCTGGAGTGCTCTG, NR_027911.1:n.829_843delTTCTGGAGTGCTCTG, NR_027912.1:n.1107_1121delTTCTGGAGTGCTCTGPathogenic06/25/2018 
85CAPN3Ex4NM_000070.2:c.606T>Cp.Ser202= | p.S202=NM_000070.2:c.606T>C, NM_024344.1:c.606T>C, NM_173087.1:c.606T>C, NM_212464.2:c.345T>C, NM_212465.2:c.345T>C, NM_212467.2:c.*299T>C, NR_027911.1:n.837T>C, NR_027912.1:n.1115T>CBenign11/22/2013 
86CAPN3Ex4NM_000070.2:c.608C>Tp.Ala203Val | p.A203VLRG_849t1:c.608C>T, NM_000070.2:c.608C>T, NM_024344.1:c.608C>T, NM_173087.1:c.608C>T, NM_212464.2:c.347C>T, NM_212465.2:c.347C>T, NM_212467.2:c.*301C>T, NR_027911.1:n.839C>T, NR_027912.1:n.1117C>T, XM_005254703.1:c.608C>T, XM_005254704.1:c.347C>T, XM_005254705.1:c.347C>T, XM_005254706.1:c.347C>TVOUS07/27/2016
87CAPN3Ex4NM_000070.2:c.614T>Cp.Leu205Pro | p.L205PLRG_849t1:c.614T>C, NM_000070.2:c.614T>C, NM_024344.1:c.614T>C, NM_173087.1:c.614T>C, NM_212464.2:c.353T>C, NM_212465.2:c.353T>C, NM_212467.2:c.*307T>C, NR_027911.1:n.845T>C, NR_027912.1:n.1123T>C, XM_005254703.1:c.614T>C, XM_005254704.1:c.353T>C, XM_005254705.1:c.353T>C, XM_005254706.1:c.353T>CVOUS12/11/2017
88CAPN3Ex4NM_000070.2:c.620A>Cp.Lys207Thr | p.K207TNM_000070.2:c.620A>C, NM_024344.1:c.620A>C, NM_173087.1:c.620A>C, NM_212464.2:c.359A>C, NM_212465.2:c.359A>C, NM_212467.2:c.*313A>C, NR_027911.1:n.851A>C, NR_027912.1:n.1129A>C, XM_005254703.1:c.620A>C, XM_005254704.1:c.359A>C, XM_005254705.1:c.359A>C, XM_005254706.1:c.359A>CVOUS01/29/2016
89CAPN3Ex4NM_000070.2:c.632+3A>GNM_000070.2:c.632+3A>G, NM_024344.1:c.632+3A>G, NM_173087.1:c.632+3A>G, NM_212464.2:c.371+3A>G, NM_212465.2:c.371+3A>G, NM_212467.2:c.*325+3A>G, NR_027911.1:n.863+3A>G, NR_027912.1:n.1141+3A>G, XM_005254703.1:c.632+3A>G, XM_005254704.1:c.371+3A>G, XM_005254705.1:c.371+3A>G, XM_005254706.1:c.371+3A>GVOUS01/13/2017
90CAPN3Ex5NM_000070.2:c.633G>Cp.Lys211Asn | p.K211NNM_000070.2:c.633G>C, NM_024344.1:c.633G>C, NM_173087.1:c.633G>C, NM_212464.2:c.372G>C, NM_212465.2:c.372G>C, NM_212467.2:c.*326G>C, NR_027911.1:n.864G>C, NR_027912.1:n.1142G>C, XM_005254703.1:c.633G>C, XM_005254704.1:c.372G>C, XM_005254705.1:c.372G>C, XM_005254706.1:c.372G>CVOUS06/15/2018
91CAPN3Ex5NM_000070.2:c.635T>Cp.Leu212Pro | p.L212PLRG_849t1:c.635T>C, NM_000070.2:c.635T>C, NM_024344.1:c.635T>C, NM_173087.1:c.635T>C, NM_212464.2:c.374T>C, NM_212465.2:c.374T>C, NM_212467.2:c.*328T>C, NR_027911.1:n.866T>C, NR_027912.1:n.1144T>C, XM_005254703.1:c.635T>C, XM_005254704.1:c.374T>C, XM_005254705.1:c.374T>C, XM_005254706.1:c.374T>CVOUS08/17/2016
92CAPN3Ex5NM_000070.2:c.639dupTNM_000070.2:c.639_640insT, NM_024344.1:c.639_640insT, NM_173087.1:c.639_640insT, NM_212464.2:c.378_379insT, NM_212465.2:c.378_379insT, NM_212467.2:c.*332_*333insT, NR_027911.1:n.870_871insT, NR_027912.1:n.1148_1149insT, XM_005254703.1:c.639_640insT, XM_005254704.1:c.378_379insT, XM_005254705.1:c.378_379insT, XM_005254706.1:c.378_379insTPathogenic01/27/2016 
93CAPN3Ex5NM_000070.2:c.640G>Ap.Gly214Ser | p.G214SLRG_849t1:c.640G>A, NM_000070.2:c.640G>A, NM_024344.1:c.640G>A, NM_173087.1:c.640G>A, NM_212464.2:c.379G>A, NM_212465.2:c.379G>A, NM_212467.2:c.*333G>A, NR_027911.1:n.871G>A, NR_027912.1:n.1149G>A, XM_005254703.1:c.640G>A, XM_005254704.1:c.379G>A, XM_005254705.1:c.379G>A, XM_005254706.1:c.379G>ALikely pathogenic11/07/2017 
94CAPN3Ex5NM_000070.2:c.643_663delTCCTACGAAGCTCTGAAAGGTp.Ser215_Gly221del | p.S215_G221delNM_000070.2:c.643_663delTCCTACGAAGCTCTGAAAGGT, NM_024344.1:c.643_663delTCCTACGAAGCTCTGAAAGGT, NM_173087.1:c.643_663delTCCTACGAAGCTCTGAAAGGT, NM_212464.2:c.382_402delTCCTACGAAGCTCTGAAAGGT, NM_212465.2:c.382_402delTCCTACGAAGCTCTGAAAGGT, NM_212467.2:c.*336_*356delTCCTACGAAGCTCTGAAAGGT, NR_027911.1:n.874_894delTCCTACGAAGCTCTGAAAGGT, NR_027912.1:n.1152_1172delTCCTACGAAGCTCTGAAAGGT, XM_005254703.1:c.643_663delTCCTACGAAGCTCTGAAAGGT, XM_005254704.1:c.382_402delTCCTACGAAGCTCTGAAAGGT, XM_005254705.1:c.382_402delTCCTACGAAGCTCTGAAAGGT, XM_005254706.1:c.382_402delTCCTACGAAGCTCTGAAAGGTPathogenic03/30/2018 
95CAPN3Ex5NM_000070.2:c.644C>Tp.Ser215Phe | p.S215FLRG_849t1:c.644C>T, NM_000070.2:c.644C>T, NM_024344.1:c.644C>T, NM_173087.1:c.644C>T, NM_212464.2:c.383C>T, NM_212465.2:c.383C>T, NM_212467.2:c.*337C>T, NR_027911.1:n.875C>T, NR_027912.1:n.1153C>T, XM_005254703.1:c.644C>T, XM_005254704.1:c.383C>T, XM_005254705.1:c.383C>T, XM_005254706.1:c.383C>TVOUS12/19/2017
96CAPN3Ex5NM_000070.2:c.648C>Tp.Tyr216= | p.Y216=NM_000070.2:c.648C>T, NM_024344.1:c.648C>T, NM_173087.1:c.648C>T, NM_212464.2:c.387C>T, NM_212465.2:c.387C>T, NM_212467.2:c.*341C>T, NR_027911.1:n.879C>T, NR_027912.1:n.1157C>T, XM_005254703.1:c.648C>T, XM_005254704.1:c.387C>T, XM_005254705.1:c.387C>T, XM_005254706.1:c.387C>TVOUS02/02/2016
97CAPN3Ex5NM_000070.2:c.649G>Ap.Glu217Lys | p.E217KLRG_849t1:c.649G>A, NM_000070.2:c.649G>A, NM_024344.1:c.649G>A, NM_173087.1:c.649G>A, NM_212464.2:c.388G>A, NM_212465.2:c.388G>A, NM_212467.2:c.*342G>A, NR_027911.1:n.880G>A, NR_027912.1:n.1158G>A, XM_005254703.1:c.649G>A, XM_005254704.1:c.388G>A, XM_005254705.1:c.388G>A, XM_005254706.1:c.388G>ALikely pathogenic06/01/2016 
98CAPN3Ex5NM_000070.2:c.662G>Tp.Gly221Val | p.G221VNM_000070.2:c.662G>T, NM_024344.1:c.662G>T, NM_173087.1:c.662G>T, NM_212464.2:c.401G>T, NM_212465.2:c.401G>T, NM_212467.2:c.*355G>T, NR_027911.1:n.893G>T, NR_027912.1:n.1171G>TPathogenic** 
99CAPN3Ex5NM_000070.2:c.680C>Tp.Ala227Val | p.A227VLRG_849t1:c.680C>T, NM_000070.2:c.680C>T, NM_024344.1:c.680C>T, NM_173087.1:c.680C>T, NM_212464.2:c.419C>T, NM_212465.2:c.419C>T, NM_212467.2:c.*373C>T, NR_027911.1:n.911C>T, NR_027912.1:n.1189C>T, XM_005254703.1:c.680C>T, XM_005254704.1:c.419C>T, XM_005254705.1:c.419C>T, XM_005254706.1:c.419C>TVOUS01/26/2018
100CAPN3Ex5NM_000070.2:c.694A>Cp.Thr232Pro | p.T232PLRG_849t1:c.694A>C, NM_000070.2:c.694A>C, NM_024344.1:c.694A>C, NM_173087.1:c.694A>C, NM_212464.2:c.433A>C, NM_212465.2:c.433A>C, NM_212467.2:c.*387A>C, NR_027911.1:n.925A>C, NR_027912.1:n.1203A>C, XM_005254703.1:c.694A>C, XM_005254704.1:c.433A>C, XM_005254705.1:c.433A>C, XM_005254706.1:c.433A>CVOUS05/17/2018
101CAPN3Ex5NM_000070.2:c.700G>Ap.Gly234Arg | p.G234RNM_000070.2:c.700G>A, NM_024344.1:c.700G>A, NM_173087.1:c.700G>A, NM_212464.2:c.439G>A, NM_212465.2:c.439G>A, NM_212467.2:c.*393G>A, NR_027911.1:n.931G>A, NR_027912.1:n.1209G>A, XM_005254703.1:c.700G>A, XM_005254704.1:c.439G>A, XM_005254705.1:c.439G>A, XM_005254706.1:c.439G>AVOUS08/19/2015
102CAPN3Ex5NM_000070.2:c.701G>Ap.Gly234Glu | p.G234ELRG_849t1:c.701G>A, NM_000070.2:c.701G>A, NM_024344.1:c.701G>A, NM_173087.1:c.701G>A, NM_212464.2:c.440G>A, NM_212465.2:c.440G>A, NM_212467.2:c.*394G>A, NR_027911.1:n.932G>A, NR_027912.1:n.1210G>A, XM_005254703.1:c.701G>A, XM_005254704.1:c.440G>A, XM_005254705.1:c.440G>A, XM_005254706.1:c.440G>APathogenic05/11/2017 
103CAPN3Ex5NM_000070.2:c.706G>Ap.Ala236Thr | p.A236TNM_000070.2:c.706G>A, NM_024344.1:c.706G>A, NM_173087.1:c.706G>A, NM_212464.2:c.445G>A, NM_212465.2:c.445G>A, NM_212467.2:c.*399G>A, NR_027911.1:n.937G>A, NR_027912.1:n.1215G>ABenign12/04/2015 
104CAPN3Ex5NM_000070.2:c.717dupTp.Glu240* | p.E240XLRG_849t1:c.717dupT, NM_000070.2:c.717dupT, NM_024344.1:c.717dupT, NM_173087.1:c.717dupT, NM_212464.2:c.456dupT, NM_212465.2:c.456dupT, NM_212467.2:c.*410dupT, NR_027911.1:n.948dupT, NR_027912.1:n.1226dupT, XM_005254703.1:c.717dupT, XM_005254704.1:c.456dupT, XM_005254705.1:c.456dupT, XM_005254706.1:c.456dupTPathogenic07/21/2017 
105CAPN3Ex5NM_000070.2:c.717delTp.Phe239Leufs*14 | p.F239LfsX14NM_000070.2:c.717delT, NM_024344.1:c.717delT, NM_173087.1:c.717delT, NM_212464.2:c.456delT, NM_212465.2:c.456delT, NM_212467.2:c.*410delT, NR_027911.1:n.948delT, NR_027912.1:n.1226delT, XM_005254703.1:c.717delT, XM_005254704.1:c.456delT, XM_005254705.1:c.456delT, XM_005254706.1:c.456delTPathogenic10/04/2018 
106CAPN3Ex5NM_000070.2:c.721A>Gp.Ile241Val | p.I241VLRG_849t1:c.721A>G, NM_000070.2:c.721A>G, NM_024344.1:c.721A>G, NM_173087.1:c.721A>G, NM_212464.2:c.460A>G, NM_212465.2:c.460A>G, NM_212467.2:c.*414A>G, NR_027911.1:n.952A>G, NR_027912.1:n.1230A>G, XM_005254703.1:c.721A>G, XM_005254704.1:c.460A>G, XM_005254705.1:c.460A>G, XM_005254706.1:c.460A>GVOUS09/07/2016
107CAPN3Ex5NM_000070.2:c.725G>Ap.Arg242Lys | p.R242KLRG_849t1:c.725G>A, NM_000070.2:c.725G>A, NM_024344.1:c.725G>A, NM_173087.1:c.725G>A, NM_212464.2:c.464G>A, NM_212465.2:c.464G>A, NM_212467.2:c.*418G>A, NR_027911.1:n.956G>A, NR_027912.1:n.1234G>A, XM_005254703.1:c.725G>A, XM_005254704.1:c.464G>A, XM_005254705.1:c.464G>A, XM_005254706.1:c.464G>AVOUS12/07/2017
108CAPN3Ex5NM_000070.2:c.749A>Gp.Lys250Arg | p.K250RLRG_849t1:c.749A>G, NM_000070.2:c.749A>G, NM_024344.1:c.749A>G, NM_173087.1:c.749A>G, NM_212464.2:c.488A>G, NM_212465.2:c.488A>G, NM_212467.2:c.*442A>G, NR_027911.1:n.980A>G, NR_027912.1:n.1258A>G, XM_005254703.1:c.749A>G, XM_005254704.1:c.488A>G, XM_005254705.1:c.488A>G, XM_005254706.1:c.488A>GVOUS07/27/2016
109CAPN3Ex5NM_000070.2:c.759_761delGAAp.Lys254del | p.K254delNM_000070.2:c.759_761delGAA, NM_024344.1:c.759_761delGAA, NM_173087.1:c.759_761delGAA, NM_212464.2:c.498_500delGAA, NM_212465.2:c.498_500delGAA, NM_212467.2:c.*452_*454delGAA, NR_027911.1:n.990_992delGAA, NR_027912.1:n.1268_1270delGAA, XM_005254703.1:c.759_761delGAA, XM_005254704.1:c.498_500delGAA, XM_005254705.1:c.498_500delGAA, XM_005254706.1:c.498_500delGAAPathogenic02/28/2018 
110CAPN3Ex5NM_000070.2:c.763G>Ap.Ala255Thr | p.A255TNM_000070.2:c.763G>A, NM_024344.1:c.763G>A, NM_173087.1:c.763G>A, NM_212464.2:c.502G>A, NM_212465.2:c.502G>A, NM_212467.2:c.*456G>A, NR_027911.1:n.994G>A, NR_027912.1:n.1272G>A, XM_005254703.1:c.763G>A, XM_005254704.1:c.502G>A, XM_005254705.1:c.502G>A, XM_005254706.1:c.502G>AVOUS01/12/2016
111CAPN3Ex5NM_000070.2:c.768C>Tp.Ile256= | p.I256=LRG_849t1:c.768C>T, NM_000070.2:c.768C>T, NM_024344.1:c.768C>T, NM_173087.1:c.768C>T, NM_212464.2:c.507C>T, NM_212465.2:c.507C>T, NM_212467.2:c.*461C>T, NR_027911.1:n.999C>T, NR_027912.1:n.1277C>T, XM_005254703.1:c.768C>T, XM_005254704.1:c.507C>T, XM_005254705.1:c.507C>T, XM_005254706.1:c.507C>TVOUS07/25/2016
112CAPN3Ex5NM_000070.2:c.769G>Ap.Glu257Lys | p.E257KLRG_849t1:c.769G>A, NM_000070.2:c.769G>A, NM_024344.1:c.769G>A, NM_173087.1:c.769G>A, NM_212464.2:c.508G>A, NM_212465.2:c.508G>A, NM_212467.2:c.*462G>A, NR_027911.1:n.1000G>A, NR_027912.1:n.1278G>A, XM_005254703.1:c.769G>A, XM_005254704.1:c.508G>A, XM_005254705.1:c.508G>A, XM_005254706.1:c.508G>AVOUS10/18/2016
113CAPN3Ex5NM_000070.2:c.783C>Tp.Leu261= | p.L261=LRG_849t1:c.783C>T, NM_000070.2:c.783C>T, NM_024344.1:c.783C>T, NM_173087.1:c.783C>T, NM_212464.2:c.522C>T, NM_212465.2:c.522C>T, NM_212467.2:c.*476C>T, NR_027911.1:n.1014C>T, NR_027912.1:n.1292C>T, XM_005254703.1:c.783C>T, XM_005254704.1:c.522C>T, XM_005254705.1:c.522C>T, XM_005254706.1:c.522C>TVOUS06/08/2018
114CAPN3Ex5NM_000070.2:c.788G>Ap.Gly263Asp | p.G263DNM_000070.2:c.788G>A, NM_024344.1:c.788G>A, NM_173087.1:c.788G>A, NM_212464.2:c.527G>A, NM_212465.2:c.527G>A, NM_212467.2:c.*481G>A, NR_027911.1:n.1019G>A, NR_027912.1:n.1297G>A, XM_005254703.1:c.788G>A, XM_005254704.1:c.527G>A, XM_005254705.1:c.527G>A, XM_005254706.1:c.527G>AVOUS09/10/2015
115CAPN3Ex5NM_000070.2:c.794C>Tp.Ser265Phe | p.S265FNM_000070.2:c.794C>T, NM_024344.1:c.794C>T, NM_173087.1:c.794C>T, NM_212464.2:c.533C>T, NM_212465.2:c.533C>T, NM_212467.2:c.*487C>T, NR_027911.1:n.1025C>T, NR_027912.1:n.1303C>T, XM_005254703.1:c.794C>T, XM_005254704.1:c.533C>T, XM_005254705.1:c.533C>T, XM_005254706.1:c.533C>TVOUS01/08/2016
116CAPN3Ex5NM_000070.2:c.797T>Cp.Ile266Thr | p.I266TLRG_849t1:c.797T>C, NM_000070.2:c.797T>C, NM_024344.1:c.797T>C, NM_173087.1:c.797T>C, NM_212464.2:c.536T>C, NM_212465.2:c.536T>C, NM_212467.2:c.*490T>C, NR_027911.1:n.1028T>C, NR_027912.1:n.1306T>C, XM_005254703.1:c.797T>C, XM_005254704.1:c.536T>C, XM_005254705.1:c.536T>C, XM_005254706.1:c.536T>CVOUS05/20/2016
117CAPN3Ex6NM_000070.2:c.802-10C>TLRG_849t1:c.802-10C>T, NM_000070.2:c.802-10C>T, NM_024344.1:c.802-10C>T, NM_173087.1:c.801+847C>T, NM_212464.2:c.541-10C>T, NM_212465.2:c.541-10C>T, NM_212467.2:c.*495-10C>T, NR_027911.1:n.1033-10C>T, NR_027912.1:n.1311-10C>T, XM_005254703.1:c.802-10C>T, XM_005254704.1:c.541-10C>T, XM_005254705.1:c.541-10C>T, XM_005254706.1:c.540+847C>TVOUS04/20/2016
118CAPN3Ex6NM_000070.2:c.802-9G>ANM_000070.2:c.802-9G>A, NM_024344.1:c.802-9G>A, NM_173087.1:c.801+848G>A, NM_212464.2:c.541-9G>A, NM_212465.2:c.541-9G>A, NM_212467.2:c.*495-9G>A, NR_027911.1:n.1033-9G>A, NR_027912.1:n.1311-9G>A, XM_005254703.1:c.802-9G>A, XM_005254704.1:c.541-9G>A, XM_005254705.1:c.541-9G>A, XM_005254706.1:c.540+848G>APathogenic01/20/2017 
119CAPN3Ex6NM_000070.2:c.835T>Cp.Ser279Pro | p.S279PNM_000070.2:c.835T>C, NM_024344.1:c.835T>C, NM_173087.1:c.801+890T>C, NM_212464.2:c.574T>C, NM_212465.2:c.574T>C, NM_212467.2:c.*528T>C, NR_027911.1:n.1066T>C, NR_027912.1:n.1344T>C, XM_005254703.1:c.835T>C, XM_005254704.1:c.574T>C, XM_005254705.1:c.574T>C, XM_005254706.1:c.540+890T>CVOUS02/23/2016
120CAPN3Ex6NM_000070.2:c.844A>Tp.Asn282Tyr | p.N282YLRG_849t1:c.844A>T, NM_000070.2:c.844A>T, NM_024344.1:c.844A>T, NM_173087.1:c.801+899A>T, NM_212464.2:c.583A>T, NM_212465.2:c.583A>T, NM_212467.2:c.*537A>T, NR_027911.1:n.1075A>T, NR_027912.1:n.1353A>T, XM_005254703.1:c.844A>T, XM_005254704.1:c.583A>T, XM_005254705.1:c.583A>T, XM_005254706.1:c.540+899A>TVOUS07/18/2016
121CAPN3Ex6NM_000070.2:c.853dupGLRG_849t1:c.853_854insG, NM_000070.2:c.853_854insG, NM_024344.1:c.853_854insG, NM_173087.1:c.801+908_801+909insG, NM_212464.2:c.592_593insG, NM_212465.2:c.592_593insG, NM_212467.2:c.*546_*547insG, NR_027911.1:n.1084_1085insG, NR_027912.1:n.1362_1363insG, XM_005254703.1:c.853_854insG, XM_005254704.1:c.592_593insG, XM_005254705.1:c.592_593insG, XM_005254706.1:c.540+908_540+909insGPathogenic09/07/2016 
122CAPN3Ex6NM_000070.2:c.855_864dupGTTGATTGCAc.855_864dup10, NM_000070.2:c.864_865insGTTGATTGCA, NM_024344.1:c.864_865insGTTGATTGCA, NM_173087.1:c.801+919_801+920insGTTGATTGCA, NM_212464.2:c.603_604insGTTGATTGCA, NM_212465.2:c.603_604insGTTGATTGCA, NM_212467.2:c.*557_*558insGTTGATTGCA, NR_027911.1:n.1095_1096insGTTGATTGCA, NR_027912.1:n.1373_1374insGTTGATTGCA, XM_005254703.1:c.864_865insGTTGATTGCA, XM_005254704.1:c.603_604insGTTGATTGCA, XM_005254705.1:c.603_604insGTTGATTGCA, XM_005254706.1:c.540+919_540+920insGTTGATTGCAPathogenic04/30/2013 
123CAPN3Ex6NM_000070.2:c.864A>Gp.Ala288= | p.A288=LRG_849t1:c.864A>G, NM_000070.2:c.864A>G, NM_024344.1:c.864A>G, NM_173087.1:c.801+919A>G, NM_212464.2:c.603A>G, NM_212465.2:c.603A>G, NM_212467.2:c.*557A>G, NR_027911.1:n.1095A>G, NR_027912.1:n.1373A>G, XM_005254703.1:c.864A>G, XM_005254704.1:c.603A>G, XM_005254705.1:c.603A>G, XM_005254706.1:c.540+919A>GVOUS06/16/2017
124CAPN3Ex6NM_000070.2:c.865C>Tp.Arg289Trp | p.R289WLRG_849t1:c.865C>T, NM_000070.2:c.865C>T, NM_024344.1:c.865C>T, NM_173087.1:c.801+920C>T, NM_212464.2:c.604C>T, NM_212465.2:c.604C>T, NM_212467.2:c.*558C>T, NR_027911.1:n.1096C>T, NR_027912.1:n.1374C>T, XM_005254703.1:c.865C>T, XM_005254704.1:c.604C>T, XM_005254705.1:c.604C>T, XM_005254706.1:c.540+920C>TPathogenic05/22/2018 
125CAPN3Ex6NM_000070.2:c.868A>Tp.Met290Leu | p.M290LNM_000070.2:c.868A>T, NM_024344.1:c.868A>T, NM_173087.1:c.801+923A>T, NM_212464.2:c.607A>T, NM_212465.2:c.607A>T, NM_212467.2:c.*561A>T, NR_027911.1:n.1099A>T, NR_027912.1:n.1377A>T, XM_005254703.1:c.868A>T, XM_005254704.1:c.607A>T, XM_005254705.1:c.607A>T, XM_005254706.1:c.540+923A>TVOUS02/09/2016
126CAPN3Ex6NM_000070.2:c.883_886delGATAinsCTTp.Asp295Leufs*57 | p.D295LfsX57NM_000070.2:c.883_886delinsCTT, NM_024344.1:c.883_886delinsCTT, NM_173087.1:c.801+938_801+941delinsCTT, NM_212464.2:c.622_625delinsCTT, NM_212465.2:c.622_625delinsCTT, NM_212467.2:c.*576_*579delinsCTT, NR_027911.1:n.1114_1117delinsCTT, NR_027912.1:n.1392_1395delinsCTT, XM_005254703.1:c.883_886delinsCTT, XM_005254704.1:c.622_625delinsCTT, XM_005254705.1:c.622_625delinsCTT, XM_005254706.1:c.540+938_540+941delinsCTTPathogenic04/25/2018 
127CAPN3Ex6NM_000070.2:c.883G>Cp.Asp295His | p.D295HNM_000070.2:c.883G>C, NM_024344.1:c.883G>C, NM_173087.1:c.801+938G>C, NM_212464.2:c.622G>C, NM_212465.2:c.622G>C, NM_212467.2:c.*576G>C, NR_027911.1:n.1114G>C, NR_027912.1:n.1392G>C, XM_005254703.1:c.883G>C, XM_005254704.1:c.622G>C, XM_005254705.1:c.622G>C, XM_005254706.1:c.540+938G>CVOUS07/21/2017
128CAPN3Ex6NM_000070.2:c.884A>Tp.Asp295Val | p.D295VNM_000070.2:c.884A>T, NM_024344.1:c.884A>T, NM_173087.1:c.801+939A>T, NM_212464.2:c.623A>T, NM_212465.2:c.623A>T, NM_212467.2:c.*577A>T, NR_027911.1:n.1115A>T, NR_027912.1:n.1393A>T, XM_005254703.1:c.884A>T, XM_005254704.1:c.623A>T, XM_005254705.1:c.623A>T, XM_005254706.1:c.540+939A>TVOUS06/08/2016
129CAPN3Ex6NM_000070.2:c.897C>Ap.Leu299= | p.L299=LRG_849t1:c.897C>A, NM_000070.2:c.897C>A, NM_024344.1:c.897C>A, NM_173087.1:c.801+952C>A, NM_212464.2:c.636C>A, NM_212465.2:c.636C>A, NM_212467.2:c.*590C>A, NR_027911.1:n.1128C>A, NR_027912.1:n.1406C>A, XM_005254703.1:c.897C>A, XM_005254704.1:c.636C>A, XM_005254705.1:c.636C>A, XM_005254706.1:c.540+952C>AVOUS07/19/2018
130CAPN3Ex6NM_000070.2:c.905C>Tp.Ser302Leu | p.S302LLRG_849t1:c.905C>T, NM_000070.2:c.905C>T, NM_024344.1:c.905C>T, NM_173087.1:c.801+960C>T, NM_212464.2:c.644C>T, NM_212465.2:c.644C>T, NM_212467.2:c.*598C>T, NR_027911.1:n.1136C>T, NR_027912.1:n.1414C>T, XM_005254703.1:c.905C>T, XM_005254704.1:c.644C>T, XM_005254705.1:c.644C>T, XM_005254706.1:c.540+960C>TVOUS01/22/2018
131CAPN3Ex6NM_000070.2:c.930T>Cp.Asp310= | p.D310=NM_000070.2:c.930T>C, NM_024344.1:c.930T>C, NM_173087.1:c.801+985T>C, NM_212464.2:c.669T>C, NM_212465.2:c.669T>C, NM_212467.2:c.*623T>C, NR_027911.1:n.1161T>C, NR_027912.1:n.1439T>C, XM_005254703.1:c.930T>C, XM_005254704.1:c.669T>C, XM_005254705.1:c.669T>C, XM_005254706.1:c.540+985T>CBenign06/11/2015 
132CAPN3Ex6NM_000070.2:c.938C>Tp.Pro313Leu | p.P313LNM_000070.2:c.938C>T, NM_024344.1:c.938C>T, NM_173087.1:c.801+993C>T, NM_212464.2:c.677C>T, NM_212465.2:c.677C>T, NM_212467.2:c.*631C>T, NR_027911.1:n.1169C>T, NR_027912.1:n.1447C>T, XM_005254703.1:c.938C>T, XM_005254704.1:c.677C>T, XM_005254705.1:c.677C>T, XM_005254706.1:c.540+993C>TVOUS08/25/2015
133CAPN3Ex6NM_000070.2:c.943C>Tp.Arg315Trp | p.R315WVOUS**
134CAPN3Ex7NM_000070.2:c.946-1_948delGACAPathogenic12/12/2016 
135CAPN3Ex7NM_000070.2:c.950T>Cp.Ile317Thr | p.I317TLRG_849t1:c.950T>C, NM_000070.2:c.950T>C, NM_024344.1:c.950T>C, NM_173087.1:c.806T>C, NM_212464.2:c.689T>C, NM_212465.2:c.689T>C, NM_212467.2:c.*643T>C, NR_027911.1:n.1181T>C, NR_027912.1:n.1459T>C, XM_005254703.1:c.950T>C, XM_005254704.1:c.689T>C, XM_005254705.1:c.689T>C, XM_005254706.1:c.545T>CVOUS07/08/2016
136CAPN3Ex7NM_000070.2:c.956C>Tp.Pro319Leu | p.P319LNM_000070.2:c.956C>T, NM_024344.1:c.956C>T, NM_173087.1:c.812C>T, NM_212464.2:c.695C>T, NM_212465.2:c.695C>T, NM_212467.2:c.*649C>T, NR_027911.1:n.1187C>T, NR_027912.1:n.1465C>T, XM_005254703.1:c.956C>T, XM_005254704.1:c.695C>T, XM_005254705.1:c.695C>T, XM_005254706.1:c.551C>TLikely pathogenic09/20/2017 
137CAPN3Ex7NM_000070.2:c.984C>Tp.Cys328= | p.C328=NM_000070.2:c.984C>T, NM_024344.1:c.984C>T, NM_173087.1:c.840C>T, NM_212464.2:c.723C>T, NM_212465.2:c.723C>T, NM_212467.2:c.*677C>T, NR_027911.1:n.1215C>T, NR_027912.1:n.1493C>TBenign01/27/2014 
138CAPN3Ex7NM_000070.2:c.998G>Ap.Gly333Asp | p.G333DLRG_849t1:c.998G>A, NM_000070.2:c.998G>A, NM_024344.1:c.998G>A, NM_173087.1:c.854G>A, NM_212464.2:c.737G>A, NM_212465.2:c.737G>A, NM_212467.2:c.*691G>A, NR_027911.1:n.1229G>A, NR_027912.1:n.1507G>A, XM_005254703.1:c.998G>A, XM_005254704.1:c.737G>A, XM_005254705.1:c.737G>A, XM_005254706.1:c.593G>AVOUS03/28/2017
139CAPN3Ex7NM_000070.2:c.1001A>Tp.His334Leu | p.H334LNM_000070.2:c.1001A>T, NM_024344.1:c.1001A>T, NM_173087.1:c.857A>T, NM_212464.2:c.740A>T, NM_212465.2:c.740A>T, NM_212467.2:c.*694A>T, NR_027911.1:n.1232A>T, NR_027912.1:n.1510A>T, XM_005254703.1:c.1001A>T, XM_005254704.1:c.740A>T, XM_005254705.1:c.740A>T, XM_005254706.1:c.596A>TVOUS10/25/2018
140CAPN3Ex7NM_000070.2:c.1007A>Gp.Tyr336Cys | p.Y336CLRG_849t1:c.1007A>G, NM_000070.2:c.1007A>G, NM_024344.1:c.1007A>G, NM_173087.1:c.863A>G, NM_212464.2:c.746A>G, NM_212465.2:c.746A>G, NM_212467.2:c.*700A>G, NR_027911.1:n.1238A>G, NR_027912.1:n.1516A>G, XM_005254703.1:c.1007A>G, XM_005254704.1:c.746A>G, XM_005254705.1:c.746A>G, XM_005254706.1:c.602A>GVOUS04/19/2018
141CAPN3Ex7NM_000070.2:c.1017G>Ap.Thr339= | p.T339=LRG_849t1:c.1017G>A, NM_000070.2:c.1017G>A, NM_024344.1:c.1017G>A, NM_173087.1:c.873G>A, NM_212464.2:c.756G>A, NM_212465.2:c.756G>A, NM_212467.2:c.*710G>A, NR_027911.1:n.1248G>A, NR_027912.1:n.1526G>A, XM_005254703.1:c.1017G>A, XM_005254704.1:c.756G>A, XM_005254705.1:c.756G>A, XM_005254706.1:c.612G>ABenign05/31/2016 
142CAPN3Ex7NM_000070.2:c.1020G>Tp.Gly340= | p.G340=NM_000070.2:c.1020G>T, NM_024344.1:c.1020G>T, NM_173087.1:c.876G>T, NM_212464.2:c.759G>T, NM_212465.2:c.759G>T, NM_212467.2:c.*713G>T, NR_027911.1:n.1251G>T, NR_027912.1:n.1529G>T, XM_005254703.1:c.1020G>T, XM_005254704.1:c.759G>T, XM_005254705.1:c.759G>T, XM_005254706.1:c.615G>TVOUS02/12/2018
143CAPN3Ex7NM_000070.2:c.1027G>Tp.Glu343* | p.E343XLRG_849t1:c.1027G>T, NM_000070.2:c.1027G>T, NM_024344.1:c.1027G>T, NM_173087.1:c.883G>T, NM_212464.2:c.766G>T, NM_212465.2:c.766G>T, NM_212467.2:c.*720G>T, NR_027911.1:n.1258G>T, NR_027912.1:n.1536G>T, XM_005254703.1:c.1027G>T, XM_005254704.1:c.766G>T, XM_005254705.1:c.766G>T, XM_005254706.1:c.622G>TPathogenic04/12/2018 
144CAPN3Ex7NM_000070.2:c.1029+3A>GLRG_849t1:c.1029+3A>G, NM_000070.2:c.1029+3A>G, NM_024344.1:c.1029+3A>G, NM_173087.1:c.885+3A>G, NM_212464.2:c.768+3A>G, NM_212465.2:c.768+3A>G, NM_212467.2:c.*722+3A>G, NR_027911.1:n.1260+3A>G, NR_027912.1:n.1538+3A>G, XM_005254703.1:c.1029+3A>G, XM_005254704.1:c.768+3A>G, XM_005254705.1:c.768+3A>G, XM_005254706.1:c.624+3A>GBenign08/24/2012 
145CAPN3Ex8NM_000070.2:c.1030-7G>ANM_000070.2:c.1030-7G>A, NM_024344.1:c.1030-7G>A, NM_173087.1:c.886-7G>A, NM_212464.2:c.769-7G>A, NM_212465.2:c.769-7G>A, NM_212467.2:c.*723-7G>A, NR_027911.1:n.1261-7G>A, NR_027912.1:n.1539-7G>A, XM_005254703.1:c.1030-7G>A, XM_005254704.1:c.769-7G>A, XM_005254705.1:c.769-7G>A, XM_005254706.1:c.625-7G>AVOUS02/10/2016
146CAPN3Ex8NM_000070.2:c.1034C>Gp.Pro345Arg | p.P345RLRG_849t1:c.1034C>G, NM_000070.2:c.1034C>G, NM_024344.1:c.1034C>G, NM_173087.1:c.890C>G, NM_212464.2:c.773C>G, NM_212465.2:c.773C>G, NM_212467.2:c.*727C>G, NR_027911.1:n.1265C>G, NR_027912.1:n.1543C>G, XM_005254703.1:c.1034C>G, XM_005254704.1:c.773C>G, XM_005254705.1:c.773C>G, XM_005254706.1:c.629C>GVOUS07/11/2016
147CAPN3Ex8NM_000070.2:c.1043delGLRG_849t1:c.1043delG, NM_000070.2:c.1043delG, NM_024344.1:c.1043delG, NM_173087.1:c.899delG, NM_212464.2:c.782delG, NM_212465.2:c.782delG, NM_212467.2:c.*736delG, NR_027911.1:n.1274delG, NR_027912.1:n.1552delG, XM_005254703.1:c.1043delG, XM_005254704.1:c.782delG, XM_005254705.1:c.782delG, XM_005254706.1:c.638delGPathogenic03/17/2016 
148CAPN3Ex8NM_000070.2:c.1063C>Tp.Arg355Trp | p.R355WNM_000070.2:c.1063C>T, NM_024344.1:c.1063C>T, NM_173087.1:c.919C>T, NM_212464.2:c.802C>T, NM_212465.2:c.802C>T, NM_212467.2:c.*756C>T, NR_027911.1:n.1294C>T, NR_027912.1:n.1572C>T, XM_005254703.1:c.1063C>T, XM_005254704.1:c.802C>T, XM_005254705.1:c.802C>T, XM_005254706.1:c.658C>TPathogenic06/21/2017 
149CAPN3Ex8NM_000070.2:c.1069C>Tp.Arg357Trp | p.R357WLRG_849t1:c.1069C>T, NM_000070.2:c.1069C>T, NM_024344.1:c.1069C>T, NM_173087.1:c.925C>T, NM_212464.2:c.808C>T, NM_212465.2:c.808C>T, NM_212467.2:c.*762C>T, NR_027911.1:n.1300C>T, NR_027912.1:n.1578C>T, XM_005254703.1:c.1069C>T, XM_005254704.1:c.808C>T, XM_005254705.1:c.808C>T, XM_005254706.1:c.664C>TLikely pathogenic09/20/2018 
150CAPN3Ex8NM_000070.2:c.1070G>Ap.Arg357Gln | p.R357QLRG_849t1:c.1070G>A, NM_000070.2:c.1070G>A, NM_024344.1:c.1070G>A, NM_173087.1:c.926G>A, NM_212464.2:c.809G>A, NM_212465.2:c.809G>A, NM_212467.2:c.*763G>A, NR_027911.1:n.1301G>A, NR_027912.1:n.1579G>A, XM_005254703.1:c.1070G>A, XM_005254704.1:c.809G>A, XM_005254705.1:c.809G>A, XM_005254706.1:c.665G>AVOUS10/12/2016
151CAPN3Ex8NM_000070.2:c.1072A>Gp.Asn358Asp | p.N358DNM_000070.2:c.1072A>G, NM_024344.1:c.1072A>G, NM_173087.1:c.928A>G, NM_212464.2:c.811A>G, NM_212465.2:c.811A>G, NM_212467.2:c.*765A>G, NR_027911.1:n.1303A>G, NR_027912.1:n.1581A>G, XM_005254703.1:c.1072A>G, XM_005254704.1:c.811A>G, XM_005254705.1:c.811A>G, XM_005254706.1:c.667A>GVOUS05/21/2015
152CAPN3Ex8NM_000070.2:c.1073A>Gp.Asn358Ser | p.N358SNM_000070.2:c.1073A>G, NM_024344.1:c.1073A>G, NM_173087.1:c.929A>G, NM_212464.2:c.812A>G, NM_212465.2:c.812A>G, NM_212467.2:c.*766A>G, NR_027911.1:n.1304A>G, NR_027912.1:n.1582A>G, XM_005254703.1:c.1073A>G, XM_005254704.1:c.812A>G, XM_005254705.1:c.812A>G, XM_005254706.1:c.668A>GVOUS08/17/2015
153CAPN3Ex8NM_000070.2:c.1076C>Tp.Pro359Leu | p.P359LNM_000070.2:c.1076C>T, NM_024344.1:c.1076C>T, NM_173087.1:c.932C>T, NM_212464.2:c.815C>T, NM_212465.2:c.815C>T, NM_212467.2:c.*769C>T, NR_027911.1:n.1307C>T, NR_027912.1:n.1585C>T, XM_005254703.1:c.1076C>T, XM_005254704.1:c.815C>T, XM_005254705.1:c.815C>T, XM_005254706.1:c.671C>TVOUS11/04/2015
154CAPN3Ex8NM_000070.2:c.1079G>Ap.Trp360* | p.W360XLRG_849t1:c.1079G>A, NM_000070.2:c.1079G>A, NM_024344.1:c.1079G>A, NM_173087.1:c.935G>A, NM_212464.2:c.818G>A, NM_212465.2:c.818G>A, NM_212467.2:c.*772G>A, NR_027911.1:n.1310G>A, NR_027912.1:n.1588G>A, XM_005254703.1:c.1079G>A, XM_005254704.1:c.818G>A, XM_005254705.1:c.818G>A, XM_005254706.1:c.674G>APathogenic06/20/2018 
155CAPN3Ex8NM_000070.2:c.1082G>Ap.Gly361Asp | p.G361DNM_000070.2:c.1082G>A, NM_024344.1:c.1082G>A, NM_173087.1:c.938G>A, NM_212464.2:c.821G>A, NM_212465.2:c.821G>A, NM_212467.2:c.*775G>A, NR_027911.1:n.1313G>A, NR_027912.1:n.1591G>A, XM_005254703.1:c.1082G>A, XM_005254704.1:c.821G>A, XM_005254705.1:c.821G>A, XM_005254706.1:c.677G>AVOUS02/02/2016
156CAPN3Ex8NM_000070.2:c.1115+8A>GNM_000070.2:c.1115+8A>G, NM_024344.1:c.1115+8A>G, NM_173087.1:c.971+8A>G, NM_212464.2:c.854+8A>G, NM_212465.2:c.854+8A>G, NM_212467.2:c.*808+8A>G, NR_027911.1:n.1346+8A>G, NR_027912.1:n.1624+8A>G, XM_005254703.1:c.1115+8A>G, XM_005254704.1:c.854+8A>G, XM_005254705.1:c.854+8A>G, XM_005254706.1:c.710+8A>GVOUS12/15/2015
157CAPN3Ex9NM_000070.2:c.1116-5A>GBenign03/14/2014 
158CAPN3Ex9NM_000070.2:c.1117T>Cp.Trp373Arg | p.W373RNM_000070.2:c.1117T>C, NM_024344.1:c.1117T>C, NM_173087.1:c.973T>C, NM_212464.2:c.856T>C, NM_212465.2:c.856T>C, NM_212467.2:c.*810T>C, NR_027911.1:n.1348T>C, NR_027912.1:n.1626T>C, XM_005254703.1:c.1117T>C, XM_005254704.1:c.856T>C, XM_005254705.1:c.856T>C, XM_005254706.1:c.712T>CVOUS12/28/2016
159CAPN3Ex9NM_000070.2:c.1118G>Ap.Trp373* | p.W373XLRG_849t1:c.1118G>A, NM_000070.2:c.1118G>A, NM_024344.1:c.1118G>A, NM_173087.1:c.974G>A, NM_212464.2:c.857G>A, NM_212465.2:c.857G>A, NM_212467.2:c.*811G>A, NR_027911.1:n.1349G>A, NR_027912.1:n.1627G>A, XM_005254703.1:c.1118G>A, XM_005254704.1:c.857G>A, XM_005254705.1:c.857G>A, XM_005254706.1:c.713G>APathogenic10/10/2016 
160CAPN3Ex9NM_000070.2:c.1127G>Ap.Trp376* | p.W376XLRG_849t1:c.1127G>A, NM_000070.2:c.1127G>A, NM_024344.1:c.1127G>A, NM_173087.1:c.983G>A, NM_212464.2:c.866G>A, NM_212465.2:c.866G>A, NM_212467.2:c.*820G>A, NR_027911.1:n.1358G>A, NR_027912.1:n.1636G>A, XM_005254703.1:c.1127G>A, XM_005254704.1:c.866G>A, XM_005254705.1:c.866G>A, XM_005254706.1:c.722G>APathogenic11/03/2016 
161CAPN3Ex9NM_000070.2:c.1148A>Gp.Glu383Gly | p.E383GLRG_849t1:c.1148A>G, NM_000070.2:c.1148A>G, NM_024344.1:c.1148A>G, NM_173087.1:c.1004A>G, NM_212464.2:c.887A>G, NM_212465.2:c.887A>G, NM_212467.2:c.*841A>G, NR_027911.1:n.1379A>G, NR_027912.1:n.1657A>G, XM_005254703.1:c.1148A>G, XM_005254704.1:c.887A>G, XM_005254705.1:c.887A>G, XM_005254706.1:c.743A>GVOUS06/01/2016
162CAPN3Ex9NM_000070.2:c.1187A>Gp.Glu396Gly | p.E396GLRG_849t1:c.1187A>G, NM_000070.2:c.1187A>G, NM_024344.1:c.1187A>G, NM_173087.1:c.1043A>G, NM_212464.2:c.926A>G, NM_212465.2:c.926A>G, NM_212467.2:c.*880A>G, NR_027911.1:n.1418A>G, NR_027912.1:n.1696A>G, XM_005254703.1:c.1187A>G, XM_005254704.1:c.926A>G, XM_005254705.1:c.926A>G, XM_005254706.1:c.782A>GVOUS10/07/2016
163CAPN3Ex9NM_000070.2:c.1193G>Cp.Trp398Ser | p.W398SNM_000070.2:c.1193G>C, NM_024344.1:c.1193G>C, NM_173087.1:c.1049G>C, NM_212464.2:c.932G>C, NM_212465.2:c.932G>C, NM_212467.2:c.*886G>C, NR_027911.1:n.1424G>C, NR_027912.1:n.1702G>C, XM_005254703.1:c.1193G>C, XM_005254704.1:c.932G>C, XM_005254705.1:c.932G>C, XM_005254706.1:c.788G>CVOUS09/03/2015
164CAPN3Ex10NM_000070.2:c.1194-45C>TBenign** 
165CAPN3Ex10NM_000070.2:c.1194-26C>GBenign** 
166CAPN3Ex10NM_000070.2:c.1194-9A>GNM_000070.2:c.1194-9A>G, NM_024344.1:c.1194-9A>G, NM_173087.1:c.1050-9A>G, NM_173088.1:c.-3076A>G, NM_212464.2:c.933-9A>G, NM_212465.2:c.933-9A>G, NM_212467.2:c.*887-9A>G, NR_027911.1:n.1425-9A>G, NR_027912.1:n.1703-9A>G, XM_005254703.1:c.1194-9A>G, XM_005254704.1:c.933-9A>G, XM_005254705.1:c.933-9A>G, XM_005254706.1:c.789-9A>GPathogenic10/10/2017 
167CAPN3Ex10NM_000070.2:c.1202A>Gp.Tyr401Cys | p.Y401CLRG_849t1:c.1202A>G, NM_000070.2:c.1202A>G, NM_024344.1:c.1202A>G, NM_173087.1:c.1058A>G, NM_173088.1:c.-3059A>G, NM_212464.2:c.941A>G, NM_212465.2:c.941A>G, NM_212467.2:c.*895A>G, NR_027911.1:n.1433A>G, NR_027912.1:n.1711A>G, XM_005254703.1:c.1202A>G, XM_005254704.1:c.941A>G, XM_005254705.1:c.941A>G, XM_005254706.1:c.797A>GVOUS08/22/2017
168CAPN3Ex10NM_000070.2:c.1227A>Cp.Thr409= | p.T409=LRG_849t1:c.1227A>C, NM_000070.2:c.1227A>C, NM_024344.1:c.1227A>C, NM_173087.1:c.1083A>C, NM_173088.1:c.-3034A>C, NM_212464.2:c.966A>C, NM_212465.2:c.966A>C, NM_212467.2:c.*920A>C, NR_027911.1:n.1458A>C, NR_027912.1:n.1736A>C, XM_005254703.1:c.1227A>C, XM_005254704.1:c.966A>C, XM_005254705.1:c.966A>C, XM_005254706.1:c.822A>CVOUS04/23/2018
169CAPN3Ex10NM_000070.2:c.1227A>Gp.Thr409= | p.T409=LRG_849t1:c.1227A>G, NM_000070.2:c.1227A>G, NM_024344.1:c.1227A>G, NM_173087.1:c.1083A>G, NM_173088.1:c.-3034A>G, NM_212464.2:c.966A>G, NM_212465.2:c.966A>G, NM_212467.2:c.*920A>G, NR_027911.1:n.1458A>G, NR_027912.1:n.1736A>G, XM_005254703.1:c.1227A>G, XM_005254704.1:c.966A>G, XM_005254705.1:c.966A>G, XM_005254706.1:c.822A>GVOUS06/20/2016
170CAPN3Ex10NM_000070.2:c.1250C>Tp.Thr417Met | p.T417MNM_000070.2:c.1250C>T, NM_024344.1:c.1250C>T, NM_173087.1:c.1106C>T, NM_173088.1:c.-3011C>T, NM_212464.2:c.989C>T, NM_212465.2:c.989C>T, NM_212467.2:c.*943C>T, NR_027911.1:n.1481C>T, NR_027912.1:n.1759C>T, XM_005254703.1:c.1250C>T, XM_005254704.1:c.989C>T, XM_005254705.1:c.989C>T, XM_005254706.1:c.845C>TPathogenic04/12/2017 
171CAPN3Ex10NM_000070.2:c.1251G>Ap.Thr417= | p.T417=NM_000070.2:c.1251G>A, NM_024344.1:c.1251G>A, NM_173087.1:c.1107G>A, NM_173088.1:c.-3010G>A, NM_212464.2:c.990G>A, NM_212465.2:c.990G>A, NM_212467.2:c.*944G>A, NR_027911.1:n.1482G>A, NR_027912.1:n.1760G>A, XM_005254703.1:c.1251G>A, XM_005254704.1:c.990G>A, XM_005254705.1:c.990G>A, XM_005254706.1:c.846G>AVOUS10/13/2015
172CAPN3Ex10NM_000070.2:c.1256A>Gp.Asp419Gly | p.D419GNM_000070.2:c.1256A>G, NM_024344.1:c.1256A>G, NM_173087.1:c.1112A>G, NM_173088.1:c.-3005A>G, NM_212464.2:c.995A>G, NM_212465.2:c.995A>G, NM_212467.2:c.*949A>G, NR_027911.1:n.1487A>G, NR_027912.1:n.1765A>G, XM_005254703.1:c.1256A>G, XM_005254704.1:c.995A>G, XM_005254705.1:c.995A>G, XM_005254706.1:c.851A>GLikely pathogenic05/25/2017 
173CAPN3Ex10NM_000070.2:c.1257T>Gp.Asp419Glu | p.D419ELRG_849t1:c.1257T>G, NM_000070.2:c.1257T>G, NM_024344.1:c.1257T>G, NM_173087.1:c.1113T>G, NM_173088.1:c.-3004T>G, NM_212464.2:c.996T>G, NM_212465.2:c.996T>G, NM_212467.2:c.*950T>G, NR_027911.1:n.1488T>G, NR_027912.1:n.1766T>G, XM_005254703.1:c.1257T>G, XM_005254704.1:c.996T>G, XM_005254705.1:c.996T>G, XM_005254706.1:c.852T>GLikely pathogenic05/09/2018 
174CAPN3Ex10NM_000070.2:c.1263G>Ap.Leu421= | p.L421=LRG_849t1:c.1263G>A, NM_000070.2:c.1263G>A, NM_024344.1:c.1263G>A, NM_173087.1:c.1119G>A, NM_173088.1:c.-2998G>A, NM_212464.2:c.1002G>A, NM_212465.2:c.1002G>A, NM_212467.2:c.*956G>A, NR_027911.1:n.1494G>A, NR_027912.1:n.1772G>A, XM_005254703.1:c.1263G>A, XM_005254704.1:c.1002G>A, XM_005254705.1:c.1002G>A, XM_005254706.1:c.858G>AVOUS12/22/2017
175CAPN3Ex10NM_000070.2:c.1267T>Cp.Ser423Pro | p.S423PLRG_849t1:c.1267T>C, NM_000070.2:c.1267T>C, NM_024344.1:c.1267T>C, NM_173087.1:c.1123T>C, NM_173088.1:c.-2994T>C, NM_212464.2:c.1006T>C, NM_212465.2:c.1006T>C, NM_212467.2:c.*960T>C, NR_027911.1:n.1498T>C, NR_027912.1:n.1776T>C, XM_005254703.1:c.1267T>C, XM_005254704.1:c.1006T>C, XM_005254705.1:c.1006T>C, XM_005254706.1:c.862T>CVOUS05/09/2018
176CAPN3Ex10NM_000070.2:c.1290A>Gp.Thr430= | p.T430=LRG_849t1:c.1290A>G, NM_000070.2:c.1290A>G, NM_024344.1:c.1290A>G, NM_173087.1:c.1146A>G, NM_173088.1:c.-2971A>G, NM_212464.2:c.1029A>G, NM_212465.2:c.1029A>G, NM_212467.2:c.*983A>G, NR_027911.1:n.1521A>G, NR_027912.1:n.1799A>G, XM_005254703.1:c.1290A>G, XM_005254704.1:c.1029A>G, XM_005254705.1:c.1029A>G, XM_005254706.1:c.885A>GVOUS05/30/2018
177CAPN3Ex10NM_000070.2:c.1291G>Cp.Val431Leu | p.V431LLRG_849t1:c.1291G>C, NM_000070.2:c.1291G>C, NM_024344.1:c.1291G>C, NM_173087.1:c.1147G>C, NM_173088.1:c.-2970G>C, NM_212464.2:c.1030G>C, NM_212465.2:c.1030G>C, NM_212467.2:c.*984G>C, NR_027911.1:n.1522G>C, NR_027912.1:n.1800G>C, XM_005254703.1:c.1291G>C, XM_005254704.1:c.1030G>C, XM_005254705.1:c.1030G>C, XM_005254706.1:c.886G>CVOUS10/03/2018
178CAPN3Ex10NM_000070.2:c.1292T>Cp.Val431Ala | p.V431ALRG_849t1:c.1292T>C, NM_000070.2:c.1292T>C, NM_024344.1:c.1292T>C, NM_173087.1:c.1148T>C, NM_173088.1:c.-2969T>C, NM_212464.2:c.1031T>C, NM_212465.2:c.1031T>C, NM_212467.2:c.*985T>C, NR_027911.1:n.1523T>C, NR_027912.1:n.1801T>C, XM_005254703.1:c.1292T>C, XM_005254704.1:c.1031T>C, XM_005254705.1:c.1031T>C, XM_005254706.1:c.887T>CVOUS12/07/2018
179CAPN3Ex10NM_000070.2:c.1302C>Tp.Asn434= | p.N434=NM_000070.2:c.1302C>T, NM_024344.1:c.1302C>T, NM_173087.1:c.1158C>T, NM_173088.1:c.-2959C>T, NM_212464.2:c.1041C>T, NM_212465.2:c.1041C>T, NM_212467.2:c.*995C>T, NR_027911.1:n.1533C>T, NR_027912.1:n.1811C>T, XM_005254703.1:c.1302C>T, XM_005254704.1:c.1041C>T, XM_005254705.1:c.1041C>T, XM_005254706.1:c.897C>TLikely benign12/05/2016 
180CAPN3Ex10NM_000070.2:c.1303G>Ap.Glu435Lys | p.E435KLRG_849t1:c.1303G>A, NM_000070.2:c.1303G>A, NM_024344.1:c.1303G>A, NM_173087.1:c.1159G>A, NM_173088.1:c.-2958G>A, NM_212464.2:c.1042G>A, NM_212465.2:c.1042G>A, NM_212467.2:c.*996G>A, NR_027911.1:n.1534G>A, NR_027912.1:n.1812G>A, XM_005254703.1:c.1303G>A, XM_005254704.1:c.1042G>A, XM_005254705.1:c.1042G>A, XM_005254706.1:c.898G>APathogenic08/29/2018 
181CAPN3Ex10NM_000070.2:c.1309C>Tp.Arg437Cys | p.R437CNM_000070.2:c.1309C>T, NM_024344.1:c.1309C>T, NM_173087.1:c.1165C>T, NM_173088.1:c.-2952C>T, NM_212464.2:c.1048C>T, NM_212465.2:c.1048C>T, NM_212467.2:c.*1002C>T, NR_027911.1:n.1540C>T, NR_027912.1:n.1818C>T, XM_005254703.1:c.1309C>T, XM_005254704.1:c.1048C>T, XM_005254705.1:c.1048C>T, XM_005254706.1:c.904C>TLikely pathogenic01/19/2016 
182CAPN3Ex10NM_000070.2:c.1318C>Tp.Arg440Trp | p.R440WNM_000070.2:c.1318C>T, NM_024344.1:c.1318C>T, NM_173087.1:c.1174C>T, NM_173088.1:c.-2943C>T, NM_212464.2:c.1057C>T, NM_212465.2:c.1057C>T, NM_212467.2:c.*1011C>T, NR_027911.1:n.1549C>T, NR_027912.1:n.1827C>T, XM_005254703.1:c.1318C>T, XM_005254704.1:c.1057C>T, XM_005254705.1:c.1057C>T, XM_005254706.1:c.913C>TPathogenic10/15/2018 
183CAPN3Ex10NM_000070.2:c.1319G>Ap.Arg440Gln | p.R440QNM_000070.2:c.1319G>A, NM_024344.1:c.1319G>A, NM_173087.1:c.1175G>A, NM_173088.1:c.-2942G>A, NM_212464.2:c.1058G>A, NM_212465.2:c.1058G>A, NM_212467.2:c.*1012G>A, NR_027911.1:n.1550G>A, NR_027912.1:n.1828G>A, XM_005254703.1:c.1319G>A, XM_005254704.1:c.1058G>A, XM_005254705.1:c.1058G>A, XM_005254706.1:c.914G>APathogenic06/05/2018 
184CAPN3Ex10NM_000070.2:c.1322delGNM_000070.2:c.1322delG, NM_024344.1:c.1322delG, NM_173087.1:c.1178delG, NM_173088.1:c.-2939delG, NM_212464.2:c.1061delG, NM_212465.2:c.1061delG, NM_212467.2:c.*1015delG, NR_027911.1:n.1553delG, NR_027912.1:n.1831delG, XM_005254703.1:c.1322delG, XM_005254704.1:c.1061delG, XM_005254705.1:c.1061delG, XM_005254706.1:c.917delGPathogenic12/09/2015 
185CAPN3Ex10NM_000070.2:c.1325G>Ap.Cys442Tyr | p.C442YNM_000070.2:c.1325G>A, NM_024344.1:c.1325G>A, NM_173087.1:c.1181G>A, NM_173088.1:c.-2936G>A, NM_212464.2:c.1064G>A, NM_212465.2:c.1064G>A, NM_212467.2:c.*1018G>A, NR_027911.1:n.1556G>A, NR_027912.1:n.1834G>A, XM_005254703.1:c.1325G>A, XM_005254704.1:c.1064G>A, XM_005254705.1:c.1064G>A, XM_005254706.1:c.920G>AVOUS07/15/2015
186CAPN3Ex10NM_000070.2:c.1327T>Cp.Ser443Pro | p.S443PLRG_849t1:c.1327T>C, NM_000070.2:c.1327T>C, NM_024344.1:c.1327T>C, NM_173087.1:c.1183T>C, NM_173088.1:c.-2934T>C, NM_212464.2:c.1066T>C, NM_212465.2:c.1066T>C, NM_212467.2:c.*1020T>C, NR_027911.1:n.1558T>C, NR_027912.1:n.1836T>C, XM_005254703.1:c.1327T>C, XM_005254704.1:c.1066T>C, XM_005254705.1:c.1066T>C, XM_005254706.1:c.922T>CVOUS10/03/2018
187CAPN3Ex10NM_000070.2:c.1331delCinsTCGTACCCAGp.Ala444delinsValValProSer | p.A444delinsVVPSLRG_849t1:c.1331delinsTCGTACCCAG, NM_000070.2:c.1331delinsTCGTACCCAG, NM_024344.1:c.1331delinsTCGTACCCAG, NM_173087.1:c.1187delinsTCGTACCCAG, NM_173088.1:c.-2930delinsTCGTACCCAG, NM_212464.2:c.1070delinsTCGTACCCAG, NM_212465.2:c.1070delinsTCGTACCCAG, NM_212467.2:c.*1024delinsTCGTACCCAG, NR_027911.1:n.1562delinsTCGTACCCAG, NR_027912.1:n.1840delinsTCGTACCCAG, XM_005254703.1:c.1331delinsTCGTACCCAG, XM_005254704.1:c.1070delinsTCGTACCCAG, XM_005254705.1:c.1070delinsTCGTACCCAG, XM_005254706.1:c.926delinsTCGTACCCAGVOUS07/02/2018
188CAPN3Ex10NM_000070.2:c.1332C>Tp.Ala444= | p.A444=NM_000070.2:c.1332C>T, NM_024344.1:c.1332C>T, NM_173087.1:c.1188C>T, NM_173088.1:c.-2929C>T, NM_212464.2:c.1071C>T, NM_212465.2:c.1071C>T, NM_212467.2:c.*1025C>T, NR_027911.1:n.1563C>T, NR_027912.1:n.1841C>T, XM_005254703.1:c.1332C>T, XM_005254704.1:c.1071C>T, XM_005254705.1:c.1071C>T, XM_005254706.1:c.927C>TVOUS12/15/2015
189CAPN3Ex10NM_000070.2:c.1333G>Ap.Gly445Arg | p.G445RNM_000070.2:c.1333G>A, NM_024344.1:c.1333G>A, NM_173087.1:c.1189G>A, NM_173088.1:c.-2928G>A, NM_212464.2:c.1072G>A, NM_212465.2:c.1072G>A, NM_212467.2:c.*1026G>A, NR_027911.1:n.1564G>A, NR_027912.1:n.1842G>A, XM_005254703.1:c.1333G>A, XM_005254704.1:c.1072G>A, XM_005254705.1:c.1072G>A, XM_005254706.1:c.928G>APathogenic03/28/2017 
190CAPN3Ex10NM_000070.2:c.1333G>Cp.Gly445Arg | p.G445RLRG_849t1:c.1333G>C, NM_000070.2:c.1333G>C, NM_024344.1:c.1333G>C, NM_173087.1:c.1189G>C, NM_173088.1:c.-2928G>C, NM_212464.2:c.1072G>C, NM_212465.2:c.1072G>C, NM_212467.2:c.*1026G>C, NR_027911.1:n.1564G>C, NR_027912.1:n.1842G>C, XM_005254703.1:c.1333G>C, XM_005254704.1:c.1072G>C, XM_005254705.1:c.1072G>C, XM_005254706.1:c.928G>CLikely pathogenic03/08/2018 
191CAPN3Ex10NM_000070.2:c.1336G>Ap.Gly446Ser | p.G446SNM_000070.2:c.1336G>A, NM_024344.1:c.1336G>A, NM_173087.1:c.1192G>A, NM_173088.1:c.-2925G>A, NM_212464.2:c.1075G>A, NM_212465.2:c.1075G>A, NM_212467.2:c.*1029G>A, NR_027911.1:n.1567G>A, NR_027912.1:n.1845G>A, XM_005254703.1:c.1336G>A, XM_005254704.1:c.1075G>A, XM_005254705.1:c.1075G>A, XM_005254706.1:c.931G>AVOUS11/03/2015
192CAPN3Ex10NM_000070.2:c.1342C>Tp.Arg448Cys | p.R448CNM_000070.2:c.1342C>T, NM_024344.1:c.1342C>T, NM_173087.1:c.1198C>T, NM_173088.1:c.-2919C>T, NM_212464.2:c.1081C>T, NM_212465.2:c.1081C>T, NM_212467.2:c.*1035C>T, NR_027911.1:n.1573C>T, NR_027912.1:n.1851C>T, XM_005254703.1:c.1342C>T, XM_005254704.1:c.1081C>T, XM_005254705.1:c.1081C>T, XM_005254706.1:c.937C>TPathogenic12/03/2018 
193CAPN3Ex10NM_000070.2:c.1343G>Ap.Arg448His | p.R448HLRG_849t1:c.1343G>A, NM_000070.2:c.1343G>A, NM_024344.1:c.1343G>A, NM_173087.1:c.1199G>A, NM_173088.1:c.-2918G>A, NM_212464.2:c.1082G>A, NM_212465.2:c.1082G>A, NM_212467.2:c.*1036G>A, NR_027911.1:n.1574G>A, NR_027912.1:n.1852G>A, XM_005254703.1:c.1343G>A, XM_005254704.1:c.1082G>A, XM_005254705.1:c.1082G>A, XM_005254706.1:c.938G>APathogenic11/01/2016 
194CAPN3Ex10NM_000070.2:c.1345A>Cp.Asn449His | p.N449HNM_000070.2:c.1345A>C, NM_024344.1:c.1345A>C, NM_173087.1:c.1201A>C, NM_173088.1:c.-2916A>C, NM_212464.2:c.1084A>C, NM_212465.2:c.1084A>C, NM_212467.2:c.*1038A>C, NR_027911.1:n.1576A>C, NR_027912.1:n.1854A>C, XM_005254703.1:c.1345A>C, XM_005254704.1:c.1084A>C, XM_005254705.1:c.1084A>C, XM_005254706.1:c.940A>CVOUS01/23/2016
195CAPN3Ex10NM_000070.2:c.1350C>Tp.Phe450= | p.F450=NM_000070.2:c.1350C>T, NM_024344.1:c.1350C>T, NM_173087.1:c.1206C>T, NM_173088.1:c.-2911C>T, NM_212464.2:c.1089C>T, NM_212465.2:c.1089C>T, NM_212467.2:c.*1043C>T, NR_027911.1:n.1581C>T, NR_027912.1:n.1859C>T, XM_005254703.1:c.1350C>T, XM_005254704.1:c.1089C>T, XM_005254705.1:c.1089C>T, XM_005254706.1:c.945C>TLikely benign06/11/2015 
196CAPN3Ex10NM_000070.2:c.1353A>Cp.Pro451= | p.P451=LRG_849t1:c.1353A>C, NM_000070.2:c.1353A>C, NM_024344.1:c.1353A>C, NM_173087.1:c.1209A>C, NM_173088.1:c.-2908A>C, NM_212464.2:c.1092A>C, NM_212465.2:c.1092A>C, NM_212467.2:c.*1046A>C, NR_027911.1:n.1584A>C, NR_027912.1:n.1862A>C, XM_005254703.1:c.1353A>C, XM_005254704.1:c.1092A>C, XM_005254705.1:c.1092A>C, XM_005254706.1:c.948A>CVOUS08/29/2016
197CAPN3Ex10NM_000070.2:c.1354G>Tp.Asp452Tyr | p.D452YLRG_849t1:c.1354G>T, NM_000070.2:c.1354G>T, NM_024344.1:c.1354G>T, NM_173087.1:c.1210G>T, NM_173088.1:c.-2907G>T, NM_212464.2:c.1093G>T, NM_212465.2:c.1093G>T, NM_212467.2:c.*1047G>T, NR_027911.1:n.1585G>T, NR_027912.1:n.1863G>T, XM_005254703.1:c.1354G>T, XM_005254704.1:c.1093G>T, XM_005254705.1:c.1093G>T, XM_005254706.1:c.949G>TVOUS04/17/2014
198CAPN3Ex11NM_000070.2:c.1355-6G>ABenign** 
199CAPN3Ex11NM_000070.2:c.1355-1G>CLRG_849t1:c.1355-1G>C, NM_000070.2:c.1355-1G>C, NM_024344.1:c.1355-1G>C, NM_173087.1:c.1211-1G>C, NM_173088.1:c.-919G>C, NM_173089.1:c.-3397G>C, NM_173090.1:c.-3415G>C, NM_212464.2:c.1094-1G>C, NM_212465.2:c.1094-1G>C, NM_212467.2:c.*1048-1G>C, NR_027911.1:n.1586-1G>C, NR_027912.1:n.1864-1G>C, XM_005254703.1:c.1355-1G>C, XM_005254704.1:c.1094-1G>C, XM_005254705.1:c.1094-1G>C, XM_005254706.1:c.950-1G>CPathogenic06/01/2016 
200CAPN3Ex11NM_000070.2:c.1373delCLRG_849t1:c.1373delC, NM_000070.2:c.1373delC, NM_024344.1:c.1373delC, NM_173087.1:c.1229delC, NM_173088.1:c.-900delC, NM_173089.1:c.-3378delC, NM_173090.1:c.-3396delC, NM_212464.2:c.1112delC, NM_212465.2:c.1112delC, NM_212467.2:c.*1066delC, NR_027911.1:n.1604delC, NR_027912.1:n.1882delC, XM_005254703.1:c.1373delC, XM_005254704.1:c.1112delC, XM_005254705.1:c.1112delC, XM_005254706.1:c.968delCPathogenic04/20/2016 
201CAPN3Ex11NM_000070.2:c.1377G>Tp.Gln459His | p.Q459HLRG_849t1:c.1377G>T, NM_000070.2:c.1377G>T, NM_024344.1:c.1377G>T, NM_173087.1:c.1233G>T, NM_173088.1:c.-896G>T, NM_173089.1:c.-3374G>T, NM_173090.1:c.-3392G>T, NM_212464.2:c.1116G>T, NM_212465.2:c.1116G>T, NM_212467.2:c.*1070G>T, NR_027911.1:n.1608G>T, NR_027912.1:n.1886G>T, XM_005254703.1:c.1377G>T, XM_005254704.1:c.1116G>T, XM_005254705.1:c.1116G>T, XM_005254706.1:c.972G>TVOUS09/29/2016
202CAPN3Ex11NM_000070.2:c.1378T>Ap.Tyr460Asn | p.Y460NNM_000070.2:c.1378T>A, NM_024344.1:c.1378T>A, NM_173087.1:c.1234T>A, NM_173088.1:c.-895T>A, NM_173089.1:c.-3373T>A, NM_173090.1:c.-3391T>A, NM_212464.2:c.1117T>A, NM_212465.2:c.1117T>A, NM_212467.2:c.*1071T>A, NR_027911.1:n.1609T>A, NR_027912.1:n.1887T>A, XM_005254703.1:c.1378T>A, XM_005254704.1:c.1117T>A, XM_005254705.1:c.1117T>A, XM_005254706.1:c.973T>AVOUS11/10/2015
203CAPN3Ex11NM_000070.2:c.1381C>Tp.Arg461Cys | p.R461CLRG_849t1:c.1381C>T, NM_000070.2:c.1381C>T, NM_024344.1:c.1381C>T, NM_173087.1:c.1237C>T, NM_173088.1:c.-892C>T, NM_173089.1:c.-3370C>T, NM_173090.1:c.-3388C>T, NM_212464.2:c.1120C>T, NM_212465.2:c.1120C>T, NM_212467.2:c.*1074C>T, NR_027911.1:n.1612C>T, NR_027912.1:n.1890C>T, XM_005254703.1:c.1381C>T, XM_005254704.1:c.1120C>T, XM_005254705.1:c.1120C>T, XM_005254706.1:c.976C>TPathogenic04/20/2017 
204CAPN3Ex11NM_000070.2:c.1435A>Gp.Ser479Gly | p.S479GNM_000070.2:c.1435A>G, NM_024344.1:c.1435A>G, NM_173087.1:c.1291A>G, NM_173088.1:c.-838A>G, NM_173089.1:c.-3316A>G, NM_173090.1:c.-3334A>G, NM_212464.2:c.1174A>G, NM_212465.2:c.1174A>G, NM_212467.2:c.*1128A>G, NR_027911.1:n.1666A>G, NR_027912.1:n.1944A>GPathogenic10/09/2018 
205CAPN3Ex11NM_000070.2:c.1437C>Tp.Ser479= | p.S479=LRG_849t1:c.1437C>T, NM_000070.2:c.1437C>T, NM_024344.1:c.1437C>T, NM_173087.1:c.1293C>T, NM_173088.1:c.-836C>T, NM_173089.1:c.-3314C>T, NM_173090.1:c.-3332C>T, NM_212464.2:c.1176C>T, NM_212465.2:c.1176C>T, NM_212467.2:c.*1130C>T, NR_027911.1:n.1668C>T, NR_027912.1:n.1946C>T, XM_005254703.1:c.1437C>T, XM_005254704.1:c.1176C>T, XM_005254705.1:c.1176C>T, XM_005254706.1:c.1032C>TVOUS11/01/2018
206CAPN3Ex11NM_000070.2:c.1439T>Ap.Phe480Tyr | p.F480YLRG_849t1:c.1439T>A, NM_000070.2:c.1439T>A, NM_024344.1:c.1439T>A, NM_173087.1:c.1295T>A, NM_173088.1:c.-834T>A, NM_173089.1:c.-3312T>A, NM_173090.1:c.-3330T>A, NM_212464.2:c.1178T>A, NM_212465.2:c.1178T>A, NM_212467.2:c.*1132T>A, NR_027911.1:n.1670T>A, NR_027912.1:n.1948T>A, XM_005254703.1:c.1439T>A, XM_005254704.1:c.1178T>A, XM_005254705.1:c.1178T>A, XM_005254706.1:c.1034T>AVOUS04/27/2017
207CAPN3Ex11NM_000070.2:c.1442T>Cp.Leu481Pro | p.L481PNM_000070.2:c.1442T>C, NM_024344.1:c.1442T>C, NM_173087.1:c.1298T>C, NM_173088.1:c.-831T>C, NM_173089.1:c.-3309T>C, NM_173090.1:c.-3327T>C, NM_212464.2:c.1181T>C, NM_212465.2:c.1181T>C, NM_212467.2:c.*1135T>C, NR_027911.1:n.1673T>C, NR_027912.1:n.1951T>C, XM_005254703.1:c.1442T>C, XM_005254704.1:c.1181T>C, XM_005254705.1:c.1181T>C, XM_005254706.1:c.1037T>CVOUS01/25/2016
208CAPN3Ex11NM_000070.2:c.1444G>Ap.Val482Met | p.V482MLRG_849t1:c.1444G>A, NM_000070.2:c.1444G>A, NM_024344.1:c.1444G>A, NM_173087.1:c.1300G>A, NM_173088.1:c.-829G>A, NM_173089.1:c.-3307G>A, NM_173090.1:c.-3325G>A, NM_212464.2:c.1183G>A, NM_212465.2:c.1183G>A, NM_212467.2:c.*1137G>A, NR_027911.1:n.1675G>A, NR_027912.1:n.1953G>A, XM_005254703.1:c.1444G>A, XM_005254704.1:c.1183G>A, XM_005254705.1:c.1183G>A, XM_005254706.1:c.1039G>AVOUS12/22/2017
209CAPN3Ex11NM_000070.2:c.1450C>Ap.Leu484Met | p.L484MLRG_849t1:c.1450C>A, NM_000070.2:c.1450C>A, NM_024344.1:c.1450C>A, NM_173087.1:c.1306C>A, NM_173088.1:c.-823C>A, NM_173089.1:c.-3301C>A, NM_173090.1:c.-3319C>A, NM_212464.2:c.1189C>A, NM_212465.2:c.1189C>A, NM_212467.2:c.*1143C>A, NR_027911.1:n.1681C>A, NR_027912.1:n.1959C>A, XM_005254703.1:c.1450C>A, XM_005254704.1:c.1189C>A, XM_005254705.1:c.1189C>A, XM_005254706.1:c.1045C>AVOUS10/05/2016
210CAPN3Ex11NM_000070.2:c.1465C>Tp.Arg489Trp | p.R489WNM_000070.2:c.1465C>T, NM_024344.1:c.1465C>T, NM_173087.1:c.1321C>T, NM_173088.1:c.-808C>T, NM_173089.1:c.-3286C>T, NM_173090.1:c.-3304C>T, NM_212464.2:c.1204C>T, NM_212465.2:c.1204C>T, NM_212467.2:c.*1158C>T, NR_027911.1:n.1696C>T, NR_027912.1:n.1974C>T, XM_005254703.1:c.1465C>T, XM_005254704.1:c.1204C>T, XM_005254705.1:c.1204C>T, XM_005254706.1:c.1060C>TPathogenic11/23/2016 
211CAPN3Ex11NM_000070.2:c.1466G>Ap.Arg489Gln | p.R489QLRG_849t1:c.1466G>A, NM_000070.2:c.1466G>A, NM_024344.1:c.1466G>A, NM_173087.1:c.1322G>A, NM_173088.1:c.-807G>A, NM_173089.1:c.-3285G>A, NM_173090.1:c.-3303G>A, NM_212464.2:c.1205G>A, NM_212465.2:c.1205G>A, NM_212467.2:c.*1159G>A, NR_027911.1:n.1697G>A, NR_027912.1:n.1975G>A, XM_005254703.1:c.1466G>A, XM_005254704.1:c.1205G>A, XM_005254705.1:c.1205G>A, XM_005254706.1:c.1061G>APathogenic02/09/2018 
212CAPN3Ex11NM_000070.2:c.1468C>Tp.Arg490Trp | p.R490WNM_000070.2:c.1468C>T, NM_024344.1:c.1468C>T, NM_173087.1:c.1324C>T, NM_173088.1:c.-805C>T, NM_173089.1:c.-3283C>T, NM_173090.1:c.-3301C>T, NM_212464.2:c.1207C>T, NM_212465.2:c.1207C>T, NM_212467.2:c.*1161C>T, NR_027911.1:n.1699C>T, NR_027912.1:n.1977C>TPathogenic03/23/2018 
213CAPN3Ex11NM_000070.2:c.1469G>Ap.Arg490Gln | p.R490QNM_000070.2:c.1469G>A, NM_024344.1:c.1469G>A, NM_173087.1:c.1325G>A, NM_173088.1:c.-804G>A, NM_173089.1:c.-3282G>A, NM_173090.1:c.-3300G>A, NM_212464.2:c.1208G>A, NM_212465.2:c.1208G>A, NM_212467.2:c.*1162G>A, NR_027911.1:n.1700G>A, NR_027912.1:n.1978G>A, XM_005254703.1:c.1469G>A, XM_005254704.1:c.1208G>A, XM_005254705.1:c.1208G>A, XM_005254706.1:c.1064G>APathogenic05/08/2017 
214CAPN3Ex11NM_000070.2:c.1477C>Tp.Arg493Trp | p.R493WNM_000070.2:c.1477C>T, NM_024344.1:c.1477C>T, NM_173087.1:c.1333C>T, NM_173088.1:c.-796C>T, NM_173089.1:c.-3274C>T, NM_173090.1:c.-3292C>T, NM_212464.2:c.1216C>T, NM_212465.2:c.1216C>T, NM_212467.2:c.*1170C>T, NR_027911.1:n.1708C>T, NR_027912.1:n.1986C>T, XM_005254703.1:c.1477C>T, XM_005254704.1:c.1216C>T, XM_005254705.1:c.1216C>T, XM_005254706.1:c.1072C>TLikely pathogenic08/18/2016 
215CAPN3Ex11NM_000070.2:c.1477C>Gp.Arg493Gly | p.R493GNM_000070.2:c.1477C>G, NM_024344.1:c.1477C>G, NM_173087.1:c.1333C>G, NM_173088.1:c.-796C>G, NM_173089.1:c.-3274C>G, NM_173090.1:c.-3292C>G, NM_212464.2:c.1216C>G, NM_212465.2:c.1216C>G, NM_212467.2:c.*1170C>G, NR_027911.1:n.1708C>G, NR_027912.1:n.1986C>G, XM_005254703.1:c.1477C>G, XM_005254704.1:c.1216C>G, XM_005254705.1:c.1216C>G, XM_005254706.1:c.1072C>GVOUS02/29/2016
216CAPN3Ex11NM_000070.2:c.1484T>Cp.Leu495Pro | p.L495PLRG_849t1:c.1484T>C, NM_000070.2:c.1484T>C, NM_024344.1:c.1484T>C, NM_173087.1:c.1340T>C, NM_173088.1:c.-789T>C, NM_173089.1:c.-3267T>C, NM_173090.1:c.-3285T>C, NM_212464.2:c.1223T>C, NM_212465.2:c.1223T>C, NM_212467.2:c.*1177T>C, NR_027911.1:n.1715T>C, NR_027912.1:n.1993T>C, XM_005254703.1:c.1484T>C, XM_005254704.1:c.1223T>C, XM_005254705.1:c.1223T>C, XM_005254706.1:c.1079T>CVOUS06/06/2016
217CAPN3Ex11NM_000070.2:c.1505T>Cp.Ile502Thr | p.I502TLRG_849t1:c.1505T>C, NM_000070.2:c.1505T>C, NM_024344.1:c.1505T>C, NM_173087.1:c.1361T>C, NM_173088.1:c.-768T>C, NM_173089.1:c.-3246T>C, NM_173090.1:c.-3264T>C, NM_212464.2:c.1244T>C, NM_212465.2:c.1244T>C, NM_212467.2:c.*1198T>C, NR_027911.1:n.1736T>C, NR_027912.1:n.2014T>C, XM_005254703.1:c.1505T>C, XM_005254704.1:c.1244T>C, XM_005254705.1:c.1244T>C, XM_005254706.1:c.1100T>CVOUS05/17/2018
218CAPN3Ex11NM_000070.2:c.1513G>Cp.Ala505Pro | p.A505PLRG_849t1:c.1513G>C, NM_000070.2:c.1513G>C, NM_024344.1:c.1513G>C, NM_173087.1:c.1369G>C, NM_173088.1:c.-760G>C, NM_173089.1:c.-3238G>C, NM_173090.1:c.-3256G>C, NM_212464.2:c.1252G>C, NM_212465.2:c.1252G>C, NM_212467.2:c.*1206G>C, NR_027911.1:n.1744G>C, NR_027912.1:n.2022G>C, XM_005254703.1:c.1513G>C, XM_005254704.1:c.1252G>C, XM_005254705.1:c.1252G>C, XM_005254706.1:c.1108G>CVOUS04/03/2017
219CAPN3Ex11NM_000070.2:c.1516A>Gp.Ile506Val | p.I506VLRG_849t1:c.1516A>G, NM_000070.2:c.1516A>G, NM_024344.1:c.1516A>G, NM_173087.1:c.1372A>G, NM_173088.1:c.-757A>G, NM_173089.1:c.-3235A>G, NM_173090.1:c.-3253A>G, NM_212464.2:c.1255A>G, NM_212465.2:c.1255A>G, NM_212467.2:c.*1209A>G, NR_027911.1:n.1747A>G, NR_027912.1:n.2025A>G, XM_005254703.1:c.1516A>G, XM_005254704.1:c.1255A>G, XM_005254705.1:c.1255A>G, XM_005254706.1:c.1111A>GVOUS03/16/2016
220CAPN3Ex11NM_000070.2:c.1517T>Cp.Ile506Thr | p.I506TLRG_849t1:c.1517T>C, NM_000070.2:c.1517T>C, NM_024344.1:c.1517T>C, NM_173087.1:c.1373T>C, NM_173088.1:c.-756T>C, NM_173089.1:c.-3234T>C, NM_173090.1:c.-3252T>C, NM_212464.2:c.1256T>C, NM_212465.2:c.1256T>C, NM_212467.2:c.*1210T>C, NR_027911.1:n.1748T>C, NR_027912.1:n.2026T>C, XM_005254703.1:c.1517T>C, XM_005254704.1:c.1256T>C, XM_005254705.1:c.1256T>C, XM_005254706.1:c.1112T>CLikely pathogenic01/03/2019 
221CAPN3Ex11NM_000070.2:c.1521C>Tp.Tyr507= | p.Y507=LRG_849t1:c.1521C>T, NM_000070.2:c.1521C>T, NM_024344.1:c.1521C>T, NM_173087.1:c.1377C>T, NM_173088.1:c.-752C>T, NM_173089.1:c.-3230C>T, NM_173090.1:c.-3248C>T, NM_212464.2:c.1260C>T, NM_212465.2:c.1260C>T, NM_212467.2:c.*1214C>T, NR_027911.1:n.1752C>T, NR_027912.1:n.2030C>T, XM_005254703.1:c.1521C>T, XM_005254704.1:c.1260C>T, XM_005254705.1:c.1260C>T, XM_005254706.1:c.1116C>TVOUS02/08/2017
222CAPN3Ex11NM_000070.2:c.1524G>Ap.Glu508= | p.E508=LRG_849t1:c.1524G>A, NM_000070.2:c.1524G>A, NM_024344.1:c.1524G>A, NM_173087.1:c.1380G>A, NM_173088.1:c.-749G>A, NM_173089.1:c.-3227G>A, NM_173090.1:c.-3245G>A, NM_212464.2:c.1263G>A, NM_212465.2:c.1263G>A, NM_212467.2:c.*1217G>A, NR_027911.1:n.1755G>A, NR_027912.1:n.2033G>A, XM_005254703.1:c.1524G>A, XM_005254704.1:c.1263G>A, XM_005254705.1:c.1263G>A, XM_005254706.1:c.1119G>ALikely pathogenic05/25/2017 
223CAPN3Ex11NM_000070.2:c.1524+2T>CLRG_849t1:c.1524+2T>C, NM_000070.2:c.1524+2T>C, NM_024344.1:c.1524+2T>C, NM_173087.1:c.1380+2T>C, NM_173088.1:c.-747T>C, NM_173089.1:c.-3225T>C, NM_173090.1:c.-3243T>C, NM_212464.2:c.1263+2T>C, NM_212465.2:c.1263+2T>C, NM_212467.2:c.*1217+2T>C, NR_027911.1:n.1755+2T>C, NR_027912.1:n.2033+2T>C, XM_005254703.1:c.1524+2T>C, XM_005254704.1:c.1263+2T>C, XM_005254705.1:c.1263+2T>C, XM_005254706.1:c.1119+2T>CPathogenic10/05/2016 
224CAPN3Ex11NM_000070.2:c.1524+3G>ALRG_849t1:c.1524+3G>A, NM_000070.2:c.1524+3G>A, NM_024344.1:c.1524+3G>A, NM_173087.1:c.1380+3G>A, NM_173088.1:c.-746G>A, NM_173089.1:c.-3224G>A, NM_173090.1:c.-3242G>A, NM_212464.2:c.1263+3G>A, NM_212465.2:c.1263+3G>A, NM_212467.2:c.*1217+3G>A, NR_027911.1:n.1755+3G>A, NR_027912.1:n.2033+3G>A, XM_005254703.1:c.1524+3G>A, XM_005254704.1:c.1263+3G>A, XM_005254705.1:c.1263+3G>A, XM_005254706.1:c.1119+3G>AVOUS03/16/2016
225CAPN3Ex12NM_000070.2:c.1536+9G>ALRG_849t1:c.1536+9G>A, NM_000070.2:c.1536+9G>A, NM_024344.1:c.1536+9G>A, NM_173087.1:c.1392+9G>A, NM_173088.1:c.-415G>A, NM_173089.1:c.-2893G>A, NM_173090.1:c.-2911G>A, NM_212464.2:c.*3G>A, NM_212465.2:c.1275+9G>A, NM_212467.2:c.*1229+9G>A, NR_027911.1:n.1776G>A, NR_027912.1:n.2045+9G>A, XM_005254703.1:c.1536+9G>A, XM_005254704.1:c.1275+9G>A, XM_005254705.1:c.1275+9G>A, XM_005254706.1:c.1131+9G>AVOUS10/27/2016
226CAPN3Ex13NM_000070.2:c.1537-48T>CBenign08/24/2012 
227CAPN3Ex13NM_000070.2:c.1537-33G>AVOUS**
228CAPN3Ex13NM_000070.2:c.1542C>Tp.His514= | p.H514=LRG_849t1:c.1542C>T, NM_000070.2:c.1542C>T, NM_024344.1:c.1542C>T, NM_173087.1:c.1398C>T, NM_173088.1:c.6C>T, NM_173089.1:c.-2238C>T, NM_173090.1:c.-2256C>T, NM_212464.2:c.*658C>T, NM_212465.2:c.1281C>T, NM_212467.2:c.*1235C>T, NR_027911.1:n.2431C>T, NR_027912.1:n.2051C>T, XM_005254703.1:c.1542C>T, XM_005254704.1:c.1281C>T, XM_005254705.1:c.1281C>T, XM_005254706.1:c.1137C>TVOUS08/29/2016
229CAPN3Ex13NM_000070.2:c.1543G>Ap.Gly515Arg | p.G515RNM_000070.2:c.1543G>A, NM_024344.1:c.1543G>A, NM_173087.1:c.1399G>A, NM_173088.1:c.7G>A, NM_173089.1:c.-2237G>A, NM_173090.1:c.-2255G>A, NM_212464.2:c.*659G>A, NM_212465.2:c.1282G>A, NM_212467.2:c.*1236G>A, NR_027911.1:n.2432G>A, NR_027912.1:n.2052G>A, XM_005254703.1:c.1543G>A, XM_005254704.1:c.1282G>A, XM_005254705.1:c.1282G>A, XM_005254706.1:c.1138G>AVOUS08/10/2018
230CAPN3Ex13NM_000070.2:c.1557C>Tp.His519= | p.H519=LRG_849t1:c.1557C>T, NM_000070.2:c.1557C>T, NM_024344.1:c.1557C>T, NM_173087.1:c.1413C>T, NM_173088.1:c.21C>T, NM_173089.1:c.-2223C>T, NM_173090.1:c.-2241C>T, NM_212464.2:c.*673C>T, NM_212465.2:c.1296C>T, NM_212467.2:c.*1250C>T, NR_027911.1:n.2446C>T, NR_027912.1:n.2066C>T, XM_005254703.1:c.1557C>T, XM_005254704.1:c.1296C>T, XM_005254705.1:c.1296C>T, XM_005254706.1:c.1152C>TVOUS04/20/2017
231CAPN3Ex13NM_000070.2:c.1566G>Ap.Lys522= | p.K522=NM_000070.2:c.1566G>A, NM_024344.1:c.1566G>A, NM_173087.1:c.1422G>A, NM_173088.1:c.30G>A, NM_173089.1:c.-2214G>A, NM_173090.1:c.-2232G>A, NM_212464.2:c.*682G>A, NM_212465.2:c.1305G>A, NM_212467.2:c.*1259G>A, NR_027911.1:n.2455G>A, NR_027912.1:n.2075G>A, XM_005254703.1:c.1566G>A, XM_005254704.1:c.1305G>A, XM_005254705.1:c.1305G>A, XM_005254706.1:c.1161G>AVOUS01/13/2017
232CAPN3Ex13NM_000070.2:c.1584C>Tp.Asn528= | p.N528=NM_000070.2:c.1584C>T, NM_024344.1:c.1584C>T, NM_173087.1:c.1440C>T, NM_173088.1:c.48C>T, NM_173089.1:c.-2196C>T, NM_173090.1:c.-2214C>T, NM_212464.2:c.*700C>T, NM_212465.2:c.1323C>T, NM_212467.2:c.*1277C>T, NR_027911.1:n.2473C>T, NR_027912.1:n.2093C>T, XM_005254703.1:c.1584C>T, XM_005254704.1:c.1323C>T, XM_005254705.1:c.1323C>T, XM_005254706.1:c.1179C>TVOUS02/11/2018
233CAPN3Ex13NM_000070.2:c.1585G>Ap.Ala529Thr | p.A529TNM_000070.2:c.1585G>A, NM_024344.1:c.1585G>A, NM_173087.1:c.1441G>A, NM_173088.1:c.49G>A, NM_173089.1:c.-2195G>A, NM_173090.1:c.-2213G>A, NM_212464.2:c.*701G>A, NM_212465.2:c.1324G>A, NM_212467.2:c.*1278G>A, NR_027911.1:n.2474G>A, NR_027912.1:n.2094G>A, XM_005254703.1:c.1585G>A, XM_005254704.1:c.1324G>A, XM_005254705.1:c.1324G>A, XM_005254706.1:c.1180G>AVOUS12/03/2015
234CAPN3Ex13NM_000070.2:c.1588T>Cp.Ser530Pro | p.S530PNM_000070.2:c.1588T>C, NM_024344.1:c.1588T>C, NM_173087.1:c.1444T>C, NM_173088.1:c.52T>C, NM_173089.1:c.-2192T>C, NM_173090.1:c.-2210T>C, NM_212464.2:c.*704T>C, NM_212465.2:c.1327T>C, NM_212467.2:c.*1281T>C, NR_027911.1:n.2477T>C, NR_027912.1:n.2097T>C, XM_005254703.1:c.1588T>C, XM_005254704.1:c.1327T>C, XM_005254705.1:c.1327T>C, XM_005254706.1:c.1183T>CVOUS08/20/2015
235CAPN3Ex13NM_000070.2:c.1611C>Ap.Tyr537* | p.Y537XNM_000070.2:c.1611C>A, NM_024344.1:c.1611C>A, NM_173087.1:c.1467C>A, NM_173088.1:c.75C>A, NM_173089.1:c.-2169C>A, NM_173090.1:c.-2187C>A, NM_212464.2:c.*727C>A, NM_212465.2:c.1350C>A, NM_212467.2:c.*1304C>A, NR_027911.1:n.2500C>A, NR_027912.1:n.2120C>A, XM_005254703.1:c.1611C>A, XM_005254704.1:c.1350C>A, XM_005254705.1:c.1350C>A, XM_005254706.1:c.1206C>APathogenic08/11/2015 
236CAPN3Ex13NM_000070.2:c.1621C>Gp.Arg541Gly | p.R541GNM_000070.2:c.1621C>G, NM_024344.1:c.1621C>G, NM_173087.1:c.1477C>G, NM_173088.1:c.85C>G, NM_173089.1:c.-2159C>G, NM_173090.1:c.-2177C>G, NM_212464.2:c.*737C>G, NM_212465.2:c.1360C>G, NM_212467.2:c.*1314C>G, NR_027911.1:n.2510C>G, NR_027912.1:n.2130C>G, XM_005254703.1:c.1621C>G, XM_005254704.1:c.1360C>G, XM_005254705.1:c.1360C>G, XM_005254706.1:c.1216C>GVOUS10/06/2015
237CAPN3Ex13NM_000070.2:c.1621C>Tp.Arg541Trp | p.R541WLRG_849t1:c.1621C>T, NM_000070.2:c.1621C>T, NM_024344.1:c.1621C>T, NM_173087.1:c.1477C>T, NM_173088.1:c.85C>T, NM_173089.1:c.-2159C>T, NM_173090.1:c.-2177C>T, NM_212464.2:c.*737C>T, NM_212465.2:c.1360C>T, NM_212467.2:c.*1314C>T, NR_027911.1:n.2510C>T, NR_027912.1:n.2130C>T, XM_005254703.1:c.1621C>T, XM_005254704.1:c.1360C>T, XM_005254705.1:c.1360C>T, XM_005254706.1:c.1216C>TPathogenic08/31/2018 
238CAPN3Ex13NM_000070.2:c.1622G>Ap.Arg541Gln | p.R541QNM_000070.2:c.1622G>A, NM_024344.1:c.1622G>A, NM_173087.1:c.1478G>A, NM_173088.1:c.86G>A, NM_173089.1:c.-2158G>A, NM_173090.1:c.-2176G>A, NM_212464.2:c.*738G>A, NM_212465.2:c.1361G>A, NM_212467.2:c.*1315G>A, NR_027911.1:n.2511G>A, NR_027912.1:n.2131G>ALikely pathogenic10/25/2018 
239CAPN3Ex13NM_000070.2:c.1636C>Tp.Arg546Cys | p.R546CNM_000070.2:c.1636C>T, NM_024344.1:c.1636C>T, NM_173087.1:c.1492C>T, NM_173088.1:c.100C>T, NM_173089.1:c.-2144C>T, NM_173090.1:c.-2162C>T, NM_212464.2:c.*752C>T, NM_212465.2:c.1375C>T, NM_212467.2:c.*1329C>T, NR_027911.1:n.2525C>T, NR_027912.1:n.2145C>T, XM_005254703.1:c.1636C>T, XM_005254704.1:c.1375C>T, XM_005254705.1:c.1375C>T, XM_005254706.1:c.1231C>TLikely pathogenic06/13/2017 
240CAPN3Ex13NM_000070.2:c.1637G>Ap.Arg546His | p.R546HNM_000070.2:c.1637G>A, NM_024344.1:c.1637G>A, NM_173087.1:c.1493G>A, NM_173088.1:c.101G>A, NM_173089.1:c.-2143G>A, NM_173090.1:c.-2161G>A, NM_212464.2:c.*753G>A, NM_212465.2:c.1376G>A, NM_212467.2:c.*1330G>A, NR_027911.1:n.2526G>A, NR_027912.1:n.2146G>A, XM_005254703.1:c.1637G>A, XM_005254704.1:c.1376G>A, XM_005254705.1:c.1376G>A, XM_005254706.1:c.1232G>AVOUS12/04/2015
241CAPN3Ex13NM_000070.2:c.1643G>Ap.Arg548His | p.R548HLRG_849t1:c.1643G>A, NM_000070.2:c.1643G>A, NM_024344.1:c.1643G>A, NM_173087.1:c.1499G>A, NM_173088.1:c.107G>A, NM_173089.1:c.-2137G>A, NM_173090.1:c.-2155G>A, NM_212464.2:c.*759G>A, NM_212465.2:c.1382G>A, NM_212467.2:c.*1336G>A, NR_027911.1:n.2532G>A, NR_027912.1:n.2152G>A, XM_005254703.1:c.1643G>A, XM_005254704.1:c.1382G>A, XM_005254705.1:c.1382G>A, XM_005254706.1:c.1238G>AVOUS07/27/2016
242CAPN3Ex13NM_000070.2:c.1650T>Cp.Pro550= | p.P550=LRG_849t1:c.1650T>C, NM_000070.2:c.1650T>C, NM_024344.1:c.1650T>C, NM_173087.1:c.1506T>C, NM_173088.1:c.114T>C, NM_173089.1:c.-2130T>C, NM_173090.1:c.-2148T>C, NM_212464.2:c.*766T>C, NM_212465.2:c.1389T>C, NM_212467.2:c.*1343T>C, NR_027911.1:n.2539T>C, NR_027912.1:n.2159T>C, XM_005254703.1:c.1650T>C, XM_005254704.1:c.1389T>C, XM_005254705.1:c.1389T>C, XM_005254706.1:c.1245T>CVOUS12/06/2017
243CAPN3Ex13NM_000070.2:c.1656C>Tp.Ser552= | p.S552=LRG_849t1:c.1656C>T, NM_000070.2:c.1656C>T, NM_024344.1:c.1656C>T, NM_173087.1:c.1512C>T, NM_173088.1:c.120C>T, NM_173089.1:c.-2124C>T, NM_173090.1:c.-2142C>T, NM_212464.2:c.*772C>T, NM_212465.2:c.1395C>T, NM_212467.2:c.*1349C>T, NR_027911.1:n.2545C>T, NR_027912.1:n.2165C>T, XM_005254703.1:c.1656C>T, XM_005254704.1:c.1395C>T, XM_005254705.1:c.1395C>T, XM_005254706.1:c.1251C>TVOUS07/18/2016
244CAPN3Ex13NM_000070.2:c.1662C>Tp.Tyr554= | p.Y554=LRG_849t1:c.1662C>T, NM_000070.2:c.1662C>T, NM_024344.1:c.1662C>T, NM_173087.1:c.1518C>T, NM_173088.1:c.126C>T, NM_173089.1:c.-2118C>T, NM_173090.1:c.-2136C>T, NM_212464.2:c.*778C>T, NM_212465.2:c.1401C>T, NM_212467.2:c.*1355C>T, NR_027911.1:n.2551C>T, NR_027912.1:n.2171C>T, XM_005254703.1:c.1662C>T, XM_005254704.1:c.1401C>T, XM_005254705.1:c.1401C>T, XM_005254706.1:c.1257C>TVOUS11/01/2018
245CAPN3Ex13NM_000070.2:c.1662C>Gp.Tyr554* | p.Y554XLRG_849t1:c.1662C>G, NM_000070.2:c.1662C>G, NM_024344.1:c.1662C>G, NM_173087.1:c.1518C>G, NM_173088.1:c.126C>G, NM_173089.1:c.-2118C>G, NM_173090.1:c.-2136C>G, NM_212464.2:c.*778C>G, NM_212465.2:c.1401C>G, NM_212467.2:c.*1355C>G, NR_027911.1:n.2551C>G, NR_027912.1:n.2171C>G, XM_005254703.1:c.1662C>G, XM_005254704.1:c.1401C>G, XM_005254705.1:c.1401C>G, XM_005254706.1:c.1257C>GPathogenic08/22/2016 
246CAPN3Ex13NM_000070.2:c.1663G>Ap.Val555Ile | p.V555ILRG_849t1:c.1663G>A, NM_000070.2:c.1663G>A, NM_024344.1:c.1663G>A, NM_173087.1:c.1519G>A, NM_173088.1:c.127G>A, NM_173089.1:c.-2117G>A, NM_173090.1:c.-2135G>A, NM_212464.2:c.*779G>A, NM_212465.2:c.1402G>A, NM_212467.2:c.*1356G>A, NR_027911.1:n.2552G>A, NR_027912.1:n.2172G>A, XM_005254703.1:c.1663G>A, XM_005254704.1:c.1402G>A, XM_005254705.1:c.1402G>A, XM_005254706.1:c.1258G>AVOUS08/02/2018
247CAPN3Ex13NM_000070.2:c.1668C>Tp.Ile556= | p.I556=NM_000070.2:c.1668C>T, NM_024344.1:c.1668C>T, NM_173087.1:c.1524C>T, NM_173088.1:c.132C>T, NM_173089.1:c.-2112C>T, NM_173090.1:c.-2130C>T, NM_212464.2:c.*784C>T, NM_212465.2:c.1407C>T, NM_212467.2:c.*1361C>T, NR_027911.1:n.2557C>T, NR_027912.1:n.2177C>T, XM_005254703.1:c.1668C>T, XM_005254704.1:c.1407C>T, XM_005254705.1:c.1407C>T, XM_005254706.1:c.1263C>TVOUS01/30/2019
248CAPN3Ex13NM_000070.2:c.1673C>Tp.Pro558Leu | p.P558LNM_000070.2:c.1673C>T, NM_024344.1:c.1673C>T, NM_173087.1:c.1529C>T, NM_173088.1:c.137C>T, NM_173089.1:c.-2107C>T, NM_173090.1:c.-2125C>T, NM_212464.2:c.*789C>T, NM_212465.2:c.1412C>T, NM_212467.2:c.*1366C>T, NR_027911.1:n.2562C>T, NR_027912.1:n.2182C>T, XM_005254703.1:c.1673C>T, XM_005254704.1:c.1412C>T, XM_005254705.1:c.1412C>T, XM_005254706.1:c.1268C>TVOUS02/09/2016
249CAPN3Ex13NM_000070.2:c.1678A>Gp.Thr560Ala | p.T560ANM_000070.2:c.1678A>G, NM_024344.1:c.1678A>G, NM_173087.1:c.1534A>G, NM_173088.1:c.142A>G, NM_173089.1:c.-2102A>G, NM_173090.1:c.-2120A>G, NM_212464.2:c.*794A>G, NM_212465.2:c.1417A>G, NM_212467.2:c.*1371A>G, NR_027911.1:n.2567A>G, NR_027912.1:n.2187A>G, XM_005254703.1:c.1678A>G, XM_005254704.1:c.1417A>G, XM_005254705.1:c.1417A>G, XM_005254706.1:c.1273A>GVOUS08/14/2015
250CAPN3Ex13NM_000070.2:c.1686G>Ap.Glu562= | p.E562=LRG_849t1:c.1686G>A, NM_000070.2:c.1686G>A, NM_024344.1:c.1686G>A, NM_173087.1:c.1542G>A, NM_173088.1:c.150G>A, NM_173089.1:c.-2094G>A, NM_173090.1:c.-2112G>A, NM_212464.2:c.*802G>A, NM_212465.2:c.1425G>A, NM_212467.2:c.*1379G>A, NR_027911.1:n.2575G>A, NR_027912.1:n.2195G>A, XM_005254703.1:c.1686G>A, XM_005254704.1:c.1425G>A, XM_005254705.1:c.1425G>A, XM_005254706.1:c.1281G>AVOUS05/04/2016
251CAPN3Ex13NM_000070.2:c.1698G>Tp.Glu566Asp | p.E566DLRG_849t1:c.1698G>T, NM_000070.2:c.1698G>T, NM_024344.1:c.1698G>T, NM_173087.1:c.1554G>T, NM_173088.1:c.162G>T, NM_173089.1:c.-2082G>T, NM_173090.1:c.-2100G>T, NM_212464.2:c.*814G>T, NM_212465.2:c.1437G>T, NM_212467.2:c.*1391G>T, NR_027911.1:n.2587G>T, NR_027912.1:n.2207G>T, XM_005254703.1:c.1698G>T, XM_005254704.1:c.1437G>T, XM_005254705.1:c.1437G>T, XM_005254706.1:c.1293G>TVOUS12/07/2018
252CAPN3Ex13NM_000070.2:c.1699G>Tp.Gly567Trp | p.G567WNM_000070.2:c.1699G>T, NM_024344.1:c.1699G>T, NM_173087.1:c.1555G>T, NM_173088.1:c.163G>T, NM_173089.1:c.-2081G>T, NM_173090.1:c.-2099G>T, NM_212464.2:c.*815G>T, NM_212465.2:c.1438G>T, NM_212467.2:c.*1392G>T, NR_027911.1:n.2588G>T, NR_027912.1:n.2208G>TPathogenic03/06/2018 
253CAPN3Ex13NM_000070.2:c.1702G>Cp.Glu568Gln | p.E568QLRG_849t1:c.1702G>C, NM_000070.2:c.1702G>C, NM_024344.1:c.1702G>C, NM_173087.1:c.1558G>C, NM_173088.1:c.166G>C, NM_173089.1:c.-2078G>C, NM_173090.1:c.-2096G>C, NM_212464.2:c.*818G>C, NM_212465.2:c.1441G>C, NM_212467.2:c.*1395G>C, NR_027911.1:n.2591G>C, NR_027912.1:n.2211G>C, XM_005254703.1:c.1702G>C, XM_005254704.1:c.1441G>C, XM_005254705.1:c.1441G>C, XM_005254706.1:c.1297G>CVOUS03/08/2017
254CAPN3Ex13NM_000070.2:c.1706T>Cp.Phe569Ser | p.F569SLRG_849t1:c.1706T>C, NM_000070.2:c.1706T>C, NM_024344.1:c.1706T>C, NM_173087.1:c.1562T>C, NM_173088.1:c.170T>C, NM_173089.1:c.-2074T>C, NM_173090.1:c.-2092T>C, NM_212464.2:c.*822T>C, NM_212465.2:c.1445T>C, NM_212467.2:c.*1399T>C, NR_027911.1:n.2595T>C, NR_027912.1:n.2215T>C, XM_005254703.1:c.1706T>C, XM_005254704.1:c.1445T>C, XM_005254705.1:c.1445T>C, XM_005254706.1:c.1301T>CVOUS11/14/2019
255CAPN3Ex13NM_000070.2:c.1708_1719delATCCTCCGGGTCNM_000070.2:c.1708_1719delATCCTCCGGGTC, NM_024344.1:c.1708_1719delATCCTCCGGGTC, NM_173087.1:c.1564_1575delATCCTCCGGGTC, NM_173088.1:c.172_183delATCCTCCGGGTC, NM_173089.1:c.-2072_-2061delATCCTCCGGGTC, NM_173090.1:c.-2090_-2079delATCCTCCGGGTC, NM_212464.2:c.*824_*835delATCCTCCGGGTC, NM_212465.2:c.1447_1458delATCCTCCGGGTC, NM_212467.2:c.*1401_*1412delATCCTCCGGGTC, NR_027911.1:n.2597_2608delATCCTCCGGGTC, NR_027912.1:n.2217_2228delATCCTCCGGGTC, XM_005254703.1:c.1708_1719delATCCTCCGGGTC, XM_005254704.1:c.1447_1458delATCCTCCGGGTC, XM_005254705.1:c.1447_1458delATCCTCCGGGTC, XM_005254706.1:c.1303_1314delATCCTCCGGGTCVOUS01/08/2016
256CAPN3Ex13NM_000070.2:c.1714C>Gp.Arg572Gly | p.R572GLRG_849t1:c.1714C>G, NM_000070.2:c.1714C>G, NM_024344.1:c.1714C>G, NM_173087.1:c.1570C>G, NM_173088.1:c.178C>G, NM_173089.1:c.-2066C>G, NM_173090.1:c.-2084C>G, NM_212464.2:c.*830C>G, NM_212465.2:c.1453C>G, NM_212467.2:c.*1407C>G, NR_027911.1:n.2603C>G, NR_027912.1:n.2223C>G, XM_005254703.1:c.1714C>G, XM_005254704.1:c.1453C>G, XM_005254705.1:c.1453C>G, XM_005254706.1:c.1309C>GVOUS11/01/2016
257CAPN3Ex13NM_000070.2:c.1714C>Tp.Arg572Trp | p.R572WNM_000070.2:c.1714C>T, NM_024344.1:c.1714C>T, NM_173087.1:c.1570C>T, NM_173088.1:c.178C>T, NM_173089.1:c.-2066C>T, NM_173090.1:c.-2084C>T, NM_212464.2:c.*830C>T, NM_212465.2:c.1453C>T, NM_212467.2:c.*1407C>T, NR_027911.1:n.2603C>T, NR_027912.1:n.2223C>T, XM_005254703.1:c.1714C>T, XM_005254704.1:c.1453C>T, XM_005254705.1:c.1453C>T, XM_005254706.1:c.1309C>TPathogenic10/11/2016 
258CAPN3Ex13NM_000070.2:c.1715G>Ap.Arg572Gln | p.R572QLRG_849t1:c.1715G>A, NM_000070.2:c.1715G>A, NM_024344.1:c.1715G>A, NM_173087.1:c.1571G>A, NM_173088.1:c.179G>A, NM_173089.1:c.-2065G>A, NM_173090.1:c.-2083G>A, NM_212464.2:c.*831G>A, NM_212465.2:c.1454G>A, NM_212467.2:c.*1408G>A, NR_027911.1:n.2604G>A, NR_027912.1:n.2224G>A, XM_005254703.1:c.1715G>A, XM_005254704.1:c.1454G>A, XM_005254705.1:c.1454G>A, XM_005254706.1:c.1310G>APathogenic09/14/2016 
259CAPN3Ex13NM_000070.2:c.1715G>Cp.Arg572Pro | p.R572PLRG_849t1:c.1715G>C, NM_000070.2:c.1715G>C, NM_024344.1:c.1715G>C, NM_173087.1:c.1571G>C, NM_173088.1:c.179G>C, NM_173089.1:c.-2065G>C, NM_173090.1:c.-2083G>C, NM_212464.2:c.*831G>C, NM_212465.2:c.1454G>C, NM_212467.2:c.*1408G>C, NR_027911.1:n.2604G>C, NR_027912.1:n.2224G>C, XM_005254703.1:c.1715G>C, XM_005254704.1:c.1454G>C, XM_005254705.1:c.1454G>C, XM_005254706.1:c.1310G>CVOUS03/29/2016
260CAPN3Ex13NM_000070.2:c.1743_1744delTGp.Glu582Glyfs*3 | p.E582GfsX3NM_000070.2:c.1743_1744delTG, NM_024344.1:c.1743_1744delTG, NM_173087.1:c.1599_1600delTG, NM_173088.1:c.207_208delTG, NM_173089.1:c.-2037_-2036delTG, NM_173090.1:c.-2055_-2054delTG, NM_212464.2:c.*859_*860delTG, NM_212465.2:c.1482_1483delTG, NM_212467.2:c.*1436_*1437delTG, NR_027911.1:n.2632_2633delTG, NR_027912.1:n.2252_2253delTG, XM_005254703.1:c.1743_1744delTG, XM_005254704.1:c.1482_1483delTG, XM_005254705.1:c.1482_1483delTG, XM_005254706.1:c.1338_1339delTGPathogenic06/29/2018 
261CAPN3Ex13NM_000070.2:c.1745+4_1745+7delAGTGNM_000070.2:c.1745+4_1745+7delAGTG, NM_024344.1:c.1745+4_1745+7delAGTG, NM_173087.1:c.1601+4_1601+7delAGTG, NM_173088.1:c.209+4_209+7delAGTG, NM_173089.1:c.-2031_-2028delAGTG, NM_173090.1:c.-2049_-2046delAGTG, NM_212464.2:c.*861+4_*861+7delAGTG, NM_212465.2:c.1484+4_1484+7delAGTG, NM_212467.2:c.*1438+4_*1438+7delAGTG, NR_027911.1:n.2634+4_2634+7delAGTG, NR_027912.1:n.2254+4_2254+7delAGTG, XM_005254703.1:c.1745+4_1745+7delAGTG, XM_005254704.1:c.1484+4_1484+7delAGTG, XM_005254705.1:c.1484+4_1484+7delAGTG, XM_005254706.1:c.1340+4_1340+7delAGTGVOUS05/08/2015
262CAPN3Ex13NM_000070.2:c.1745+5G>CNM_000070.2:c.1745+5G>C, NM_024344.1:c.1745+5G>C, NM_173087.1:c.1601+5G>C, NM_173088.1:c.209+5G>C, NM_173089.1:c.-2030G>C, NM_173090.1:c.-2048G>C, NM_212464.2:c.*861+5G>C, NM_212465.2:c.1484+5G>C, NM_212467.2:c.*1438+5G>C, NR_027911.1:n.2634+5G>C, NR_027912.1:n.2254+5G>C, XM_005254703.1:c.1745+5G>C, XM_005254704.1:c.1484+5G>C, XM_005254705.1:c.1484+5G>C, XM_005254706.1:c.1340+5G>CLikely pathogenic12/11/2015 
263CAPN3Ex14NM_000070.2:c.1746-20C>GNM_000070.2:c.1746-20C>G, NM_024344.1:c.1746-20C>G, NM_173087.1:c.1602-20C>G, NM_173088.1:c.210-20C>G, NM_173089.1:c.-1316C>G, NM_173090.1:c.-1334C>G, NM_212464.2:c.*862-20C>G, NM_212465.2:c.1485-20C>G, NM_212467.2:c.*1439-20C>G, NR_027911.1:n.2635-20C>G, NR_027912.1:n.2255-20C>GLikely benign11/23/2016 
264CAPN3Ex14NM_000070.2:c.1746-7C>GNM_000070.2:c.1746-7C>G, NM_024344.1:c.1746-7C>G, NM_173087.1:c.1602-7C>G, NM_173088.1:c.210-7C>G, NM_173089.1:c.-1303C>G, NM_173090.1:c.-1321C>G, NM_212464.2:c.*862-7C>G, NM_212465.2:c.1485-7C>G, NM_212467.2:c.*1439-7C>G, NR_027911.1:n.2635-7C>G, NR_027912.1:n.2255-7C>G, XM_005254703.1:c.1746-7C>G, XM_005254704.1:c.1485-7C>G, XM_005254705.1:c.1485-7C>G, XM_005254706.1:c.1341-7C>GVOUS02/28/2017
265CAPN3Ex14NM_000070.2:c.1763T>Cp.Ile588Thr | p.I588TLRG_849t1:c.1763T>C, NM_000070.2:c.1763T>C, NM_024344.1:c.1763T>C, NM_173087.1:c.1619T>C, NM_173088.1:c.227T>C, NM_173089.1:c.-1279T>C, NM_173090.1:c.-1297T>C, NM_212464.2:c.*879T>C, NM_212465.2:c.1502T>C, NM_212467.2:c.*1456T>C, NR_027911.1:n.2652T>C, NR_027912.1:n.2272T>C, XM_005254703.1:c.1763T>C, XM_005254704.1:c.1502T>C, XM_005254705.1:c.1502T>C, XM_005254706.1:c.1358T>CVOUS10/31/2016
266CAPN3Ex14NM_000070.2:c.1771delGp.Asp591Ilefs*4 | p.D591IfsX4LRG_849t1:c.1771delG, NM_000070.2:c.1771delG, NM_024344.1:c.1771delG, NM_173087.1:c.1627delG, NM_173088.1:c.235delG, NM_173089.1:c.-1271delG, NM_173090.1:c.-1289delG, NM_212464.2:c.*887delG, NM_212465.2:c.1510delG, NM_212467.2:c.*1464delG, NR_027911.1:n.2660delG, NR_027912.1:n.2280delG, XM_005254703.1:c.1771delG, XM_005254704.1:c.1510delG, XM_005254705.1:c.1510delG, XM_005254706.1:c.1366delGPathogenic03/23/2018 
267CAPN3Ex14NM_000070.2:c.1774C>Tp.Arg592Trp | p.R592WLRG_849t1:c.1774C>T, NM_000070.2:c.1774C>T, NM_024344.1:c.1774C>T, NM_173087.1:c.1630C>T, NM_173088.1:c.238C>T, NM_173089.1:c.-1268C>T, NM_173090.1:c.-1286C>T, NM_212464.2:c.*890C>T, NM_212465.2:c.1513C>T, NM_212467.2:c.*1467C>T, NR_027911.1:n.2663C>T, NR_027912.1:n.2283C>T, XM_005254703.1:c.1774C>T, XM_005254704.1:c.1513C>T, XM_005254705.1:c.1513C>T, XM_005254706.1:c.1369C>TVOUS05/23/2017
268CAPN3Ex14NM_000070.2:c.1782+5G>ANM_000070.2:c.1782+5G>A, NM_024344.1:c.1782+5G>A, NM_173087.1:c.1638+5G>A, NM_173088.1:c.246+5G>A, NM_173089.1:c.-1255G>A, NM_173090.1:c.-1273G>A, NM_212464.2:c.*898+5G>A, NM_212465.2:c.1521+5G>A, NM_212467.2:c.*1475+5G>A, NR_027911.1:n.2671+5G>A, NR_027912.1:n.2291+5G>A, XM_005254703.1:c.1782+5G>A, XM_005254704.1:c.1521+5G>A, XM_005254705.1:c.1521+5G>A, XM_005254706.1:c.1377+5G>AVOUS12/28/2016
269CAPN3Ex15NM_000070.2:c.1783-9C>TLRG_849t1:c.1783-9C>T, NM_000070.2:c.1783-9C>T, NM_024344.1:c.1782+2140C>T, NM_173087.1:c.1638+2140C>T, NM_173088.1:c.247-9C>T, NM_173089.1:c.-82+962C>T, NM_173090.1:c.-99-9C>T, NM_212464.2:c.*898+2140C>T, NM_212465.2:c.1521+2140C>T, NM_212467.2:c.*1475+2140C>T, NR_027911.1:n.2671+2140C>T, NR_027912.1:n.2291+2140C>T, XM_005254703.1:c.1783-9C>T, XM_005254704.1:c.1522-9C>T, XM_005254705.1:c.1522-9C>T, XM_005254706.1:c.1378-9C>TVOUS02/27/2017
270CAPN3Ex15NM_000070.2:c.1783-5T>CLRG_849t1:c.1783-5T>C, NM_000070.2:c.1783-5T>C, NM_024344.1:c.1782+2144T>C, NM_173087.1:c.1638+2144T>C, NM_173088.1:c.247-5T>C, NM_173089.1:c.-82+966T>C, NM_173090.1:c.-99-5T>C, NM_212464.2:c.*898+2144T>C, NM_212465.2:c.1521+2144T>C, NM_212467.2:c.*1475+2144T>C, NR_027911.1:n.2671+2144T>C, NR_027912.1:n.2291+2144T>C, XM_005254703.1:c.1783-5T>C, XM_005254704.1:c.1522-5T>C, XM_005254705.1:c.1522-5T>C, XM_005254706.1:c.1378-5T>CVOUS05/09/2017
271CAPN3Ex15NM_000070.2:c.1795A>Gp.Thr599Ala | p.T599ALRG_849t1:c.1795A>G, NM_000070.2:c.1795A>G, NM_024344.1:c.1782+2161A>G, NM_173087.1:c.1638+2161A>G, NM_173088.1:c.259A>G, NM_173089.1:c.-82+983A>G, NM_173090.1:c.-87A>G, NM_212464.2:c.*898+2161A>G, NM_212465.2:c.1521+2161A>G, NM_212467.2:c.*1475+2161A>G, NR_027911.1:n.2671+2161A>G, NR_027912.1:n.2291+2161A>G, XM_005254703.1:c.1795A>G, XM_005254704.1:c.1534A>G, XM_005254705.1:c.1534A>G, XM_005254706.1:c.1390A>GVOUS06/13/2017
272CAPN3Ex15NM_000070.2:c.1795dupALRG_849t1:c.1795_1796insA, NM_000070.2:c.1795_1796insA, NM_024344.1:c.1782+2161_1782+2162insA, NM_173087.1:c.1638+2161_1638+2162insA, NM_173088.1:c.259_260insA, NM_173089.1:c.-82+983_-82+984insA, NM_173090.1:c.-87_-86insA, NM_212464.2:c.*898+2161_*898+2162insA, NM_212465.2:c.1521+2161_1521+2162insA, NM_212467.2:c.*1475+2161_*1475+2162insA, NR_027911.1:n.2671+2161_2671+2162insA, NR_027912.1:n.2291+2161_2291+2162insA, XM_005254703.1:c.1795_1796insA, XM_005254704.1:c.1534_1535insA, XM_005254705.1:c.1534_1535insA, XM_005254706.1:c.1390_1391insAPathogenic11/29/2016 
273CAPN3Ex15NM_000070.2:c.1800+21C>TVOUS**
274CAPN3Ex16NM_000070.2:c.1801-1G>ALRG_849t1:c.1801-1G>A, NM_000070.2:c.1801-1G>A, NM_022473.1:c.*9094C>T, NM_024344.1:c.1783-1G>A, NM_173087.1:c.1639-1093G>A, NM_173088.1:c.265-1G>A, NM_173089.1:c.-81-1093G>A, NM_173090.1:c.-81-1093G>A, NM_212464.2:c.*899-1G>A, NM_212465.2:c.1522-1G>A, NM_212467.2:c.*1476-1G>A, NR_027911.1:n.2672-1G>A, NR_027912.1:n.2292-1G>A, XM_005254591.1:c.*9094C>T, XM_005254592.1:c.*9094C>T, XM_005254593.1:c.*9094C>T, XM_005254594.1:c.*9094C>T, XM_005254703.1:c.1801-1G>A, XM_005254704.1:c.1540-1G>A, XM_005254705.1:c.1540-1G>A, XM_005254706.1:c.1396-1G>APathogenic05/12/2016 
275CAPN3Ex16NM_000070.2:c.1813G>Ap.Val605Ile | p.V605IVOUS**
276CAPN3Ex16NM_000070.2:c.1817C>Tp.Ser606Leu | p.S606LLRG_849t1:c.1817C>T, NM_000070.2:c.1817C>T, NM_022473.1:c.*9077G>A, NM_024344.1:c.1799C>T, NM_173087.1:c.1639-1076C>T, NM_173088.1:c.281C>T, NM_173089.1:c.-81-1076C>T, NM_173090.1:c.-81-1076C>T, NM_212464.2:c.*915C>T, NM_212465.2:c.1538C>T, NM_212467.2:c.*1492C>T, NR_027911.1:n.2688C>T, NR_027912.1:n.2308C>T, XM_005254591.1:c.*9077G>A, XM_005254592.1:c.*9077G>A, XM_005254593.1:c.*9077G>A, XM_005254594.1:c.*9077G>A, XM_005254703.1:c.1817C>T, XM_005254704.1:c.1556C>T, XM_005254705.1:c.1556C>T, XM_005254706.1:c.1412C>TLikely pathogenic11/02/2016 
277CAPN3Ex16NM_000070.2:c.1818G>Ap.Ser606= | p.S606=LRG_849t1:c.1818G>A, NM_000070.2:c.1818G>A, NM_022473.1:c.*9076C>T, NM_024344.1:c.1800G>A, NM_173087.1:c.1639-1075G>A, NM_173088.1:c.282G>A, NM_173089.1:c.-81-1075G>A, NM_173090.1:c.-81-1075G>A, NM_212464.2:c.*916G>A, NM_212465.2:c.1539G>A, NM_212467.2:c.*1493G>A, NR_027911.1:n.2689G>A, NR_027912.1:n.2309G>A, XM_005254591.1:c.*9076C>T, XM_005254592.1:c.*9076C>T, XM_005254593.1:c.*9076C>T, XM_005254594.1:c.*9076C>T, XM_005254703.1:c.1818G>A, XM_005254704.1:c.1557G>A, XM_005254705.1:c.1557G>A, XM_005254706.1:c.1413G>AVOUS01/04/2017
278CAPN3Ex16NM_000070.2:c.1830C>Tp.Asn610= | p.N610=LRG_849t1:c.1830C>T, NM_000070.2:c.1830C>T, NM_022473.1:c.*9064G>A, NM_024344.1:c.1812C>T, NM_173087.1:c.1639-1063C>T, NM_173088.1:c.294C>T, NM_173089.1:c.-81-1063C>T, NM_173090.1:c.-81-1063C>T, NM_212464.2:c.*928C>T, NM_212465.2:c.1551C>T, NM_212467.2:c.*1505C>T, NR_027911.1:n.2701C>T, NR_027912.1:n.2321C>T, XM_005254591.1:c.*9064G>A, XM_005254592.1:c.*9064G>A, XM_005254593.1:c.*9064G>A, XM_005254594.1:c.*9064G>A, XM_005254703.1:c.1830C>T, XM_005254704.1:c.1569C>T, XM_005254705.1:c.1569C>T, XM_005254706.1:c.1425C>TVOUS08/24/2018
279CAPN3Ex16NM_000070.2:c.1838delALRG_849t1:c.1838delA, NM_000070.2:c.1838delA, NM_022473.1:c.*9056delT, NM_024344.1:c.1820delA, NM_173087.1:c.1639-1055delA, NM_173088.1:c.302delA, NM_173089.1:c.-81-1055delA, NM_173090.1:c.-81-1055delA, NM_212464.2:c.*936delA, NM_212465.2:c.1559delA, NM_212467.2:c.*1513delA, NR_027911.1:n.2709delA, NR_027912.1:n.2329delA, XM_005254591.1:c.*9056delT, XM_005254592.1:c.*9056delT, XM_005254593.1:c.*9056delT, XM_005254594.1:c.*9056delT, XM_005254703.1:c.1838delA, XM_005254704.1:c.1577delA, XM_005254705.1:c.1577delA, XM_005254706.1:c.1433delAPathogenic** 
280CAPN3Ex16NM_000070.2:c.1841A>Gp.Glu614Gly | p.E614GNM_000070.2:c.1841A>G, NM_022473.1:c.*9053T>C, NM_024344.1:c.1823A>G, NM_173087.1:c.1639-1052A>G, NM_173088.1:c.305A>G, NM_173089.1:c.-81-1052A>G, NM_173090.1:c.-81-1052A>G, NM_212464.2:c.*939A>G, NM_212465.2:c.1562A>G, NM_212467.2:c.*1516A>G, NR_027911.1:n.2712A>G, NR_027912.1:n.2332A>G, XM_005254591.1:c.*9053T>C, XM_005254592.1:c.*9053T>C, XM_005254593.1:c.*9053T>C, XM_005254594.1:c.*9053T>C, XM_005254703.1:c.1841A>G, XM_005254704.1:c.1580A>G, XM_005254705.1:c.1580A>G, XM_005254706.1:c.1436A>GVOUS11/16/2015
281CAPN3Ex16NM_000070.2:c.1842G>Cp.Glu614Asp | p.E614DNM_000070.2:c.1842G>C, NM_022473.1:c.*9052C>G, NM_024344.1:c.1824G>C, NM_173087.1:c.1639-1051G>C, NM_173088.1:c.306G>C, NM_173089.1:c.-81-1051G>C, NM_173090.1:c.-81-1051G>C, NM_212464.2:c.*940G>C, NM_212465.2:c.1563G>C, NM_212467.2:c.*1517G>C, NR_027911.1:n.2713G>C, NR_027912.1:n.2333G>C, XM_005254591.1:c.*9052C>G, XM_005254592.1:c.*9052C>G, XM_005254593.1:c.*9052C>G, XM_005254594.1:c.*9052C>G, XM_005254703.1:c.1842G>C, XM_005254704.1:c.1581G>C, XM_005254705.1:c.1581G>C, XM_005254706.1:c.1437G>CVOUS03/12/2019
282CAPN3Ex16NM_000070.2:c.1855C>Tp.Gln619* | p.Q619XLRG_849t1:c.1855C>T, NM_000070.2:c.1855C>T, NM_022473.1:c.*9039G>A, NM_024344.1:c.1837C>T, NM_173087.1:c.1639-1038C>T, NM_173088.1:c.319C>T, NM_173089.1:c.-81-1038C>T, NM_173090.1:c.-81-1038C>T, NM_212464.2:c.*953C>T, NM_212465.2:c.1576C>T, NM_212467.2:c.*1530C>T, NR_027911.1:n.2726C>T, NR_027912.1:n.2346C>T, XM_005254591.1:c.*9039G>A, XM_005254592.1:c.*9039G>A, XM_005254593.1:c.*9039G>A, XM_005254594.1:c.*9039G>A, XM_005254703.1:c.1855C>T, XM_005254704.1:c.1594C>T, XM_005254705.1:c.1594C>T, XM_005254706.1:c.1450C>TPathogenic12/11/2017 
283CAPN3Ex16NM_000070.2:c.1863dupALRG_849t1:c.1863_1864insA, NM_000070.2:c.1863_1864insA, NM_022473.1:c.*9030_*9031insT, NM_024344.1:c.1845_1846insA, NM_173087.1:c.1639-1030_1639-1029insA, NM_173088.1:c.327_328insA, NM_173089.1:c.-81-1030_-81-1029insA, NM_173090.1:c.-81-1030_-81-1029insA, NM_212464.2:c.*961_*962insA, NM_212465.2:c.1584_1585insA, NM_212467.2:c.*1538_*1539insA, NR_027911.1:n.2734_2735insA, NR_027912.1:n.2354_2355insA, XM_005254591.1:c.*9030_*9031insT, XM_005254592.1:c.*9030_*9031insT, XM_005254593.1:c.*9030_*9031insT, XM_005254594.1:c.*9030_*9031insT, XM_005254703.1:c.1863_1864insA, XM_005254704.1:c.1602_1603insA, XM_005254705.1:c.1602_1603insA, XM_005254706.1:c.1458_1459insAPathogenic09/17/2016 
284CAPN3Ex16NM_000070.2:c.1865_1866delAGp.Glu622Glyfs*9 | p.E622GfsX9LRG_849t1:c.1865_1866delAG, NM_000070.2:c.1865_1866delAG, NM_022473.1:c.*9028_*9029delCT, NM_024344.1:c.1847_1848delAG, NM_173087.1:c.1639-1028_1639-1027delAG, NM_173088.1:c.329_330delAG, NM_173089.1:c.-81-1028_-81-1027delAG, NM_173090.1:c.-81-1028_-81-1027delAG, NM_212464.2:c.*963_*964delAG, NM_212465.2:c.1586_1587delAG, NM_212467.2:c.*1540_*1541delAG, NR_027911.1:n.2736_2737delAG, NR_027912.1:n.2356_2357delAG, XM_005254591.1:c.*9028_*9029delCT, XM_005254592.1:c.*9028_*9029delCT, XM_005254593.1:c.*9028_*9029delCT, XM_005254594.1:c.*9028_*9029delCT, XM_005254703.1:c.1865_1866delAG, XM_005254704.1:c.1604_1605delAG, XM_005254705.1:c.1604_1605delAG, XM_005254706.1:c.1460_1461delAGPathogenic11/01/2018 
285CAPN3Ex16NM_000070.2:c.1869G>Ap.Glu623= | p.E623=LRG_849t1:c.1869G>A, NM_000070.2:c.1869G>A, NM_022473.1:c.*9025C>T, NM_024344.1:c.1851G>A, NM_173087.1:c.1639-1024G>A, NM_173088.1:c.333G>A, NM_173089.1:c.-81-1024G>A, NM_173090.1:c.-81-1024G>A, NM_212464.2:c.*967G>A, NM_212465.2:c.1590G>A, NM_212467.2:c.*1544G>A, NR_027911.1:n.2740G>A, NR_027912.1:n.2360G>A, XM_005254591.1:c.*9025C>T, XM_005254592.1:c.*9025C>T, XM_005254593.1:c.*9025C>T, XM_005254594.1:c.*9025C>T, XM_005254703.1:c.1869G>A, XM_005254704.1:c.1608G>A, XM_005254705.1:c.1608G>A, XM_005254706.1:c.1464G>AVOUS01/24/2017
286CAPN3Ex16NM_000070.2:c.1869G>Cp.Glu623Asp | p.E623DLRG_849t1:c.1869G>C, NM_000070.2:c.1869G>C, NM_022473.1:c.*9025C>G, NM_024344.1:c.1851G>C, NM_173087.1:c.1639-1024G>C, NM_173088.1:c.333G>C, NM_173089.1:c.-81-1024G>C, NM_173090.1:c.-81-1024G>C, NM_212464.2:c.*967G>C, NM_212465.2:c.1590G>C, NM_212467.2:c.*1544G>C, NR_027911.1:n.2740G>C, NR_027912.1:n.2360G>C, XM_005254591.1:c.*9025C>G, XM_005254592.1:c.*9025C>G, XM_005254593.1:c.*9025C>G, XM_005254594.1:c.*9025C>G, XM_005254703.1:c.1869G>C, XM_005254704.1:c.1608G>C, XM_005254705.1:c.1608G>C, XM_005254706.1:c.1464G>CVOUS12/28/2016
287CAPN3Ex16NM_000070.2:c.1914_1914+18delGGTGTCTGGGCATGTGGCALRG_849t1:c.1914_1914+18delGGTGTCTGGGCATGTGGCA, NM_000070.2:c.1914_1914+18delGGTGTCTGGGCATGTGGCA, NM_022473.1:c.*8962_*8980delTGCCACATGCCCAGACACC, NM_024344.1:c.1896_1896+18delGGTGTCTGGGCATGTGGCA, NM_173087.1:c.1639-979_1639-961delGGTGTCTGGGCATGTGGCA, NM_173088.1:c.378_378+18delGGTGTCTGGGCATGTGGCA, NM_173089.1:c.-81-979_-81-961delGGTGTCTGGGCATGTGGCA, NM_173090.1:c.-81-979_-81-961delGGTGTCTGGGCATGTGGCA, NM_212464.2:c.*1012_*1012+18delGGTGTCTGGGCATGTGGCA, NM_212465.2:c.1635_1635+18delGGTGTCTGGGCATGTGGCA, NM_212467.2:c.*1589_*1589+18delGGTGTCTGGGCATGTGGCA, NR_027911.1:n.2785_2785+18delGGTGTCTGGGCATGTGGCA, NR_027912.1:n.2405_2405+18delGGTGTCTGGGCATGTGGCA, XM_005254591.1:c.*8962_*8980delTGCCACATGCCCAGACACC, XM_005254592.1:c.*8962_*8980delTGCCACATGCCCAGACACC, XM_005254593.1:c.*8962_*8980delTGCCACATGCCCAGACACC, XM_005254594.1:c.*8962_*8980delTGCCACATGCCCAGACACC, XM_005254703.1:c.1914_1914+18delGGTGTCTGGGCATGTGGCA, XM_005254704.1:c.1653_1653+18delGGTGTCTGGGCATGTGGCA, XM_005254705.1:c.1653_16Likely pathogenic01/17/2017 
288CAPN3Ex16NM_000070.2:c.1914+10C>TNM_000070.2:c.1914+10C>T, NM_022473.1:c.*8970G>A, NM_024344.1:c.1896+10C>T, NM_173087.1:c.1639-969C>T, NM_173088.1:c.378+10C>T, NM_173089.1:c.-81-969C>T, NM_173090.1:c.-81-969C>T, NM_212464.2:c.*1012+10C>T, NM_212465.2:c.1635+10C>T, NM_212467.2:c.*1589+10C>T, NR_027911.1:n.2785+10C>T, NR_027912.1:n.2405+10C>T, XM_005254591.1:c.*8970G>A, XM_005254592.1:c.*8970G>A, XM_005254593.1:c.*8970G>A, XM_005254594.1:c.*8970G>A, XM_005254703.1:c.1914+10C>T, XM_005254704.1:c.1653+10C>T, XM_005254705.1:c.1653+10C>T, XM_005254706.1:c.1509+10C>TVOUS04/14/2017
289CAPN3Ex16NM_000070.2:c.1914+30G>ABenign** 
290CAPN3Ex17NM_000070.2:c.1947G>Ap.Glu649= | p.E649=LRG_849t1:c.1947G>A, NM_000070.2:c.1947G>A, NM_022473.1:c.*7969C>T, NM_024344.1:c.1929G>A, NM_173087.1:c.1671G>A, NM_173088.1:c.411G>A, NM_173089.1:c.-49G>A, NM_173090.1:c.-49G>A, NM_212464.2:c.*1045G>A, NM_212465.2:c.1668G>A, NM_212467.2:c.*1622G>A, NR_027911.1:n.2818G>A, NR_027912.1:n.2438G>A, XM_005254591.1:c.*7969C>T, XM_005254592.1:c.*7969C>T, XM_005254593.1:c.*7969C>T, XM_005254594.1:c.*7969C>T, XM_005254703.1:c.1947G>A, XM_005254704.1:c.1686G>A, XM_005254705.1:c.1686G>A, XM_005254706.1:c.1542G>AVOUS04/24/2018
291CAPN3Ex17NM_000070.2:c.1957C>Tp.Gln653* | p.Q653XNM_000070.2:c.1957C>T, NM_022473.1:c.*7959G>A, NM_024344.1:c.1939C>T, NM_173087.1:c.1681C>T, NM_173088.1:c.421C>T, NM_173089.1:c.-39C>T, NM_173090.1:c.-39C>T, NM_212464.2:c.*1055C>T, NM_212465.2:c.1678C>T, NM_212467.2:c.*1632C>T, NR_027911.1:n.2828C>T, NR_027912.1:n.2448C>T, XM_005254591.1:c.*7959G>A, XM_005254592.1:c.*7959G>A, XM_005254593.1:c.*7959G>A, XM_005254594.1:c.*7959G>A, XM_005254703.1:c.1957C>T, XM_005254704.1:c.1696C>T, XM_005254705.1:c.1696C>T, XM_005254706.1:c.1552C>TPathogenic11/10/2015 
292CAPN3Ex17NM_000070.2:c.1981delAp.Ile661* | p.I661XNM_000070.2:c.1981delA, NM_022473.1:c.*7935delT, NM_024344.1:c.1963delA, NM_173087.1:c.1705delA, NM_173088.1:c.445delA, NM_173089.1:c.-15delA, NM_173090.1:c.-15delA, NM_212464.2:c.*1079delA, NM_212465.2:c.1702delA, NM_212467.2:c.*1656delA, NR_027911.1:n.2852delA, NR_027912.1:n.2472delA, XM_005254591.1:c.*7935delT, XM_005254592.1:c.*7935delT, XM_005254593.1:c.*7935delT, XM_005254594.1:c.*7935delT, XM_005254703.1:c.1981delA, XM_005254704.1:c.1720delA, XM_005254705.1:c.1720delA, XM_005254706.1:c.1576delAPathogenic10/26/2018 
293CAPN3Ex17NM_000070.2:c.1984G>Tp.Ala662Ser | p.A662SLRG_849t1:c.1984G>T, NM_000070.2:c.1984G>T, NM_022473.1:c.*7932C>A, NM_024344.1:c.1966G>T, NM_173087.1:c.1708G>T, NM_173088.1:c.448G>T, NM_173089.1:c.-12G>T, NM_173090.1:c.-12G>T, NM_212464.2:c.*1082G>T, NM_212465.2:c.1705G>T, NM_212467.2:c.*1659G>T, NR_027911.1:n.2855G>T, NR_027912.1:n.2475G>T, XM_005254591.1:c.*7932C>A, XM_005254592.1:c.*7932C>A, XM_005254593.1:c.*7932C>A, XM_005254594.1:c.*7932C>A, XM_005254703.1:c.1984G>T, XM_005254704.1:c.1723G>T, XM_005254705.1:c.1723G>T, XM_005254706.1:c.1579G>TVOUS06/08/2018
294CAPN3Ex17NM_000070.2:c.1992+1G>TNM_000070.2:c.1992+1G>T, NM_022473.1:c.*7923C>A, NM_024344.1:c.1974+1G>T, NM_173087.1:c.1716+1G>T, NM_173088.1:c.456+1G>T, NM_173089.1:c.-4+1G>T, NM_173090.1:c.-4+1G>T, NM_212464.2:c.*1090+1G>T, NM_212465.2:c.1713+1G>T, NM_212467.2:c.*1667+1G>T, NR_027911.1:n.2863+1G>T, NR_027912.1:n.2483+1G>T, XM_005254591.1:c.*7923C>A, XM_005254592.1:c.*7923C>A, XM_005254593.1:c.*7923C>A, XM_005254594.1:c.*7923C>A, XM_005254703.1:c.1992+1G>T, XM_005254704.1:c.1731+1G>T, XM_005254705.1:c.1731+1G>T, XM_005254706.1:c.1587+1G>TPathogenic08/22/2017 
295CAPN3Ex17NM_000070.2:c.1992+2T>ALRG_849t1:c.1992+2T>A, NM_000070.2:c.1992+2T>A, NM_022473.1:c.*7922A>T, NM_024344.1:c.1974+2T>A, NM_173087.1:c.1716+2T>A, NM_173088.1:c.456+2T>A, NM_173089.1:c.-4+2T>A, NM_173090.1:c.-4+2T>A, NM_212464.2:c.*1090+2T>A, NM_212465.2:c.1713+2T>A, NM_212467.2:c.*1667+2T>A, NR_027911.1:n.2863+2T>A, NR_027912.1:n.2483+2T>A, XM_005254591.1:c.*7922A>T, XM_005254592.1:c.*7922A>T, XM_005254593.1:c.*7922A>T, XM_005254594.1:c.*7922A>T, XM_005254703.1:c.1992+2T>A, XM_005254704.1:c.1731+2T>A, XM_005254705.1:c.1731+2T>A, XM_005254706.1:c.1587+2T>APathogenic02/09/2018 
296CAPN3Ex17NM_000070.2:c.1992+42C>GBenign** 
297CAPN3Ex18NM_000070.2:c.1993-5C>TLRG_849t1:c.1993-5C>T, NM_000070.2:c.1993-5C>T, NM_022473.1:c.*7522G>A, NM_024344.1:c.1975-5C>T, NM_173087.1:c.1717-5C>T, NM_173088.1:c.457-5C>T, NM_173089.1:c.-3-5C>T, NM_173090.1:c.-3-5C>T, NM_212464.2:c.*1091-5C>T, NM_212465.2:c.1714-5C>T, NM_212467.2:c.*1668-5C>T, NR_027911.1:n.2864-5C>T, NR_027912.1:n.2484-5C>T, XM_005254591.1:c.*7522G>A, XM_005254592.1:c.*7522G>A, XM_005254593.1:c.*7522G>A, XM_005254594.1:c.*7522G>A, XM_005254703.1:c.1993-5C>T, XM_005254704.1:c.1732-5C>T, XM_005254705.1:c.1732-5C>T, XM_005254706.1:c.1588-5C>TVOUS07/28/2017
298CAPN3Ex18NM_000070.2:c.1993-1G>ANM_000070.2:c.1993-1G>A, NM_022473.1:c.*7518C>T, NM_024344.1:c.1975-1G>A, NM_173087.1:c.1717-1G>A, NM_173088.1:c.457-1G>A, NM_173089.1:c.-3-1G>A, NM_173090.1:c.-3-1G>A, NM_212464.2:c.*1091-1G>A, NM_212465.2:c.1714-1G>A, NM_212467.2:c.*1668-1G>A, NR_027911.1:n.2864-1G>A, NR_027912.1:n.2484-1G>A, XM_005254591.1:c.*7518C>T, XM_005254592.1:c.*7518C>T, XM_005254593.1:c.*7518C>T, XM_005254594.1:c.*7518C>T, XM_005254703.1:c.1993-1G>A, XM_005254704.1:c.1732-1G>A, XM_005254705.1:c.1732-1G>A, XM_005254706.1:c.1588-1G>APathogenic01/30/2017 
299CAPN3Ex18NM_000070.2:c.1999dupGLRG_849t1:c.1999_2000insG, NM_000070.2:c.1999_2000insG, NM_022473.1:c.*7510_*7511insC, NM_024344.1:c.1981_1982insG, NM_173087.1:c.1723_1724insG, NM_173088.1:c.463_464insG, NM_173089.1:c.4_5insG, NM_173090.1:c.4_5insG, NM_212464.2:c.*1097_*1098insG, NM_212465.2:c.1720_1721insG, NM_212467.2:c.*1674_*1675insG, NR_027911.1:n.2870_2871insG, NR_027912.1:n.2490_2491insG, XM_005254591.1:c.*7510_*7511insC, XM_005254592.1:c.*7510_*7511insC, XM_005254593.1:c.*7510_*7511insC, XM_005254594.1:c.*7510_*7511insC, XM_005254703.1:c.1999_2000insG, XM_005254704.1:c.1738_1739insG, XM_005254705.1:c.1738_1739insG, XM_005254706.1:c.1594_1595insGPathogenic07/12/2016 
300CAPN3Ex18NM_000070.2:c.2036_2037delCAp.Thr679Serfs*20 | p.T679SfsX20NM_000070.2:c.2036_2037delCA, NM_022473.1:c.*7473_*7474delTG, NM_024344.1:c.2018_2019delCA, NM_173087.1:c.1760_1761delCA, NM_173088.1:c.500_501delCA, NM_173089.1:c.41_42delCA, NM_173090.1:c.41_42delCA, NM_212464.2:c.*1134_*1135delCA, NM_212465.2:c.1757_1758delCA, NM_212467.2:c.*1711_*1712delCA, NR_027911.1:n.2907_2908delCA, NR_027912.1:n.2527_2528delCA, XM_005254591.1:c.*7473_*7474delTG, XM_005254592.1:c.*7473_*7474delTG, XM_005254593.1:c.*7473_*7474delTG, XM_005254594.1:c.*7473_*7474delTG, XM_005254703.1:c.2036_2037delCA, XM_005254704.1:c.1775_1776delCA, XM_005254705.1:c.1775_1776delCA, XM_005254706.1:c.1631_1632delCAPathogenic06/01/2018 
301CAPN3Ex18NM_000070.2:c.2040C>Tp.Val680= | p.V680=LRG_849t1:c.2040C>T, NM_000070.2:c.2040C>T, NM_022473.1:c.*7470G>A, NM_024344.1:c.2022C>T, NM_173087.1:c.1764C>T, NM_173088.1:c.504C>T, NM_173089.1:c.45C>T, NM_173090.1:c.45C>T, NM_212464.2:c.*1138C>T, NM_212465.2:c.1761C>T, NM_212467.2:c.*1715C>T, NR_027911.1:n.2911C>T, NR_027912.1:n.2531C>T, XM_005254591.1:c.*7470G>A, XM_005254592.1:c.*7470G>A, XM_005254593.1:c.*7470G>A, XM_005254594.1:c.*7470G>A, XM_005254703.1:c.2040C>T, XM_005254704.1:c.1779C>T, XM_005254705.1:c.1779C>T, XM_005254706.1:c.1635C>TVOUS03/03/2017
302CAPN3Ex18NM_000070.2:c.2041G>Ap.Val681Met | p.V681MLRG_849t1:c.2041G>A, NM_000070.2:c.2041G>A, NM_022473.1:c.*7469C>T, NM_024344.1:c.2023G>A, NM_173087.1:c.1765G>A, NM_173088.1:c.505G>A, NM_173089.1:c.46G>A, NM_173090.1:c.46G>A, NM_212464.2:c.*1139G>A, NM_212465.2:c.1762G>A, NM_212467.2:c.*1716G>A, NR_027911.1:n.2912G>A, NR_027912.1:n.2532G>A, XM_005254591.1:c.*7469C>T, XM_005254592.1:c.*7469C>T, XM_005254593.1:c.*7469C>T, XM_005254594.1:c.*7469C>T, XM_005254703.1:c.2041G>A, XM_005254704.1:c.1780G>A, XM_005254705.1:c.1780G>A, XM_005254706.1:c.1636G>AVOUS11/16/2017
303CAPN3Ex18NM_000070.2:c.2047A>Tp.Lys683* | p.K683XLRG_849t1:c.2047A>T, NM_000070.2:c.2047A>T, NM_022473.1:c.*7463T>A, NM_024344.1:c.2029A>T, NM_173087.1:c.1771A>T, NM_173088.1:c.511A>T, NM_173089.1:c.52A>T, NM_173090.1:c.52A>T, NM_212464.2:c.*1145A>T, NM_212465.2:c.1768A>T, NM_212467.2:c.*1722A>T, NR_027911.1:n.2918A>T, NR_027912.1:n.2538A>T, XM_005254591.1:c.*7463T>A, XM_005254592.1:c.*7463T>A, XM_005254593.1:c.*7463T>A, XM_005254594.1:c.*7463T>A, XM_005254703.1:c.2047A>T, XM_005254704.1:c.1786A>T, XM_005254705.1:c.1786A>T, XM_005254706.1:c.1642A>TPathogenic02/05/2019 
304CAPN3Ex18NM_000070.2:c.2050C>Tp.His684Tyr | p.H684YLRG_849t1:c.2050C>T, NM_000070.2:c.2050C>T, NM_022473.1:c.*7460G>A, NM_024344.1:c.2032C>T, NM_173087.1:c.1774C>T, NM_173088.1:c.514C>T, NM_173089.1:c.55C>T, NM_173090.1:c.55C>T, NM_212464.2:c.*1148C>T, NM_212465.2:c.1771C>T, NM_212467.2:c.*1725C>T, NR_027911.1:n.2921C>T, NR_027912.1:n.2541C>T, XM_005254591.1:c.*7460G>A, XM_005254592.1:c.*7460G>A, XM_005254593.1:c.*7460G>A, XM_005254594.1:c.*7460G>A, XM_005254703.1:c.2050C>T, XM_005254704.1:c.1789C>T, XM_005254705.1:c.1789C>T, XM_005254706.1:c.1645C>TVOUS03/17/2016
305CAPN3Ex19NM_000070.2:c.2051-3C>ALRG_849t1:c.2051-3C>A, NM_000070.2:c.2051-3C>A, NM_022473.1:c.*7376G>T, NM_024344.1:c.2033-3C>A, NM_173087.1:c.1775-3C>A, NM_173088.1:c.515-3C>A, NM_173089.1:c.56-3C>A, NM_173090.1:c.56-3C>A, NM_212464.2:c.*1149-3C>A, NM_212465.2:c.1772-3C>A, NM_212467.2:c.*1726-3C>A, NR_027911.1:n.2922-3C>A, NR_027912.1:n.2542-3C>A, XM_005254591.1:c.*7376G>T, XM_005254592.1:c.*7376G>T, XM_005254593.1:c.*7376G>T, XM_005254594.1:c.*7376G>T, XM_005254703.1:c.2051-3C>A, XM_005254704.1:c.1790-3C>A, XM_005254705.1:c.1790-3C>A, XM_005254706.1:c.1646-3C>AVOUS01/25/2017
306CAPN3Ex19NM_000070.2:c.2051-3C>GLRG_849t1:c.2051-3C>G, NM_000070.2:c.2051-3C>G, NM_022473.1:c.*7376G>C, NM_024344.1:c.2033-3C>G, NM_173087.1:c.1775-3C>G, NM_173088.1:c.515-3C>G, NM_173089.1:c.56-3C>G, NM_173090.1:c.56-3C>G, NM_212464.2:c.*1149-3C>G, NM_212465.2:c.1772-3C>G, NM_212467.2:c.*1726-3C>G, NR_027911.1:n.2922-3C>G, NR_027912.1:n.2542-3C>G, XM_005254591.1:c.*7376G>C, XM_005254592.1:c.*7376G>C, XM_005254593.1:c.*7376G>C, XM_005254594.1:c.*7376G>C, XM_005254703.1:c.2051-3C>G, XM_005254704.1:c.1790-3C>G, XM_005254705.1:c.1790-3C>G, XM_005254706.1:c.1646-3C>GVOUS09/01/2016
307CAPN3Ex19NM_000070.2:c.2051-1G>TNM_000070.2:c.2051-1G>T, NM_022473.1:c.*7374C>A, NM_024344.1:c.2033-1G>T, NM_173087.1:c.1775-1G>T, NM_173088.1:c.515-1G>T, NM_173089.1:c.56-1G>T, NM_173090.1:c.56-1G>T, NM_212464.2:c.*1149-1G>T, NM_212465.2:c.1772-1G>T, NM_212467.2:c.*1726-1G>T, NR_027911.1:n.2922-1G>T, NR_027912.1:n.2542-1G>T, XM_005254591.1:c.*7374C>A, XM_005254592.1:c.*7374C>A, XM_005254593.1:c.*7374C>A, XM_005254594.1:c.*7374C>A, XM_005254703.1:c.2051-1G>T, XM_005254704.1:c.1790-1G>T, XM_005254705.1:c.1790-1G>T, XM_005254706.1:c.1646-1G>TPathogenic11/02/2016 
308CAPN3Ex19NM_000070.2:c.2061G>Ap.Leu687= | p.L687=LRG_849t1:c.2061G>A, NM_000070.2:c.2061G>A, NM_022473.1:c.*7363C>T, NM_024344.1:c.2043G>A, NM_173087.1:c.1785G>A, NM_173088.1:c.525G>A, NM_173089.1:c.66G>A, NM_173090.1:c.66G>A, NM_212464.2:c.*1159G>A, NM_212465.2:c.1782G>A, NM_212467.2:c.*1736G>A, NR_027911.1:n.2932G>A, NR_027912.1:n.2552G>A, XM_005254591.1:c.*7363C>T, XM_005254592.1:c.*7363C>T, XM_005254593.1:c.*7363C>T, XM_005254594.1:c.*7363C>T, XM_005254703.1:c.2061G>A, XM_005254704.1:c.1800G>A, XM_005254705.1:c.1800G>A, XM_005254706.1:c.1656G>AVOUS04/03/2018
309CAPN3Ex19NM_000070.2:c.2071G>Ap.Gly691Arg | p.G691RNM_000070.2:c.2071G>A, NM_022473.1:c.*7353C>T, NM_024344.1:c.2053G>A, NM_173087.1:c.1795G>A, NM_173088.1:c.535G>A, NM_173089.1:c.76G>A, NM_173090.1:c.76G>A, NM_212464.2:c.*1169G>A, NM_212465.2:c.1792G>A, NM_212467.2:c.*1746G>A, NR_027911.1:n.2942G>A, NR_027912.1:n.2562G>ALikely benign10/16/2015 
310CAPN3Ex19NM_000070.2:c.2092C>Tp.Arg698Cys | p.R698CNM_000070.2:c.2092C>T, NM_022473.1:c.*7332G>A, NM_024344.1:c.2074C>T, NM_173087.1:c.1816C>T, NM_173088.1:c.556C>T, NM_173089.1:c.97C>T, NM_173090.1:c.97C>T, NM_212464.2:c.*1190C>T, NM_212465.2:c.1813C>T, NM_212467.2:c.*1767C>T, NR_027911.1:n.2963C>T, NR_027912.1:n.2583C>T, XM_005254591.1:c.*7332G>A, XM_005254592.1:c.*7332G>A, XM_005254593.1:c.*7332G>A, XM_005254594.1:c.*7332G>A, XM_005254703.1:c.2092C>T, XM_005254704.1:c.1831C>T, XM_005254705.1:c.1831C>T, XM_005254706.1:c.1687C>TVOUS01/22/2016
311CAPN3Ex19NM_000070.2:c.2093G>Ap.Arg698His | p.R698HLRG_849t1:c.2093G>A, NM_000070.2:c.2093G>A, NM_022473.1:c.*7331C>T, NM_024344.1:c.2075G>A, NM_173087.1:c.1817G>A, NM_173088.1:c.557G>A, NM_173089.1:c.98G>A, NM_173090.1:c.98G>A, NM_212464.2:c.*1191G>A, NM_212465.2:c.1814G>A, NM_212467.2:c.*1768G>A, NR_027911.1:n.2964G>A, NR_027912.1:n.2584G>A, XM_005254591.1:c.*7331C>T, XM_005254592.1:c.*7331C>T, XM_005254593.1:c.*7331C>T, XM_005254594.1:c.*7331C>T, XM_005254703.1:c.2093G>A, XM_005254704.1:c.1832G>A, XM_005254705.1:c.1832G>A, XM_005254706.1:c.1688G>AVOUS01/23/2017
312CAPN3Ex19NM_000070.2:c.2099T>Cp.Met700Thr | p.M700TNM_000070.2:c.2099T>C, NM_022473.1:c.*7325A>G, NM_024344.1:c.2081T>C, NM_173087.1:c.1823T>C, NM_173088.1:c.563T>C, NM_173089.1:c.104T>C, NM_173090.1:c.104T>C, NM_212464.2:c.*1197T>C, NM_212465.2:c.1820T>C, NM_212467.2:c.*1774T>C, NR_027911.1:n.2970T>C, NR_027912.1:n.2590T>C, XM_005254591.1:c.*7325A>G, XM_005254592.1:c.*7325A>G, XM_005254593.1:c.*7325A>G, XM_005254594.1:c.*7325A>G, XM_005254703.1:c.2099T>C, XM_005254704.1:c.1838T>C, XM_005254705.1:c.1838T>C, XM_005254706.1:c.1694T>CVOUS02/11/2015
313CAPN3Ex19NM_000070.2:c.2105C>Tp.Ala702Val | p.A702VNM_000070.2:c.2105C>T, NM_022473.1:c.*7319G>A, NM_024344.1:c.2087C>T, NM_173087.1:c.1829C>T, NM_173088.1:c.569C>T, NM_173089.1:c.110C>T, NM_173090.1:c.110C>T, NM_212464.2:c.*1203C>T, NM_212465.2:c.1826C>T, NM_212467.2:c.*1780C>T, NR_027911.1:n.2976C>T, NR_027912.1:n.2596C>T, XM_005254591.1:c.*7319G>A, XM_005254592.1:c.*7319G>A, XM_005254593.1:c.*7319G>A, XM_005254594.1:c.*7319G>A, XM_005254703.1:c.2105C>T, XM_005254704.1:c.1844C>T, XM_005254705.1:c.1844C>T, XM_005254706.1:c.1700C>TLikely pathogenic09/15/2015 
314CAPN3Ex19NM_000070.2:c.2109C>Tp.Leu703= | p.L703=NM_000070.2:c.2109C>T, NM_022473.1:c.*7315G>A, NM_024344.1:c.2091C>T, NM_173087.1:c.1833C>T, NM_173088.1:c.573C>T, NM_173089.1:c.114C>T, NM_173090.1:c.114C>T, NM_212464.2:c.*1207C>T, NM_212465.2:c.1830C>T, NM_212467.2:c.*1784C>T, NR_027911.1:n.2980C>T, NR_027912.1:n.2600C>T, XM_005254591.1:c.*7315G>A, XM_005254592.1:c.*7315G>A, XM_005254593.1:c.*7315G>A, XM_005254594.1:c.*7315G>A, XM_005254703.1:c.2109C>T, XM_005254704.1:c.1848C>T, XM_005254705.1:c.1848C>T, XM_005254706.1:c.1704C>TVOUS06/02/2017
315CAPN3Ex19NM_000070.2:c.2115+2T>CLRG_849t1:c.2115+2T>C, NM_000070.2:c.2115+2T>C, NM_022473.1:c.*7307A>G, NM_024344.1:c.2097+2T>C, NM_173087.1:c.1839+2T>C, NM_173088.1:c.579+2T>C, NM_173089.1:c.120+2T>C, NM_173090.1:c.120+2T>C, NM_212464.2:c.*1213+2T>C, NM_212465.2:c.1836+2T>C, NM_212467.2:c.*1790+2T>C, NR_027911.1:n.2986+2T>C, NR_027912.1:n.2606+2T>C, XM_005254591.1:c.*7307A>G, XM_005254592.1:c.*7307A>G, XM_005254593.1:c.*7307A>G, XM_005254594.1:c.*7307A>G, XM_005254703.1:c.2115+2T>C, XM_005254704.1:c.1854+2T>C, XM_005254705.1:c.1854+2T>C, XM_005254706.1:c.1710+2T>CPathogenic11/28/2016 
316CAPN3Ex20NM_000070.2:c.2119G>Cp.Asp707His | p.D707HLRG_849t1:c.2119G>C, NM_000070.2:c.2119G>C, NM_022473.1:c.*6873C>G, NM_024344.1:c.2101G>C, NM_173087.1:c.1843G>C, NM_173088.1:c.583G>C, NM_173089.1:c.124G>C, NM_173090.1:c.124G>C, NM_212464.2:c.*1217G>C, NM_212465.2:c.1840G>C, NM_212467.2:c.*1794G>C, NR_027911.1:n.2990G>C, NR_027912.1:n.2610G>C, XM_005254591.1:c.*6873C>G, XM_005254592.1:c.*6873C>G, XM_005254593.1:c.*6873C>G, XM_005254594.1:c.*6873C>G, XM_005254703.1:c.2119G>C, XM_005254704.1:c.1858G>C, XM_005254705.1:c.1858G>C, XM_005254706.1:c.1714G>CVOUS09/14/2016
317CAPN3Ex20NM_000070.2:c.2120A>Gp.Asp707Gly | p.D707GLRG_849t1:c.2120A>G, NM_000070.2:c.2120A>G, NM_022473.1:c.*6872T>C, NM_024344.1:c.2102A>G, NM_173087.1:c.1844A>G, NM_173088.1:c.584A>G, NM_173089.1:c.125A>G, NM_173090.1:c.125A>G, NM_212464.2:c.*1218A>G, NM_212465.2:c.1841A>G, NM_212467.2:c.*1795A>G, NR_027911.1:n.2991A>G, NR_027912.1:n.2611A>G, XM_005254591.1:c.*6872T>C, XM_005254592.1:c.*6872T>C, XM_005254593.1:c.*6872T>C, XM_005254594.1:c.*6872T>C, XM_005254703.1:c.2120A>G, XM_005254704.1:c.1859A>G, XM_005254705.1:c.1859A>G, XM_005254706.1:c.1715A>GPathogenic10/14/2016 
318CAPN3Ex20NM_000070.2:c.2125T>Cp.Ser709Pro | p.S709PLRG_849t1:c.2125T>C, NM_000070.2:c.2125T>C, NM_022473.1:c.*6867A>G, NM_024344.1:c.2107T>C, NM_173087.1:c.1849T>C, NM_173088.1:c.589T>C, NM_173089.1:c.130T>C, NM_173090.1:c.130T>C, NM_212464.2:c.*1223T>C, NM_212465.2:c.1846T>C, NM_212467.2:c.*1800T>C, NR_027911.1:n.2996T>C, NR_027912.1:n.2616T>C, XM_005254591.1:c.*6867A>G, XM_005254592.1:c.*6867A>G, XM_005254593.1:c.*6867A>G, XM_005254594.1:c.*6867A>G, XM_005254703.1:c.2125T>C, XM_005254704.1:c.1864T>C, XM_005254705.1:c.1864T>C, XM_005254706.1:c.1720T>CVOUS03/17/2016
319CAPN3Ex20NM_000070.2:c.2134C>Tp.Leu712Phe | p.L712FNM_000070.2:c.2134C>T, NM_022473.1:c.*6858G>A, NM_024344.1:c.2116C>T, NM_173087.1:c.1858C>T, NM_173088.1:c.598C>T, NM_173089.1:c.139C>T, NM_173090.1:c.139C>T, NM_212464.2:c.*1232C>T, NM_212465.2:c.1855C>T, NM_212467.2:c.*1809C>T, NR_027911.1:n.3005C>T, NR_027912.1:n.2625C>T, XM_005254591.1:c.*6858G>A, XM_005254592.1:c.*6858G>A, XM_005254593.1:c.*6858G>A, XM_005254594.1:c.*6858G>A, XM_005254703.1:c.2134C>T, XM_005254704.1:c.1873C>T, XM_005254705.1:c.1873C>T, XM_005254706.1:c.1729C>TLikely pathogenic07/03/2017 
320CAPN3Ex20NM_000070.2:c.2138A>Cp.Asn713Thr | p.N713TLRG_849t1:c.2138A>C, NM_000070.2:c.2138A>C, NM_022473.1:c.*6854T>G, NM_024344.1:c.2120A>C, NM_173087.1:c.1862A>C, NM_173088.1:c.602A>C, NM_173089.1:c.143A>C, NM_173090.1:c.143A>C, NM_212464.2:c.*1236A>C, NM_212465.2:c.1859A>C, NM_212467.2:c.*1813A>C, NR_027911.1:n.3009A>C, NR_027912.1:n.2629A>C, XM_005254591.1:c.*6854T>G, XM_005254592.1:c.*6854T>G, XM_005254593.1:c.*6854T>G, XM_005254594.1:c.*6854T>G, XM_005254703.1:c.2138A>C, XM_005254704.1:c.1877A>C, XM_005254705.1:c.1877A>C, XM_005254706.1:c.1733A>CVOUS07/22/2016
321CAPN3Ex20NM_000070.2:c.2148G>Tp.Glu716Asp | p.E716DNM_000070.2:c.2148G>T, NM_022473.1:c.*6844C>A, NM_024344.1:c.2130G>T, NM_173087.1:c.1872G>T, NM_173088.1:c.612G>T, NM_173089.1:c.153G>T, NM_173090.1:c.153G>T, NM_212464.2:c.*1246G>T, NM_212465.2:c.1869G>T, NM_212467.2:c.*1823G>T, NR_027911.1:n.3019G>T, NR_027912.1:n.2639G>T, XM_005254591.1:c.*6844C>A, XM_005254592.1:c.*6844C>A, XM_005254593.1:c.*6844C>A, XM_005254594.1:c.*6844C>A, XM_005254703.1:c.2148G>T, XM_005254704.1:c.1887G>T, XM_005254705.1:c.1887G>T, XM_005254706.1:c.1743G>TLikely pathogenic03/05/2018 
322CAPN3Ex20NM_000070.2:c.2179delTNM_000070.2:c.2179delT, NM_022473.1:c.*6813delA, NM_024344.1:c.2161delT, NM_173087.1:c.1903delT, NM_173088.1:c.643delT, NM_173089.1:c.184delT, NM_173090.1:c.184delT, NM_212464.2:c.*1277delT, NM_212465.2:c.1900delT, NM_212467.2:c.*1854delT, NR_027911.1:n.3050delT, NR_027912.1:n.2670delT, XM_005254591.1:c.*6813delA, XM_005254592.1:c.*6813delA, XM_005254593.1:c.*6813delA, XM_005254594.1:c.*6813delA, XM_005254703.1:c.2179delT, XM_005254704.1:c.1918delT, XM_005254705.1:c.1918delT, XM_005254706.1:c.1774delTPathogenic11/23/2015 
323CAPN3Ex20NM_000070.2:c.2184G>Ap.Gln728= | p.Q728=NM_000070.2:c.2184G>A, NM_022473.1:c.*6808C>T, NM_024344.1:c.2166G>A, NM_173087.1:c.1908G>A, NM_173088.1:c.648G>A, NM_173089.1:c.189G>A, NM_173090.1:c.189G>A, NM_212464.2:c.*1282G>A, NM_212465.2:c.1905G>A, NM_212467.2:c.*1859G>A, NR_027911.1:n.3055G>A, NR_027912.1:n.2675G>A, XM_005254591.1:c.*6808C>T, XM_005254592.1:c.*6808C>T, XM_005254593.1:c.*6808C>T, XM_005254594.1:c.*6808C>T, XM_005254703.1:c.2184G>A, XM_005254704.1:c.1923G>A, XM_005254705.1:c.1923G>A, XM_005254706.1:c.1779G>AVOUS01/30/2018
324CAPN3Ex20NM_000070.2:c.2184+3G>ALRG_849t1:c.2184+3G>A, NM_000070.2:c.2184+3G>A, NM_022473.1:c.*6805C>T, NM_024344.1:c.2166+3G>A, NM_173087.1:c.1908+3G>A, NM_173088.1:c.648+3G>A, NM_173089.1:c.189+3G>A, NM_173090.1:c.189+3G>A, NM_212464.2:c.*1282+3G>A, NM_212465.2:c.1905+3G>A, NM_212467.2:c.*1859+3G>A, NR_027911.1:n.3055+3G>A, NR_027912.1:n.2675+3G>A, XM_005254591.1:c.*6805C>T, XM_005254592.1:c.*6805C>T, XM_005254593.1:c.*6805C>T, XM_005254594.1:c.*6805C>T, XM_005254703.1:c.2184+3G>A, XM_005254704.1:c.1923+3G>A, XM_005254705.1:c.1923+3G>A, XM_005254706.1:c.1779+3G>AVOUS12/13/2016
325CAPN3Ex21NM_000070.2:c.2185-5_2190dupGCCAGAAAATTLRG_849t1:c.2185-5_2190dupGCCAGAAAATT, NM_000070.2:c.2185-5_2190dupGCCAGAAAATT, NM_022473.1:c.*6711_*6721dupAATTTTCTGGC, NM_024344.1:c.2167-5_2172dupGCCAGAAAATT, NM_173087.1:c.1909-5_1914dupGCCAGAAAATT, NM_173088.1:c.649-5_654dupGCCAGAAAATT, NM_173089.1:c.190-5_195dupGCCAGAAAATT, NM_173090.1:c.190-5_195dupGCCAGAAAATT, NM_212464.2:c.*1283-5_*1288dupGCCAGAAAATT, NM_212465.2:c.1906-5_1911dupGCCAGAAAATT, NM_212467.2:c.*1860-5_*1865dupGCCAGAAAATT, NR_027911.1:n.3056-5_3061dupGCCAGAAAATT, NR_027912.1:n.2676-5_2681dupGCCAGAAAATT, XM_005254591.1:c.*6711_*6721dupAATTTTCTGGC, XM_005254592.1:c.*6711_*6721dupAATTTTCTGGC, XM_005254593.1:c.*6711_*6721dupAATTTTCTGGC, XM_005254594.1:c.*6711_*6721dupAATTTTCTGGC, XM_005254703.1:c.2185-5_2190dupGCCAGAAAATT, XM_005254704.1:c.1924-5_1929dupGCCAGAAAATT, XM_005254705.1:c.1924-5_1929dupGCCAGAAAATT, XM_005254706.1:c.1780-5_1785dupGCCAGAAAATTVOUS03/12/2020
326CAPN3Ex21NM_000070.2:c.2185-2A>GLRG_849t1:c.2185-2A>G, NM_000070.2:c.2185-2A>G, NM_022473.1:c.*6718T>C, NM_024344.1:c.2167-2A>G, NM_173087.1:c.1909-2A>G, NM_173088.1:c.649-2A>G, NM_173089.1:c.190-2A>G, NM_173090.1:c.190-2A>G, NM_212464.2:c.*1283-2A>G, NM_212465.2:c.1906-2A>G, NM_212467.2:c.*1860-2A>G, NR_027911.1:n.3056-2A>G, NR_027912.1:n.2676-2A>G, XM_005254591.1:c.*6718T>C, XM_005254592.1:c.*6718T>C, XM_005254593.1:c.*6718T>C, XM_005254594.1:c.*6718T>C, XM_005254703.1:c.2185-2A>G, XM_005254704.1:c.1924-2A>G, XM_005254705.1:c.1924-2A>G, XM_005254706.1:c.1780-2A>GPathogenic10/17/2016 
327CAPN3Ex21NM_000070.2:c.2212C>Tp.Gln738* | p.Q738XNM_000070.2:c.2212C>T, NM_022473.1:c.*6689G>A, NM_024344.1:c.2194C>T, NM_173087.1:c.1936C>T, NM_173088.1:c.676C>T, NM_173089.1:c.217C>T, NM_173090.1:c.217C>T, NM_212464.2:c.*1310C>T, NM_212465.2:c.1933C>T, NM_212467.2:c.*1887C>T, NR_027911.1:n.3083C>T, NR_027912.1:n.2703C>T, XM_005254591.1:c.*6689G>A, XM_005254592.1:c.*6689G>A, XM_005254593.1:c.*6689G>A, XM_005254594.1:c.*6689G>A, XM_005254703.1:c.2212C>T, XM_005254704.1:c.1951C>T, XM_005254705.1:c.1951C>T, XM_005254706.1:c.1807C>TPathogenic** 
328CAPN3Ex21NM_000070.2:c.2218G>Ap.Gly740Ser | p.G740SNM_000070.2:c.2218G>A, NM_022473.1:c.*6683C>T, NM_024344.1:c.2200G>A, NM_173087.1:c.1942G>A, NM_173088.1:c.682G>A, NM_173089.1:c.223G>A, NM_173090.1:c.223G>A, NM_212464.2:c.*1316G>A, NM_212465.2:c.1939G>A, NM_212467.2:c.*1893G>A, NR_027911.1:n.3089G>A, NR_027912.1:n.2709G>AVOUS05/29/2013
329CAPN3Ex21NM_000070.2:c.2219G>Ap.Gly740Asp | p.G740DLRG_849t1:c.2219G>A, NM_000070.2:c.2219G>A, NM_022473.1:c.*6682C>T, NM_024344.1:c.2201G>A, NM_173087.1:c.1943G>A, NM_173088.1:c.683G>A, NM_173089.1:c.224G>A, NM_173090.1:c.224G>A, NM_212464.2:c.*1317G>A, NM_212465.2:c.1940G>A, NM_212467.2:c.*1894G>A, NR_027911.1:n.3090G>A, NR_027912.1:n.2710G>A, XM_005254591.1:c.*6682C>T, XM_005254592.1:c.*6682C>T, XM_005254593.1:c.*6682C>T, XM_005254594.1:c.*6682C>T, XM_005254703.1:c.2219G>A, XM_005254704.1:c.1958G>A, XM_005254705.1:c.1958G>A, XM_005254706.1:c.1814G>AVOUS12/07/2016
330CAPN3Ex21NM_000070.2:c.2224A>Gp.Ile742Val | p.I742VLRG_849t1:c.2224A>G, NM_000070.2:c.2224A>G, NM_022473.1:c.*6677T>C, NM_024344.1:c.2206A>G, NM_173087.1:c.1948A>G, NM_173088.1:c.688A>G, NM_173089.1:c.229A>G, NM_173090.1:c.229A>G, NM_212464.2:c.*1322A>G, NM_212465.2:c.1945A>G, NM_212467.2:c.*1899A>G, NR_027911.1:n.3095A>G, NR_027912.1:n.2715A>G, XM_005254591.1:c.*6677T>C, XM_005254592.1:c.*6677T>C, XM_005254593.1:c.*6677T>C, XM_005254594.1:c.*6677T>C, XM_005254703.1:c.2224A>G, XM_005254704.1:c.1963A>G, XM_005254705.1:c.1963A>G, XM_005254706.1:c.1819A>GVOUS06/13/2017
331CAPN3Ex21NM_000070.2:c.2231G>Cp.Ser744Thr | p.S744TLRG_849t1:c.2231G>C, NM_000070.2:c.2231G>C, NM_022473.1:c.*6670C>G, NM_024344.1:c.2213G>C, NM_173087.1:c.1955G>C, NM_173088.1:c.695G>C, NM_173089.1:c.236G>C, NM_173090.1:c.236G>C, NM_212464.2:c.*1329G>C, NM_212465.2:c.1952G>C, NM_212467.2:c.*1906G>C, NR_027911.1:n.3102G>C, NR_027912.1:n.2722G>C, XM_005254591.1:c.*6670C>G, XM_005254592.1:c.*6670C>G, XM_005254593.1:c.*6670C>G, XM_005254594.1:c.*6670C>G, XM_005254703.1:c.2231G>C, XM_005254704.1:c.1970G>C, XM_005254705.1:c.1970G>C, XM_005254706.1:c.1826G>CVOUS11/14/2019
332CAPN3Ex21NM_000070.2:c.2235C>Ap.Tyr745* | p.Y745XLRG_849t1:c.2235C>A, NM_000070.2:c.2235C>A, NM_022473.1:c.*6666G>T, NM_024344.1:c.2217C>A, NM_173087.1:c.1959C>A, NM_173088.1:c.699C>A, NM_173089.1:c.240C>A, NM_173090.1:c.240C>A, NM_212464.2:c.*1333C>A, NM_212465.2:c.1956C>A, NM_212467.2:c.*1910C>A, NR_027911.1:n.3106C>A, NR_027912.1:n.2726C>A, XM_005254591.1:c.*6666G>T, XM_005254592.1:c.*6666G>T, XM_005254593.1:c.*6666G>T, XM_005254594.1:c.*6666G>T, XM_005254703.1:c.2235C>A, XM_005254704.1:c.1974C>A, XM_005254705.1:c.1974C>A, XM_005254706.1:c.1830C>APathogenic12/27/2016 
333CAPN3Ex21NM_000070.2:c.2235C>Tp.Tyr745= | p.Y745=NM_000070.2:c.2235C>T, NM_022473.1:c.*6666G>A, NM_024344.1:c.2217C>T, NM_173087.1:c.1959C>T, NM_173088.1:c.699C>T, NM_173089.1:c.240C>T, NM_173090.1:c.240C>T, NM_212464.2:c.*1333C>T, NM_212465.2:c.1956C>T, NM_212467.2:c.*1910C>T, NR_027911.1:n.3106C>T, NR_027912.1:n.2726C>T, XM_005254591.1:c.*6666G>A, XM_005254592.1:c.*6666G>A, XM_005254593.1:c.*6666G>A, XM_005254594.1:c.*6666G>A, XM_005254703.1:c.2235C>T, XM_005254704.1:c.1974C>T, XM_005254705.1:c.1974C>T, XM_005254706.1:c.1830C>TVOUS01/08/2019
334CAPN3Ex21NM_000070.2:c.2236G>Ap.Glu746Lys | p.E746KNM_000070.2:c.2236G>A, NM_022473.1:c.*6665C>T, NM_024344.1:c.2218G>A, NM_173087.1:c.1960G>A, NM_173088.1:c.700G>A, NM_173089.1:c.241G>A, NM_173090.1:c.241G>A, NM_212464.2:c.*1334G>A, NM_212465.2:c.1957G>A, NM_212467.2:c.*1911G>A, NR_027911.1:n.3107G>A, NR_027912.1:n.2727G>AVOUS06/07/2016
335CAPN3Ex21NM_000070.2:c.2238G>Tp.Glu746Asp | p.E746DLRG_849t1:c.2238G>T, NM_000070.2:c.2238G>T, NM_022473.1:c.*6663C>A, NM_024344.1:c.2220G>T, NM_173087.1:c.1962G>T, NM_173088.1:c.702G>T, NM_173089.1:c.243G>T, NM_173090.1:c.243G>T, NM_212464.2:c.*1336G>T, NM_212465.2:c.1959G>T, NM_212467.2:c.*1913G>T, NR_027911.1:n.3109G>T, NR_027912.1:n.2729G>T, XM_005254591.1:c.*6663C>A, XM_005254592.1:c.*6663C>A, XM_005254593.1:c.*6663C>A, XM_005254594.1:c.*6663C>A, XM_005254703.1:c.2238G>T, XM_005254704.1:c.1977G>T, XM_005254705.1:c.1977G>T, XM_005254706.1:c.1833G>TVOUS05/05/2017
336CAPN3Ex21NM_000070.2:c.2242C>Tp.Arg748* | p.R748XNM_000070.2:c.2242C>T, NM_022473.1:c.*6659G>A, NM_024344.1:c.2224C>T, NM_173087.1:c.1966C>T, NM_173088.1:c.706C>T, NM_173089.1:c.247C>T, NM_173090.1:c.247C>T, NM_212464.2:c.*1340C>T, NM_212465.2:c.1963C>T, NM_212467.2:c.*1917C>T, NR_027911.1:n.3113C>T, NR_027912.1:n.2733C>T, XM_005254591.1:c.*6659G>A, XM_005254592.1:c.*6659G>A, XM_005254593.1:c.*6659G>A, XM_005254594.1:c.*6659G>A, XM_005254703.1:c.2242C>T, XM_005254704.1:c.1981C>T, XM_005254705.1:c.1981C>T, XM_005254706.1:c.1837C>TPathogenic05/16/2018 
337CAPN3Ex21NM_000070.2:c.2243G>Ap.Arg748Gln | p.R748QNM_000070.2:c.2243G>A, NM_022473.1:c.*6658C>T, NM_024344.1:c.2225G>A, NM_173087.1:c.1967G>A, NM_173088.1:c.707G>A, NM_173089.1:c.248G>A, NM_173090.1:c.248G>A, NM_212464.2:c.*1341G>A, NM_212465.2:c.1964G>A, NM_212467.2:c.*1918G>A, NR_027911.1:n.3114G>A, NR_027912.1:n.2734G>APathogenic11/10/2017 
338CAPN3Ex21NM_000070.2:c.2251_2254dupGTCALRG_849t1:c.2254_2255insGTCA, NM_000070.2:c.2251_2254dup, NM_000070.2:c.2254_2255insGTCA, NM_022473.1:c.*6646_*6647insTGAC, NM_022473.1:c.*6647_*6650dup, NM_024344.1:c.2233_2236dup, NM_024344.1:c.2236_2237insGTCA, NM_173087.1:c.1975_1978dup, NM_173087.1:c.1978_1979insGTCA, NM_173088.1:c.715_718dup, NM_173088.1:c.718_719insGTCA, NM_173089.1:c.256_259dup, NM_173089.1:c.259_260insGTCA, NM_173090.1:c.256_259dup, NM_173090.1:c.259_260insGTCA, NM_212464.2:c.*1349_*1352dup, NM_212464.2:c.*1352_*1353insGTCA, NM_212465.2:c.1972_1975dup, NM_212465.2:c.1975_1976insGTCA, NM_212467.2:c.*1926_*1929dup, NM_212467.2:c.*1929_*1930insGTCA, NR_027911.1:n.3122_3125dup, NR_027911.1:n.3125_3126insGTCA, NR_027912.1:n.2742_2745dup, NR_027912.1:n.2745_2746insGTCA, XM_005254591.1:c.*6646_*6647insTGAC, XM_005254592.1:c.*6646_*6647insTGAC, XM_005254593.1:c.*6646_*6647insTGAC, XM_005254594.1:c.*6646_*6647insTGAC, XM_005254703.1:c.2254_2255insGTCA, XM_005254704.1:c.1993_1994insGTCA, XM_005254705.1:c.1993_1994insGPathogenic10/04/2013 
339CAPN3Ex21NM_000070.2:c.2257G>Ap.Asp753Asn | p.D753NNM_000070.2:c.2257G>A, NM_022473.1:c.*6644C>T, NM_024344.1:c.2239G>A, NM_173087.1:c.1981G>A, NM_173088.1:c.721G>A, NM_173089.1:c.262G>A, NM_173090.1:c.262G>A, NM_212464.2:c.*1355G>A, NM_212465.2:c.1978G>A, NM_212467.2:c.*1932G>A, NR_027911.1:n.3128G>A, NR_027912.1:n.2748G>A, XM_005254591.1:c.*6644C>T, XM_005254592.1:c.*6644C>T, XM_005254593.1:c.*6644C>T, XM_005254594.1:c.*6644C>T, XM_005254703.1:c.2257G>A, XM_005254704.1:c.1996G>A, XM_005254705.1:c.1996G>A, XM_005254706.1:c.1852G>AVOUS01/11/2018
340CAPN3Ex21NM_000070.2:c.2258_2260delACGp.Asp753del | p.D753delNM_000070.2:c.2258_2260delACG, NM_022473.1:c.*6641_*6643delCGT, NM_024344.1:c.2240_2242delACG, NM_173087.1:c.1982_1984delACG, NM_173088.1:c.722_724delACG, NM_173089.1:c.263_265delACG, NM_173090.1:c.263_265delACG, NM_212464.2:c.*1356_*1358delACG, NM_212465.2:c.1979_1981delACG, NM_212467.2:c.*1933_*1935delACG, NR_027911.1:n.3129_3131delACG, NR_027912.1:n.2749_2751delACG, XM_005254591.1:c.*6641_*6643delCGT, XM_005254592.1:c.*6641_*6643delCGT, XM_005254593.1:c.*6641_*6643delCGT, XM_005254594.1:c.*6641_*6643delCGT, XM_005254703.1:c.2258_2260delACG, XM_005254704.1:c.1997_1999delACG, XM_005254705.1:c.1997_1999delACG, XM_005254706.1:c.1853_1855delACGLikely pathogenic03/09/2018 
341CAPN3Ex21NM_000070.2:c.2263+1G>ALRG_849t1:c.2263+1G>A, NM_000070.2:c.2263+1G>A, NM_022473.1:c.*6637C>T, NM_024344.1:c.2245+1G>A, NM_173087.1:c.1987+1G>A, NM_173088.1:c.727+1G>A, NM_173089.1:c.268+1G>A, NM_173090.1:c.268+1G>A, NM_212464.2:c.*1361+1G>A, NM_212465.2:c.1984+1G>A, NM_212467.2:c.*1938+1G>A, NR_027911.1:n.3134+1G>A, NR_027912.1:n.2754+1G>A, XM_005254591.1:c.*6637C>T, XM_005254592.1:c.*6637C>T, XM_005254593.1:c.*6637C>T, XM_005254594.1:c.*6637C>T, XM_005254703.1:c.2263+1G>A, XM_005254704.1:c.2002+1G>A, XM_005254705.1:c.2002+1G>A, XM_005254706.1:c.1858+1G>APathogenic09/23/2016 
342CAPN3Ex22NM_000070.2:c.2279dupAp.Asn760Lysfs*5 | p.N760KfsX5LRG_849t1:c.2279_2280insA, LRG_849t1:c.2279dupA, NM_000070.2:c.2279_2280insA, NM_000070.2:c.2279dupA, NM_022473.1:c.*6404_*6405insT, NM_022473.1:c.*6405dupT, NM_024344.1:c.2261_2262insA, NM_024344.1:c.2261dupA, NM_173087.1:c.2003_2004insA, NM_173087.1:c.2003dupA, NM_173088.1:c.743_744insA, NM_173088.1:c.743dupA, NM_173089.1:c.284_285insA, NM_173089.1:c.284dupA, NM_173090.1:c.284_285insA, NM_173090.1:c.284dupA, NM_212464.2:c.*1377_*1378insA, NM_212464.2:c.*1377dupA, NM_212465.2:c.2000_2001insA, NM_212465.2:c.2000dupA, NM_212467.2:c.*1954_*1955insA, NM_212467.2:c.*1954dupA, NR_027911.1:n.3150_3151insA, NR_027911.1:n.3150dupA, NR_027912.1:n.2770_2771insA, NR_027912.1:n.2770dupA, XM_005254591.1:c.*6404_*6405insT, XM_005254591.1:c.*6405dupT, XM_005254592.1:c.*6404_*6405insT, XM_005254592.1:c.*6405dupT, XM_005254593.1:c.*6404_*6405insT, XM_005254593.1:c.*6405dupT, XM_005254594.1:c.*6404_*6405insT, XM_005254594.1:c.*6405dupT, XM_005254703.1:c.2279_2280insA, XM_005254703.1:c.2279dupA, XM_005Pathogenic05/18/2018 
343CAPN3Ex22NM_000070.2:c.2282A>Cp.Gln761Pro | p.Q761PLRG_849t1:c.2282A>C, NM_000070.2:c.2282A>C, NM_022473.1:c.*6402T>G, NM_024344.1:c.2264A>C, NM_173087.1:c.2006A>C, NM_173088.1:c.746A>C, NM_173089.1:c.287A>C, NM_173090.1:c.287A>C, NM_212464.2:c.*1380A>C, NM_212465.2:c.2003A>C, NM_212467.2:c.*1957A>C, NR_027911.1:n.3153A>C, NR_027912.1:n.2773A>C, XM_005254591.1:c.*6402T>G, XM_005254592.1:c.*6402T>G, XM_005254593.1:c.*6402T>G, XM_005254594.1:c.*6402T>G, XM_005254703.1:c.2282A>C, XM_005254704.1:c.2021A>C, XM_005254705.1:c.2021A>C, XM_005254706.1:c.1877A>CVOUS01/03/2017
344CAPN3Ex22NM_000070.2:c.2288A>Gp.Tyr763Cys | p.Y763CLRG_849t1:c.2288A>G, NM_000070.2:c.2288A>G, NM_022473.1:c.*6396T>C, NM_024344.1:c.2270A>G, NM_173087.1:c.2012A>G, NM_173088.1:c.752A>G, NM_173089.1:c.293A>G, NM_173090.1:c.293A>G, NM_212464.2:c.*1386A>G, NM_212465.2:c.2009A>G, NM_212467.2:c.*1963A>G, NR_027911.1:n.3159A>G, NR_027912.1:n.2779A>G, XM_005254591.1:c.*6396T>C, XM_005254592.1:c.*6396T>C, XM_005254593.1:c.*6396T>C, XM_005254594.1:c.*6396T>C, XM_005254703.1:c.2288A>G, XM_005254704.1:c.2027A>G, XM_005254705.1:c.2027A>G, XM_005254706.1:c.1883A>GPathogenic08/23/2018 
345CAPN3Ex22NM_000070.2:c.2290delGp.Asp764Thrfs*12 | p.D764TfsX12LRG_849t1:c.2290delG, NM_000070.2:c.2290delG, NM_022473.1:c.*6394delC, NM_024344.1:c.2272delG, NM_173087.1:c.2014delG, NM_173088.1:c.754delG, NM_173089.1:c.295delG, NM_173090.1:c.295delG, NM_212464.2:c.*1388delG, NM_212465.2:c.2011delG, NM_212467.2:c.*1965delG, NR_027911.1:n.3161delG, NR_027912.1:n.2781delG, XM_005254591.1:c.*6394delC, XM_005254592.1:c.*6394delC, XM_005254593.1:c.*6394delC, XM_005254594.1:c.*6394delC, XM_005254703.1:c.2290delG, XM_005254704.1:c.2029delG, XM_005254705.1:c.2029delG, XM_005254706.1:c.1885delGPathogenic01/12/2018 
346CAPN3Ex22NM_000070.2:c.2292C>Tp.Asp764= | p.D764=LRG_849t1:c.2292C>T, NM_000070.2:c.2292C>T, NM_022473.1:c.*6392G>A, NM_024344.1:c.2274C>T, NM_173087.1:c.2016C>T, NM_173088.1:c.756C>T, NM_173089.1:c.297C>T, NM_173090.1:c.297C>T, NM_212464.2:c.*1390C>T, NM_212465.2:c.2013C>T, NM_212467.2:c.*1967C>T, NR_027911.1:n.3163C>T, NR_027912.1:n.2783C>T, XM_005254591.1:c.*6392G>A, XM_005254592.1:c.*6392G>A, XM_005254593.1:c.*6392G>A, XM_005254594.1:c.*6392G>A, XM_005254703.1:c.2292C>T, XM_005254704.1:c.2031C>T, XM_005254705.1:c.2031C>T, XM_005254706.1:c.1887C>TVOUS10/27/2016
347CAPN3Ex22NM_000070.2:c.2293_2294delATinsGALRG_849t1:c.2293_2294delinsGA, NM_000070.2:c.2293_2294delinsGA, NM_022473.1:c.*6390_*6391delinsTC, NM_024344.1:c.2275_2276delinsGA, NM_173087.1:c.2017_2018delinsGA, NM_173088.1:c.757_758delinsGA, NM_173089.1:c.298_299delinsGA, NM_173090.1:c.298_299delinsGA, NM_212464.2:c.*1391_*1392delinsGA, NM_212465.2:c.2014_2015delinsGA, NM_212467.2:c.*1968_*1969delinsGA, NR_027911.1:n.3164_3165delinsGA, NR_027912.1:n.2784_2785delinsGA, XM_005254591.1:c.*6390_*6391delinsTC, XM_005254592.1:c.*6390_*6391delinsTC, XM_005254593.1:c.*6390_*6391delinsTC, XM_005254594.1:c.*6390_*6391delinsTC, XM_005254703.1:c.2293_2294delinsGA, XM_005254704.1:c.2032_2033delinsGA, XM_005254705.1:c.2032_2033delinsGA, XM_005254706.1:c.1888_1889delinsGAVOUS12/22/2016
348CAPN3Ex22NM_000070.2:c.2293A>Gp.Ile765Val | p.I765VLRG_849t1:c.2293A>G, NM_000070.2:c.2293A>G, NM_022473.1:c.*6391T>C, NM_024344.1:c.2275A>G, NM_173087.1:c.2017A>G, NM_173088.1:c.757A>G, NM_173089.1:c.298A>G, NM_173090.1:c.298A>G, NM_212464.2:c.*1391A>G, NM_212465.2:c.2014A>G, NM_212467.2:c.*1968A>G, NR_027911.1:n.3164A>G, NR_027912.1:n.2784A>G, XM_005254591.1:c.*6391T>C, XM_005254592.1:c.*6391T>C, XM_005254593.1:c.*6391T>C, XM_005254594.1:c.*6391T>C, XM_005254703.1:c.2293A>G, XM_005254704.1:c.2032A>G, XM_005254705.1:c.2032A>G, XM_005254706.1:c.1888A>GVOUS11/09/2016
349CAPN3Ex22NM_000070.2:c.2294T>Ap.Ile765Asn | p.I765NLRG_849t1:c.2294T>A, NM_000070.2:c.2294T>A, NM_022473.1:c.*6390A>T, NM_024344.1:c.2276T>A, NM_173087.1:c.2018T>A, NM_173088.1:c.758T>A, NM_173089.1:c.299T>A, NM_173090.1:c.299T>A, NM_212464.2:c.*1392T>A, NM_212465.2:c.2015T>A, NM_212467.2:c.*1969T>A, NR_027911.1:n.3165T>A, NR_027912.1:n.2785T>A, XM_005254591.1:c.*6390A>T, XM_005254592.1:c.*6390A>T, XM_005254593.1:c.*6390A>T, XM_005254594.1:c.*6390A>T, XM_005254703.1:c.2294T>A, XM_005254704.1:c.2033T>A, XM_005254705.1:c.2033T>A, XM_005254706.1:c.1889T>AVOUS08/02/2016
350CAPN3Ex22NM_000070.2:c.2305C>Tp.Arg769Trp | p.R769WNM_000070.2:c.2305C>T, NM_022473.1:c.*6379G>A, NM_024344.1:c.2287C>T, NM_173087.1:c.2029C>T, NM_173088.1:c.769C>T, NM_173089.1:c.310C>T, NM_173090.1:c.310C>T, NM_212464.2:c.*1403C>T, NM_212465.2:c.2026C>T, NM_212467.2:c.*1980C>T, NR_027911.1:n.3176C>T, NR_027912.1:n.2796C>T, XM_005254591.1:c.*6379G>A, XM_005254592.1:c.*6379G>A, XM_005254593.1:c.*6379G>A, XM_005254594.1:c.*6379G>A, XM_005254703.1:c.2305C>T, XM_005254704.1:c.2044C>T, XM_005254705.1:c.2044C>T, XM_005254706.1:c.1900C>TLikely pathogenic04/12/2017 
351CAPN3Ex22NM_000070.2:c.2306G>Ap.Arg769Gln | p.R769QNM_000070.2:c.2306G>A, NM_022473.1:c.*6378C>T, NM_024344.1:c.2288G>A, NM_173087.1:c.2030G>A, NM_173088.1:c.770G>A, NM_173089.1:c.311G>A, NM_173090.1:c.311G>A, NM_212464.2:c.*1404G>A, NM_212465.2:c.2027G>A, NM_212467.2:c.*1981G>A, NR_027911.1:n.3177G>A, NR_027912.1:n.2797G>A, XM_005254591.1:c.*6378C>T, XM_005254592.1:c.*6378C>T, XM_005254593.1:c.*6378C>T, XM_005254594.1:c.*6378C>T, XM_005254703.1:c.2306G>A, XM_005254704.1:c.2045G>A, XM_005254705.1:c.2045G>A, XM_005254706.1:c.1901G>APathogenic09/14/2018 
352CAPN3Ex22NM_000070.2:c.2310C>Tp.Tyr770= | p.Y770=NM_000070.2:c.2310C>T, NM_022473.1:c.*6374G>A, NM_024344.1:c.2292C>T, NM_173087.1:c.2034C>T, NM_173088.1:c.774C>T, NM_173089.1:c.315C>T, NM_173090.1:c.315C>T, NM_212464.2:c.*1408C>T, NM_212465.2:c.2031C>T, NM_212467.2:c.*1985C>T, NR_027911.1:n.3181C>T, NR_027912.1:n.2801C>T, XM_005254591.1:c.*6374G>A, XM_005254592.1:c.*6374G>A, XM_005254593.1:c.*6374G>A, XM_005254594.1:c.*6374G>A, XM_005254703.1:c.2310C>T, XM_005254704.1:c.2049C>T, XM_005254705.1:c.2049C>T, XM_005254706.1:c.1905C>TVOUS08/18/2015
353CAPN3Ex22NM_000070.2:c.2311G>Ap.Ala771Thr | p.A771TNM_000070.2:c.2311G>A, NM_022473.1:c.*6373C>T, NM_024344.1:c.2293G>A, NM_173087.1:c.2035G>A, NM_173088.1:c.775G>A, NM_173089.1:c.316G>A, NM_173090.1:c.316G>A, NM_212464.2:c.*1409G>A, NM_212465.2:c.2032G>A, NM_212467.2:c.*1986G>A, NR_027911.1:n.3182G>A, NR_027912.1:n.2802G>A, XM_005254591.1:c.*6373C>T, XM_005254592.1:c.*6373C>T, XM_005254593.1:c.*6373C>T, XM_005254594.1:c.*6373C>T, XM_005254703.1:c.2311G>A, XM_005254704.1:c.2050G>A, XM_005254705.1:c.2050G>A, XM_005254706.1:c.1906G>AVOUS01/23/2016
354CAPN3Ex22NM_000070.2:c.2329A>Gp.Ile777Val | p.I777VLRG_849t1:c.2329A>G, NM_000070.2:c.2329A>G, NM_022473.1:c.*6355T>C, NM_024344.1:c.2311A>G, NM_173087.1:c.2053A>G, NM_173088.1:c.793A>G, NM_173089.1:c.334A>G, NM_173090.1:c.334A>G, NM_212464.2:c.*1427A>G, NM_212465.2:c.2050A>G, NM_212467.2:c.*2004A>G, NR_027911.1:n.3200A>G, NR_027912.1:n.2820A>G, XM_005254591.1:c.*6355T>C, XM_005254592.1:c.*6355T>C, XM_005254593.1:c.*6355T>C, XM_005254594.1:c.*6355T>C, XM_005254703.1:c.2329A>G, XM_005254704.1:c.2068A>G, XM_005254705.1:c.2068A>G, XM_005254706.1:c.1924A>GVOUS04/25/2018
355CAPN3Ex22NM_000070.2:c.2331C>Tp.Ile777= | p.I777=LRG_849t1:c.2331C>T, NM_000070.2:c.2331C>T, NM_022473.1:c.*6353G>A, NM_024344.1:c.2313C>T, NM_173087.1:c.2055C>T, NM_173088.1:c.795C>T, NM_173089.1:c.336C>T, NM_173090.1:c.336C>T, NM_212464.2:c.*1429C>T, NM_212465.2:c.2052C>T, NM_212467.2:c.*2006C>T, NR_027911.1:n.3202C>T, NR_027912.1:n.2822C>T, XM_005254591.1:c.*6353G>A, XM_005254592.1:c.*6353G>A, XM_005254593.1:c.*6353G>A, XM_005254594.1:c.*6353G>A, XM_005254703.1:c.2331C>T, XM_005254704.1:c.2070C>T, XM_005254705.1:c.2070C>T, XM_005254706.1:c.1926C>TVOUS06/07/2016
356CAPN3Ex22NM_000070.2:c.2332G>Ap.Asp778Asn | p.D778NNM_000070.2:c.2332G>A, NM_022473.1:c.*6352C>T, NM_024344.1:c.2314G>A, NM_173087.1:c.2056G>A, NM_173088.1:c.796G>A, NM_173089.1:c.337G>A, NM_173090.1:c.337G>A, NM_212464.2:c.*1430G>A, NM_212465.2:c.2053G>A, NM_212467.2:c.*2007G>A, NR_027911.1:n.3203G>A, NR_027912.1:n.2823G>ABenign08/23/2012 
357CAPN3Ex22NM_000070.2:c.2338G>Cp.Asp780His | p.D780HNM_000070.2:c.2338G>CPathogenic09/02/2016 
358CAPN3Ex22NM_000070.2:c.2348T>Gp.Ile783Ser | p.I783SLRG_849t1:c.2348T>G, NM_000070.2:c.2348T>G, NM_022473.1:c.*6336A>C, NM_024344.1:c.2330T>G, NM_173087.1:c.2072T>G, NM_173088.1:c.812T>G, NM_173089.1:c.353T>G, NM_173090.1:c.353T>G, NM_212464.2:c.*1446T>G, NM_212465.2:c.2069T>G, NM_212467.2:c.*2023T>G, NR_027911.1:n.3219T>G, NR_027912.1:n.2839T>G, XM_005254591.1:c.*6336A>C, XM_005254592.1:c.*6336A>C, XM_005254593.1:c.*6336A>C, XM_005254594.1:c.*6336A>C, XM_005254703.1:c.2348T>G, XM_005254704.1:c.2087T>G, XM_005254705.1:c.2087T>G, XM_005254706.1:c.1943T>GVOUS10/03/2016
359CAPN3Ex22NM_000070.2:c.2359G>Ap.Val787Ile | p.V787ILRG_849t1:c.2359G>A, NM_000070.2:c.2359G>A, NM_022473.1:c.*6325C>T, NM_024344.1:c.2341G>A, NM_173087.1:c.2083G>A, NM_173088.1:c.823G>A, NM_173089.1:c.364G>A, NM_173090.1:c.364G>A, NM_212464.2:c.*1457G>A, NM_212465.2:c.2080G>A, NM_212467.2:c.*2034G>A, NR_027911.1:n.3230G>A, NR_027912.1:n.2850G>A, XM_005254591.1:c.*6325C>T, XM_005254592.1:c.*6325C>T, XM_005254593.1:c.*6325C>T, XM_005254594.1:c.*6325C>T, XM_005254703.1:c.2359G>A, XM_005254704.1:c.2098G>A, XM_005254705.1:c.2098G>A, XM_005254706.1:c.1954G>AVOUS11/16/2017
360CAPN3Ex22NM_000070.2:c.2361_2362insTCp.Arg788Serfs*96 | p.R788SfsX96NM_000070.2:c.2361_2362insTC, NM_022473.1:c.*6322_*6323insGA, NM_024344.1:c.2343_2344insTC, NM_173087.1:c.2085_2086insTC, NM_173088.1:c.825_826insTC, NM_173089.1:c.366_367insTC, NM_173090.1:c.366_367insTC, NM_212464.2:c.*1459_*1460insTC, NM_212465.2:c.2082_2083insTC, NM_212467.2:c.*2036_*2037insTC, NR_027911.1:n.3232_3233insTC, NR_027912.1:n.2852_2853insTC, XM_005254591.1:c.*6322_*6323insGA, XM_005254592.1:c.*6322_*6323insGA, XM_005254593.1:c.*6322_*6323insGA, XM_005254594.1:c.*6322_*6323insGA, XM_005254703.1:c.2361_2362insTC, XM_005254704.1:c.2100_2101insTC, XM_005254705.1:c.2100_2101insTC, XM_005254706.1:c.1956_1957insTCPathogenic10/24/2016 
361CAPN3Ex22NM_000070.2:c.2362_2363insTCp.Arg788Ilefs*96 | p.R788IfsX96NM_000070.2:c.2362_2363insTC, NM_022473.1:c.*6321_*6322insGA, NM_024344.1:c.2344_2345insTC, NM_173087.1:c.2086_2087insTC, NM_173088.1:c.826_827insTC, NM_173089.1:c.367_368insTC, NM_173090.1:c.367_368insTC, NM_212464.2:c.*1460_*1461insTC, NM_212465.2:c.2083_2084insTC, NM_212467.2:c.*2037_*2038insTC, NR_027911.1:n.3233_3234insTC, NR_027912.1:n.2853_2854insTC, XM_005254591.1:c.*6321_*6322insGA, XM_005254592.1:c.*6321_*6322insGA, XM_005254593.1:c.*6321_*6322insGA, XM_005254594.1:c.*6321_*6322insGA, XM_005254703.1:c.2362_2363insTC, XM_005254704.1:c.2101_2102insTC, XM_005254705.1:c.2101_2102insTC, XM_005254706.1:c.1957_1958insTCPathogenic10/24/2016 
362CAPN3Ex22NM_000070.2:c.2362_2363delAGinsTCATCTp.Arg788Serfs*14 | p.R788SfsX14LRG_849t1:c.2362_2363delinsTCATCT, NM_000070.2:c.2362_2363delinsTCATCT, NM_022473.1:c.*6321_*6322delinsAGATGA, NM_024344.1:c.2344_2345delinsTCATCT, NM_173087.1:c.2086_2087delinsTCATCT, NM_173088.1:c.826_827delinsTCATCT, NM_173089.1:c.367_368delinsTCATCT, NM_173090.1:c.367_368delinsTCATCT, NM_212464.2:c.*1460_*1461delinsTCATCT, NM_212465.2:c.2083_2084delinsTCATCT, NM_212467.2:c.*2037_*2038delinsTCATCT, NR_027911.1:n.3233_3234delinsTCATCT, NR_027912.1:n.2853_2854delinsTCATCT, XM_005254591.1:c.*6321_*6322delinsAGATGA, XM_005254592.1:c.*6321_*6322delinsAGATGA, XM_005254593.1:c.*6321_*6322delinsAGATGA, XM_005254594.1:c.*6321_*6322delinsAGATGA, XM_005254703.1:c.2362_2363delinsTCATCT, XM_005254704.1:c.2101_2102delinsTCATCT, XM_005254705.1:c.2101_2102delinsTCATCT, XM_005254706.1:c.1957_1958delinsTCATCTPathogenic11/09/2018 
363CAPN3Ex22NM_000070.2:c.2363G>Tp.Arg788Met | p.R788MNM_000070.2:c.2363G>T, NM_022473.1:c.*6321C>A, NM_024344.1:c.2345G>T, NM_173087.1:c.2087G>T, NM_173088.1:c.827G>T, NM_173089.1:c.368G>T, NM_173090.1:c.368G>T, NM_212464.2:c.*1461G>T, NM_212465.2:c.2084G>T, NM_212467.2:c.*2038G>T, NR_027911.1:n.3234G>T, NR_027912.1:n.2854G>T, XM_005254591.1:c.*6321C>A, XM_005254592.1:c.*6321C>A, XM_005254593.1:c.*6321C>A, XM_005254594.1:c.*6321C>A, XM_005254703.1:c.2363G>T, XM_005254704.1:c.2102G>T, XM_005254705.1:c.2102G>T, XM_005254706.1:c.1958G>TVOUS07/10/2015
364CAPN3Ex22NM_000070.2:c.2363delGinsTCTp.Arg788Ilefs*96 | p.R788IfsX96LRG_849t1:c.2363delinsTCT, NM_000070.2:c.2363delinsTCT, NM_022473.1:c.*6321delinsAGA, NM_024344.1:c.2345delinsTCT, NM_173087.1:c.2087delinsTCT, NM_173088.1:c.827delinsTCT, NM_173089.1:c.368delinsTCT, NM_173090.1:c.368delinsTCT, NM_212464.2:c.*1461delinsTCT, NM_212465.2:c.2084delinsTCT, NM_212467.2:c.*2038delinsTCT, NR_027911.1:n.3234delinsTCT, NR_027912.1:n.2854delinsTCT, XM_005254591.1:c.*6321delinsAGA, XM_005254592.1:c.*6321delinsAGA, XM_005254593.1:c.*6321delinsAGA, XM_005254594.1:c.*6321delinsAGA, XM_005254703.1:c.2363delinsTCT, XM_005254704.1:c.2102delinsTCT, XM_005254705.1:c.2102delinsTCT, XM_005254706.1:c.1958delinsTCTPathogenic10/25/2016 
365CAPN3Ex22NM_000070.2:c.2380+12delANM_000070.2:c.2380+12delA, NM_022473.1:c.*6292delT, NM_024344.1:c.2362+12delA, NM_173087.1:c.2104+12delA, NM_173088.1:c.844+12delA, NM_173089.1:c.385+12delA, NM_173090.1:c.385+12delA, NM_212464.2:c.*1478+12delA, NM_212465.2:c.2101+12delA, NM_212467.2:c.*2055+12delA, NR_027911.1:n.3251+12delA, NR_027912.1:n.2871+12delA, XM_005254591.1:c.*6292delT, XM_005254592.1:c.*6292delT, XM_005254593.1:c.*6292delT, XM_005254594.1:c.*6292delT, XM_005254703.1:c.2380+12delA, XM_005254704.1:c.2119+12delA, XM_005254705.1:c.2119+12delA, XM_005254706.1:c.1975+12delABenign03/11/2014 
366CAPN3Ex22NM_000070.2:c.2380+19C>TLRG_849t1:c.2380+19C>T, NM_000070.2:c.2380+19C>T, NM_022473.1:c.*6285G>A, NM_024344.1:c.2362+19C>T, NM_173087.1:c.2104+19C>T, NM_173088.1:c.844+19C>T, NM_173089.1:c.385+19C>T, NM_173090.1:c.385+19C>T, NM_212464.2:c.*1478+19C>T, NM_212465.2:c.2101+19C>T, NM_212467.2:c.*2055+19C>T, NR_027911.1:n.3251+19C>T, NR_027912.1:n.2871+19C>T, XM_005254591.1:c.*6285G>A, XM_005254592.1:c.*6285G>A, XM_005254593.1:c.*6285G>A, XM_005254594.1:c.*6285G>A, XM_005254703.1:c.2380+19C>T, XM_005254704.1:c.2119+19C>T, XM_005254705.1:c.2119+19C>T, XM_005254706.1:c.1975+19C>TVOUS03/16/2018
367CAPN3Ex23NM_000070.2:c.2381-17T>GNM_000070.2:c.2381-17T>G, NM_022473.1:c.*6034A>C, NM_024344.1:c.2363-17T>G, NM_173087.1:c.2105-17T>G, NM_173088.1:c.845-17T>G, NM_173089.1:c.386-17T>G, NM_173090.1:c.386-17T>G, NM_212464.2:c.*1479-17T>G, NM_212465.2:c.2102-17T>G, NM_212467.2:c.*2056-17T>G, NR_027911.1:n.3252-17T>G, NR_027912.1:n.2872-17T>GVOUS05/09/2014
368CAPN3Ex23NM_000070.2:c.2384C>Gp.Ala795Gly | p.A795GNM_000070.2:c.2384C>G, NM_022473.1:c.*6014G>C, NM_024344.1:c.2366C>G, NM_173087.1:c.2108C>G, NM_173088.1:c.848C>G, NM_173089.1:c.389C>G, NM_173090.1:c.389C>G, NM_212464.2:c.*1482C>G, NM_212465.2:c.2105C>G, NM_212467.2:c.*2059C>G, NR_027911.1:n.3255C>G, NR_027912.1:n.2875C>G, XM_005254591.1:c.*6014G>C, XM_005254592.1:c.*6014G>C, XM_005254593.1:c.*6014G>C, XM_005254594.1:c.*6014G>C, XM_005254703.1:c.2384C>G, XM_005254704.1:c.2123C>G, XM_005254705.1:c.2123C>G, XM_005254706.1:c.1979C>GVOUS01/22/2016
369CAPN3Ex23NM_000070.2:c.2393C>Ap.Ala798Glu | p.A798ENM_000070.2:c.2393C>A, NM_022473.1:c.*6005G>T, NM_024344.1:c.2375C>A, NM_173087.1:c.2117C>A, NM_173088.1:c.857C>A, NM_173089.1:c.398C>A, NM_173090.1:c.398C>A, NM_212464.2:c.*1491C>A, NM_212465.2:c.2114C>A, NM_212467.2:c.*2068C>A, NR_027911.1:n.3264C>A, NR_027912.1:n.2884C>APathogenic09/14/2018 
370CAPN3Ex23NM_000070.2:c.2409A>Tp.Gly803= | p.G803=NM_000070.2:c.2409A>T, NM_022473.1:c.*5989T>A, NM_024344.1:c.2391A>T, NM_173087.1:c.2133A>T, NM_173088.1:c.873A>T, NM_173089.1:c.414A>T, NM_173090.1:c.414A>T, NM_212464.2:c.*1507A>T, NM_212465.2:c.2130A>T, NM_212467.2:c.*2084A>T, NR_027911.1:n.3280A>T, NR_027912.1:n.2900A>T, XM_005254591.1:c.*5989T>A, XM_005254592.1:c.*5989T>A, XM_005254593.1:c.*5989T>A, XM_005254594.1:c.*5989T>A, XM_005254703.1:c.2409A>T, XM_005254704.1:c.2148A>T, XM_005254705.1:c.2148A>T, XM_005254706.1:c.2004A>TVOUS04/01/2015
371CAPN3Ex23NM_000070.2:c.2409A>Gp.Gly803= | p.G803=LRG_849t1:c.2409A>G, NM_000070.2:c.2409A>G, NM_022473.1:c.*5989T>C, NM_024344.1:c.2391A>G, NM_173087.1:c.2133A>G, NM_173088.1:c.873A>G, NM_173089.1:c.414A>G, NM_173090.1:c.414A>G, NM_212464.2:c.*1507A>G, NM_212465.2:c.2130A>G, NM_212467.2:c.*2084A>G, NR_027911.1:n.3280A>G, NR_027912.1:n.2900A>G, XM_005254591.1:c.*5989T>C, XM_005254592.1:c.*5989T>C, XM_005254593.1:c.*5989T>C, XM_005254594.1:c.*5989T>C, XM_005254703.1:c.2409A>G, XM_005254704.1:c.2148A>G, XM_005254705.1:c.2148A>G, XM_005254706.1:c.2004A>GVOUS07/27/2016
372CAPN3Ex23NM_000070.2:c.2429A>Gp.Asn810Ser | p.N810SNM_000070.2:c.2429A>G, NM_022473.1:c.*5969T>C, NM_024344.1:c.2411A>G, NM_173087.1:c.2153A>G, NM_173088.1:c.893A>G, NM_173089.1:c.434A>G, NM_173090.1:c.434A>G, NM_212464.2:c.*1527A>G, NM_212465.2:c.2150A>G, NM_212467.2:c.*2104A>G, NR_027911.1:n.3300A>G, NR_027912.1:n.2920A>G, XM_005254591.1:c.*5969T>C, XM_005254592.1:c.*5969T>C, XM_005254593.1:c.*5969T>C, XM_005254594.1:c.*5969T>C, XM_005254703.1:c.2429A>G, XM_005254704.1:c.2168A>G, XM_005254705.1:c.2168A>G, XM_005254706.1:c.2024A>GVOUS10/07/2015
373CAPN3Ex23NM_000070.2:c.2431G>Ap.Val811Ile | p.V811ILRG_849t1:c.2431G>A, NM_000070.2:c.2431G>A, NM_022473.1:c.*5967C>T, NM_024344.1:c.2413G>A, NM_173087.1:c.2155G>A, NM_173088.1:c.895G>A, NM_173089.1:c.436G>A, NM_173090.1:c.436G>A, NM_212464.2:c.*1529G>A, NM_212465.2:c.2152G>A, NM_212467.2:c.*2106G>A, NR_027911.1:n.3302G>A, NR_027912.1:n.2922G>A, XM_005254591.1:c.*5967C>T, XM_005254592.1:c.*5967C>T, XM_005254593.1:c.*5967C>T, XM_005254594.1:c.*5967C>T, XM_005254703.1:c.2431G>A, XM_005254704.1:c.2170G>A, XM_005254705.1:c.2170G>A, XM_005254706.1:c.2026G>AVOUS09/13/2016
374CAPN3Ex23NM_000070.2:c.2433T>Cp.Val811= | p.V811=Benign03/14/2014 
375CAPN3Ex24NM_000070.2:c.*134C>TLRG_849t1:c.*134C>T, NM_000070.2:c.*134C>T, NM_022473.1:c.*5397G>A, NM_024344.1:c.*134C>T, NM_173087.1:c.*134C>T, NM_173088.1:c.*134C>T, NM_173089.1:c.*134C>T, NM_173090.1:c.*134C>T, NM_212464.2:c.*1698C>T, NM_212465.2:c.*134C>T, NM_212467.2:c.*2275C>T, NR_027911.1:n.3471C>T, NR_027912.1:n.3091C>T, XM_005254591.1:c.*5397G>A, XM_005254592.1:c.*5397G>A, XM_005254593.1:c.*5397G>A, XM_005254594.1:c.*5397G>A, XM_005254703.1:c.2440-179C>T, XM_005254704.1:c.2179-179C>T, XM_005254705.1:c.*134C>T, XM_005254706.1:c.*134C>TBenign04/12/2016 
376CAPN3Ex24NM_000070.2:c.2440-46G>TBenign** 
377CAPN3Ex24NM_000070.2:c.2440-3C>GNM_000070.2:c.2440-3C>G, NM_022473.1:c.*5560G>C, NM_024344.1:c.2422-3C>G, NM_173087.1:c.2164-3C>G, NM_173088.1:c.904-3C>G, NM_173089.1:c.445-3C>G, NM_173090.1:c.445-3C>G, NM_212464.2:c.*1538-3C>G, NM_212465.2:c.2161-3C>G, NM_212467.2:c.*2115-3C>G, NR_027911.1:n.3311-3C>G, NR_027912.1:n.2931-3C>G, XM_005254591.1:c.*5560G>C, XM_005254592.1:c.*5560G>C, XM_005254593.1:c.*5560G>C, XM_005254594.1:c.*5560G>C, XM_005254703.1:c.2440-342C>G, XM_005254704.1:c.2179-342C>G, XM_005254705.1:c.2179-3C>G, XM_005254706.1:c.2035-3C>GLikely pathogenic10/04/2017 
378CAPN3Ex24NM_000070.2:c.2440-1G>ALRG_849t1:c.2440-1G>A, NM_000070.2:c.2440-1G>A, NM_022473.1:c.*5558C>T, NM_024344.1:c.2422-1G>A, NM_173087.1:c.2164-1G>A, NM_173088.1:c.904-1G>A, NM_173089.1:c.445-1G>A, NM_173090.1:c.445-1G>A, NM_212464.2:c.*1538-1G>A, NM_212465.2:c.2161-1G>A, NM_212467.2:c.*2115-1G>A, NR_027911.1:n.3311-1G>A, NR_027912.1:n.2931-1G>A, XM_005254591.1:c.*5558C>T, XM_005254592.1:c.*5558C>T, XM_005254593.1:c.*5558C>T, XM_005254594.1:c.*5558C>T, XM_005254703.1:c.2440-340G>A, XM_005254704.1:c.2179-340G>A, XM_005254705.1:c.2179-1G>A, XM_005254706.1:c.2035-1G>APathogenic05/12/2017 
379CAPN3Ex24NM_000070.2:c.2462C>Tp.Ala821Val | p.A821VNM_000070.2:c.2462C>T, NM_022473.1:c.*5535G>A, NM_024344.1:c.2444C>T, NM_173087.1:c.2186C>T, NM_173088.1:c.926C>T, NM_173089.1:c.467C>T, NM_173090.1:c.467C>T, NM_212464.2:c.*1560C>T, NM_212465.2:c.2183C>T, NM_212467.2:c.*2137C>T, NR_027911.1:n.3333C>T, NR_027912.1:n.2953C>TVOUS09/13/2013

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.