Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1ADAEx4NM_000022.2:c.320T>Cp.Leu107Pro | p.L107PLRG_16t1:c.320T>C, NM_000022.2:c.320T>C, XM_005260236.1:c.320T>C, XM_005260237.1:c.320T>C, XM_005260238.1:c.31T>C, XR_244129.1:n.374T>CPathogenic01/20/2017 
2ADAEx8NM_000022.2:c.704G>Ap.Arg235Gln | p.R235QLRG_16t1:c.704G>A, NM_000022.2:c.704G>A, NM_001281444.1:c.*4541C>T, NM_001281445.1:c.*4541C>T, NM_007066.3:c.*4541C>T, NM_007066.4:c.*4541C>T, NM_181804.1:c.*4541C>T, NM_181804.2:c.*4541C>T, NM_181805.1:c.*4541C>T, NM_181805.2:c.*4541C>T, XM_005260236.1:c.632G>A, XM_005260237.1:c.780G>A, XM_005260238.1:c.299G>A, XR_244129.1:n.758G>APathogenic10/11/2018 
3ADAEx10NM_000022.2:c.956_960delAAGAGNM_000022.2:c.956_960delAAGAG, NM_001281444.1:c.*2669_*2673delCTCTT, NM_001281445.1:c.*2669_*2673delCTCTT, NM_007066.3:c.*2669_*2673delCTCTT, NM_007066.4:c.*2669_*2673delCTCTT, NM_181804.1:c.*2669_*2673delCTCTT, NM_181804.2:c.*2669_*2673delCTCTT, NM_181805.1:c.*2669_*2673delCTCTT, NM_181805.2:c.*2669_*2673delCTCTT, XM_005260236.1:c.884_888delAAGAG, XM_005260237.1:c.*142_*146delAAGAG, XM_005260238.1:c.551_555delAAGAG, XR_244129.1:n.945_949delAAGAGPathogenic09/24/2014 
4ADAEx4NM_000022.3:c.362+4A>GLRG_16t1:c.362+4A>G, NM_000022.2:c.362+4A>G, XM_005260236.1:c.362+4A>G, XM_005260237.1:c.362+4A>G, XM_005260238.1:c.73+4A>G, XR_244129.1:n.416+4A>GVOUS04/11/2019
5ADA2Ex2NM_017424.2:c.506G>Ap.Arg169Gln | p.R169QNM_017424.2:c.506G>A, XM_005261245.1:c.506G>A, XM_005261246.1:c.506G>A, XM_005261247.1:c.380G>APathogenic12/04/2020 
6ADAM22Ex9NM_021723.4:c.709_711dupGAAp.Glu237dup | p.E237dupNM_004194.2:c.709_711dupGAA, NM_004194.3:c.709_711dupGAA, NM_016351.3:c.709_711dupGAA, NM_016351.4:c.709_711dupGAA, NM_021721.2:c.709_711dupGAA, NM_021721.3:c.709_711dupGAA, NM_021722.2:c.709_711dupGAA, NM_021722.3:c.709_711dupGAA, NM_021722.4:c.709_711dupGAA, NM_021723.2:c.709_711dupGAA, NM_021723.3:c.709_711dupGAA, XM_005250444.1:c.865_867dupGAA, XM_005250445.1:c.865_867dupGAAVOUS04/16/2019
7ADAM9Ex1NM_003816.2:c.78C>Ap.Val26= | p.V26=NM_001005845.1:c.78C>A, NM_001024380.1:c.-1014G>T, NM_001024381.1:c.-913G>T, NM_003816.2:c.78C>A, NM_031940.3:c.-1220G>T, NM_078473.2:c.-702G>T, NR_027638.1:n.156C>A, NR_027639.1:n.156C>A, NR_027878.1:n.156C>A, XM_002342831.1:c.*771C>A, XM_005273657.1:c.-1119G>T, XM_005273658.1:c.-739G>TBenign10/25/2016 
8ADAM9Ex3NM_003816.2:c.226G>Ap.Glu76Lys | p.E76KNM_001005845.1:c.226G>A, NM_003816.2:c.226G>A, NR_027638.1:n.304G>A, NR_027639.1:n.304G>A, NR_027878.1:n.304G>ALikely benign10/21/2014 
9ADAM9Ex4NM_003816.2:c.280G>Ap.Val94Ile | p.V94INM_001005845.1:c.280G>A, NM_003816.2:c.280G>A, NR_027638.1:n.358G>A, NR_027639.1:n.358G>A, NR_027878.1:n.358G>ALikely benign11/21/2016 
10ADAM9Ex4NM_003816.2:c.299A>Tp.Glu100Val | p.E100VNM_001005845.1:c.299A>T, NM_003816.2:c.299A>T, NR_027638.1:n.377A>T, NR_027639.1:n.377A>T, NR_027878.1:n.377A>TVOUS12/29/2016
11ADAM9Ex6NM_003816.2:c.540G>Ap.Lys180= | p.K180=NM_001005845.1:c.540G>A, NM_003816.2:c.540G>A, NR_027638.1:n.618G>A, NR_027639.1:n.618G>A, NR_027878.1:n.618G>AVOUS02/06/2017
12ADAM9Ex11NM_003816.2:c.1074T>Cp.Asp358= | p.D358=NM_001005845.1:c.1074T>C, NM_003816.2:c.1074T>C, NR_027638.1:n.1152T>C, NR_027639.1:n.1152T>C, NR_027878.1:n.1152T>CVOUS04/24/2015
13ADAM9Ex17NM_003816.2:c.1882-5_1882-4dupTTNM_001005845.1:c.1882-4_1882-3insTT, NM_003816.2:c.1882-4_1882-3insTT, NR_027638.1:n.1960-4_1960-3insTT, NR_027639.1:n.1959+5226_1959+5227insTT, NR_027878.1:n.1960-4_1960-3insTTLikely benign12/19/2016 
14ADAM9Ex17NM_003816.2:c.1893C>Gp.Asn631Lys | p.N631KNM_001005845.1:c.1893C>G, NM_003816.2:c.1893C>G, NR_027638.1:n.1971C>G, NR_027639.1:n.1959+5241C>G, NR_027878.1:n.1971C>GVOUS12/29/2015
15ADAM9Ex19NM_003816.2:c.2160G>Ap.Arg720= | p.R720=NM_001005845.1:c.*86G>A, NM_003816.2:c.2160G>A, NR_027638.1:n.2147-1121G>A, NR_027639.1:n.2051G>A, NR_027878.1:n.2132G>AVOUS12/02/2016
16ADAMTS10Ex17NM_030957.2:c.2017G>Ap.Val673Ile | p.V673INM_030957.2:c.2017G>A, XM_005272498.1:c.913G>A, XM_005272499.1:c.586G>A, XM_005272500.1:c.580G>A, XM_005272501.1:c.478G>AVOUS01/09/2017
17ADAMTS10Ex25NM_030957.2:c.3193G>Ap.Gly1065Ser | p.G1065SNM_030957.2:c.3193G>A, XM_005272498.1:c.2089G>A, XM_005272499.1:c.1762G>A, XM_005272500.1:c.1756G>A, XM_005272501.1:c.1654G>ABenign10/01/2015 
18ADAMTS10Ex26NM_030957.2:c.3262A>Gp.Ser1088Gly | p.S1088GNM_012335.2:c.-3634A>G, NM_012335.3:c.-3634A>G, NM_030957.2:c.3262A>G, XM_005272475.1:c.-3634A>G, XM_005272476.1:c.-3634A>G, XM_005272477.1:c.-3634A>G, XM_005272498.1:c.2158A>G, XM_005272499.1:c.1831A>G, XM_005272500.1:c.1825A>G, XM_005272501.1:c.1723A>GVOUS12/07/2017
19ADAMTS10Ex19NM_030957.3:c.2194G>Ap.Val732Ile | p.V732INM_030957.2:c.2194G>A, XM_005272498.1:c.1090G>A, XM_005272499.1:c.763G>A, XM_005272500.1:c.757G>A, XM_005272501.1:c.655G>AVOUS08/13/2019
20ADAMTS13Ex7NM_139025.4:c.702C>Ap.His234Gln | p.H234QLRG_544t1:c.702C>A, NM_139025.3:c.702C>A, NM_139025.4:c.702C>A, NM_139026.3:c.702C>A, NM_139026.4:c.702C>A, NM_139027.3:c.702C>A, NM_139027.4:c.702C>A, NR_024514.1:n.887+2304C>A, NR_024514.2:n.887+2304C>ALikely pathogenic12/02/2019 
21ADAMTS13Ex12NM_139025.4:c.1370C>Tp.Pro457Leu | p.P457LLRG_544t1:c.1370C>T, NM_139025.3:c.1370C>T, NM_139025.4:c.1370C>T, NM_139026.3:c.1277C>T, NM_139026.4:c.1277C>T, NM_139027.3:c.1370C>T, NM_139027.4:c.1370C>T, NR_024514.1:n.993-2477C>T, NR_024514.2:n.993-2477C>TVOUS12/20/2019
22ADAMTS13Ex16NM_139025.4:c.1841A>Cp.Asn614Thr | p.N614TLRG_544t1:c.1841A>C, NM_139025.3:c.1841A>C, NM_139025.4:c.1841A>C, NM_139026.3:c.1748A>C, NM_139026.4:c.1748A>C, NM_139027.3:c.1841A>C, NM_139027.4:c.1841A>C, NR_024514.1:n.1128A>C, NR_024514.2:n.1128A>CVOUS10/19/2016
23ADAMTS13Ex19NM_139025.4:c.2308G>Ap.Val770Met | p.V770MLRG_544t1:c.2308G>A, NM_139025.3:c.2308G>A, NM_139025.4:c.2308G>A, NM_139026.3:c.2215G>A, NM_139026.4:c.2215G>A, NM_139027.3:c.2308G>A, NM_139027.4:c.2308G>A, NR_024514.1:n.1256-1414G>A, NR_024514.2:n.1256-1414G>AVOUS08/20/2019
24ADAMTS17Ex18NM_139057.2:c.2501C>Gp.Thr834Ser | p.T834SNM_139057.2:c.2501C>G, XM_005254872.1:c.2582C>GVOUS10/10/2016
25ADAMTS17Ex19NM_139057.2:c.2726G>Ap.Arg909Gln | p.R909QNM_139057.2:c.2726G>A, XM_005254872.1:c.2807G>AVOUS12/07/2016
26ADAMTS18Ex3NM_199355.2:c.438G>Cp.Gln146His | p.Q146HNM_199355.2:c.438G>CVOUS09/25/2018
27ADAMTS2Ex1NM_014244.4:c.68_70dupTGCp.Leu23dup | p.L23dupNM_014244.2:c.68_70dupTGC, NM_014244.2:c.70_71insTGC, NM_014244.4:c.68_70dupTGC, NM_014244.4:c.70_71insTGC, NM_021599.1:c.68_70dupTGC, NM_021599.1:c.70_71insTGC, NM_021599.2:c.68_70dupTGC, NM_021599.2:c.70_71insTGCBenign10/17/2017 
28ADAMTS2Ex1NM_014244.4:c.68T>Cp.Leu23Pro | p.L23PNM_014244.2:c.68T>C, NM_014244.4:c.68T>C, NM_021599.1:c.68T>C, NM_021599.2:c.68T>CBenign06/06/2018 
29ADAMTS2Ex1NM_014244.4:c.80_88dupTCCTGCCGCp.Leu27_Pro29dup | p.L27_P29dupNM_014244.2:c.80_88dupTCCTGCCGC, NM_014244.4:c.80_88dupTCCTGCCGC, NM_021599.1:c.80_88dupTCCTGCCGC, NM_021599.2:c.80_88dupTCCTGCCGCLikely benign08/07/2018 
30ADAMTS2Ex1NM_014244.4:c.94C>Tp.Pro32Ser | p.P32SNM_014244.2:c.94C>T, NM_014244.4:c.94C>T, NM_021599.1:c.94C>T, NM_021599.2:c.94C>TVOUS09/12/2016
31ADAMTS2Ex2NM_014244.4:c.260G>Tp.Arg87Leu | p.R87LNM_014244.2:c.260G>T, NM_014244.4:c.260G>T, NM_021599.1:c.260G>T, NM_021599.2:c.260G>TVOUS10/10/2017
32ADAMTS2Ex3NM_014244.4:c.640C>Tp.Arg214Trp | p.R214WNM_014244.2:c.640C>T, NM_014244.4:c.640C>T, NM_021599.1:c.640C>T, NM_021599.2:c.640C>TVOUS03/03/2016
33ADAMTS2Ex4NM_014244.4:c.748G>Ap.Ala250Thr | p.A250TNM_014244.2:c.748G>A, NM_014244.4:c.748G>A, NM_021599.1:c.748G>A, NM_021599.2:c.748G>AVOUS01/21/2020
34ADAMTS2Ex6NM_014244.4:c.1122C>Tp.Ser374= | p.S374=NM_014244.2:c.1122C>T, NM_014244.4:c.1122C>T, NM_021599.1:c.1122C>T, NM_021599.2:c.1122C>TVOUS05/22/2015
35ADAMTS2Ex7NM_014244.4:c.1194C>Tp.Asp398= | p.D398=NM_014244.2:c.1194C>T, NM_014244.4:c.1194C>T, NM_021599.1:c.1194C>T, NM_021599.2:c.1194C>TBenign05/27/2016 
36ADAMTS2Ex7NM_014244.4:c.1238+18G>ANM_014244.2:c.1238+18G>A, NM_014244.4:c.1238+18G>A, NM_021599.1:c.1238+18G>A, NM_021599.2:c.1238+18G>ABenign05/27/2016 
37ADAMTS2Ex8NM_014244.4:c.1281C>Tp.Asp427= | p.D427=NM_014244.2:c.1281C>T, NM_014244.4:c.1281C>T, NM_021599.1:c.1281C>T, NM_021599.2:c.1281C>TBenign05/22/2015 
38ADAMTS2Ex8NM_014244.4:c.1308G>Ap.Ala436= | p.A436=NM_014244.2:c.1308G>A, NM_014244.4:c.1308G>A, NM_021599.1:c.1308G>A, NM_021599.2:c.1308G>ABenign01/17/2017 
39ADAMTS2Ex9NM_014244.4:c.1488C>Tp.Phe496= | p.F496=NM_014244.2:c.1488C>T, NM_014244.4:c.1488C>T, NM_021599.1:c.1488C>T, NM_021599.2:c.1488C>TLikely benign01/21/2020 
40ADAMTS2Ex10NM_014244.4:c.1629+9G>ANM_014244.2:c.1629+9G>A, NM_014244.4:c.1629+9G>A, NM_021599.1:c.1629+9G>A, NM_021599.2:c.1629+9G>ABenign07/15/2015 
41ADAMTS2Ex12NM_014244.4:c.1869C>Tp.Arg623= | p.R623=NM_014244.2:c.1869C>T, NM_014244.4:c.1869C>TVOUS08/03/2015
42ADAMTS2Ex19NM_014244.4:c.2751-4G>ANM_014244.2:c.2751-4G>A, NM_014244.4:c.2751-4G>A, XM_002342575.1:c.*2631C>TVOUS12/28/2020
43ADAMTS2Ex20NM_014244.4:c.2959-17C>TNM_014244.2:c.2959-17C>T, NM_014244.4:c.2959-17C>T, XM_002342575.1:c.*237G>ABenign02/05/2016 
44ADAMTSL2Ex10NM_014694.3:c.979G>Ap.Glu327Lys | p.E327KNM_001145320.1:c.979G>A, NM_014694.3:c.979G>A, XM_005272237.1:c.1306G>A, XM_005272238.1:c.1009G>A, XM_005272239.1:c.979G>AVOUS07/31/2019
45ADAMTSL2Ex10NM_014694.3:c.1148_1177delACCGGCTGTTCGGCCACCCGGGCCTGGACAp.Asn383_Asp392del | p.N383_D392delNM_001145320.1:c.1148_1177delACCGGCTGTTCGGCCACCCGGGCCTGGACA, NM_014694.3:c.1148_1177delACCGGCTGTTCGGCCACCCGGGCCTGGACA, XM_005272237.1:c.1475_1504delACCGGCTGTTCGGCCACCCGGGCCTGGACA, XM_005272238.1:c.1178_1207delACCGGCTGTTCGGCCACCCGGGCCTGGACA, XM_005272239.1:c.1148_1177delACCGGCTGTTCGGCCACCCGGGCCTGGACAVOUS01/19/2017
46ADAMTSL2Ex11NM_014694.3:c.1361C>Tp.Ser454Leu | p.S454LNM_001145320.1:c.1361C>T, NM_014694.3:c.1361C>T, XM_005272237.1:c.1688C>T, XM_005272238.1:c.1391C>T, XM_005272239.1:c.1361C>TVOUS09/20/2017
47ADAMTSL2Ex16NM_014694.3:c.2413C>Tp.Arg805Trp | p.R805WNM_001145320.1:c.2413C>T, NM_014694.3:c.2413C>T, XM_005272237.1:c.2740C>T, XM_005272238.1:c.2443C>T, XM_005272239.1:c.2413C>TVOUS12/13/2016
48ADAMTSL4Ex6NM_019032.4:c.767_786delAGGCCTCTGGCACAGAGCCCp.Gln256Profs*38 | p.Q256PfsX38NM_019032.4:c.767_786delAGGCCTCTGGCACAGAGCCC, NM_025008.3:c.767_786delAGGCCTCTGGCACAGAGCCC, NR_036211.1:n.*1744_*1763delAGGCCTCTGGCACAGAGCCC, XM_002342133.1:c.*1052_*1071delGGGCTCTGTGCCAGAGGCCT, XM_003846220.1:c.*2698_*2717delAGGCCTCTGGCACAGAGCCC, XM_005245269.1:c.767_786delAGGCCTCTGGCACAGAGCCC, XR_241087.1:n.1055_1074delAGGCCTCTGGCACAGAGCCC, XR_241118.1:n.485+758_485+777delGGGCTCTGTGCCAGAGGCCTPathogenic08/11/2016 
49ADAMTSL4Ex18NM_019032.4:c.2969C>Tp.Thr990Met | p.T990MNM_019032.4:c.2969C>T, NM_025008.3:c.*1062C>T, XM_002342133.1:c.95+356G>A, XM_005245269.1:c.3038C>T, XR_039834.2:n.*292G>A, XR_241087.1:n.3473C>T, XR_241118.1:n.-4767G>ABenign11/10/2017 
50ADAREx1NM_001111.4:c.15+10G>TNM_001025107.1:c.-870-5356G>T, NM_001025107.2:c.-870-5356G>T, NM_001111.3:c.15+10G>T, NM_001111.4:c.15+10G>T, NM_001193495.1:c.-2847G>T, NM_015840.2:c.15+10G>T, NM_015840.3:c.15+10G>T, NM_015841.2:c.15+10G>T, NM_015841.3:c.15+10G>TBenign05/22/2015 
51ADAREx2NM_001111.4:c.298A>Gp.Arg100Gly | p.R100GNM_001025107.1:c.-588A>G, NM_001025107.2:c.-588A>G, NM_001111.3:c.298A>G, NM_001111.4:c.298A>G, NM_001193495.1:c.-588A>G, NM_015840.2:c.298A>G, NM_015840.3:c.298A>G, NM_015841.2:c.298A>G, NM_015841.3:c.298A>GBenign02/07/2017 
52ADAREx2NM_001111.4:c.577C>Gp.Pro193Ala | p.P193ANM_001025107.1:c.-309C>G, NM_001025107.2:c.-309C>G, NM_001111.3:c.577C>G, NM_001111.4:c.577C>G, NM_001193495.1:c.-309C>G, NM_015840.2:c.577C>G, NM_015840.3:c.577C>G, NM_015841.2:c.577C>G, NM_015841.3:c.577C>GPathogenic12/18/2015 
53ADAREx2NM_001111.4:c.1151A>Gp.Lys384Arg | p.K384RNM_001025107.1:c.266A>G, NM_001025107.2:c.266A>G, NM_001111.3:c.1151A>G, NM_001111.4:c.1151A>G, NM_001193495.1:c.266A>G, NM_015840.2:c.1151A>G, NM_015840.3:c.1151A>G, NM_015841.2:c.1151A>G, NM_015841.3:c.1151A>GBenign05/21/2015 
54ADAREx3NM_001111.4:c.1666G>Cp.Val556Leu | p.V556LNM_001025107.1:c.781G>C, NM_001025107.2:c.781G>C, NM_001111.3:c.1666G>C, NM_001111.4:c.1666G>C, NM_001193495.1:c.781G>C, NM_015840.2:c.1666G>C, NM_015840.3:c.1666G>C, NM_015841.2:c.1666G>C, NM_015841.3:c.1666G>CVOUS10/24/2017
55ADAREx3NM_001111.4:c.1675C>Tp.Gln559* | p.Q559XNM_001025107.1:c.790C>T, NM_001025107.2:c.790C>T, NM_001111.3:c.1675C>T, NM_001111.4:c.1675C>T, NM_001193495.1:c.790C>T, NM_015840.2:c.1675C>T, NM_015840.3:c.1675C>T, NM_015841.2:c.1675C>T, NM_015841.3:c.1675C>TPathogenic01/24/2017 
56ADAREx3NM_001111.4:c.1760A>Gp.Tyr587Cys | p.Y587CNM_001025107.1:c.875A>G, NM_001025107.2:c.875A>G, NM_001111.3:c.1760A>G, NM_001111.4:c.1760A>G, NM_001193495.1:c.875A>G, NM_015840.2:c.1760A>G, NM_015840.3:c.1760A>G, NM_015841.2:c.1760A>G, NM_015841.3:c.1760A>GBenign05/26/2015 
57ADAREx5NM_001111.4:c.2079+8G>ANM_001025107.1:c.1194+8G>A, NM_001025107.2:c.1194+8G>A, NM_001111.3:c.2079+8G>A, NM_001111.4:c.2079+8G>A, NM_001193495.1:c.1194+8G>A, NM_015840.2:c.2079+8G>A, NM_015840.3:c.2079+8G>A, NM_015841.2:c.2079+8G>A, NM_015841.3:c.2079+8G>AVOUS02/20/2017
58ADAREx6NM_001111.4:c.2130dupCNM_001025107.1:c.1245_1246insC, NM_001025107.2:c.1245_1246insC, NM_001111.3:c.2130_2131insC, NM_001111.4:c.2130_2131insC, NM_001193495.1:c.1245_1246insC, NM_015840.2:c.2130_2131insC, NM_015840.3:c.2130_2131insC, NM_015841.2:c.2080-7_2080-6insC, NM_015841.3:c.2080-7_2080-6insCPathogenic08/09/2016 
59ADAREx7NM_001111.4:c.2496+9G>ANM_001025107.1:c.1611+9G>A, NM_001025107.2:c.1611+9G>A, NM_001111.3:c.2496+9G>A, NM_001111.4:c.2496+9G>A, NM_001193495.1:c.1611+9G>A, NM_015840.2:c.2418+87G>A, NM_015840.3:c.2418+87G>A, NM_015841.2:c.2361+87G>A, NM_015841.3:c.2361+87G>ABenign05/30/2016 
60ADAREx8NM_001111.4:c.2553C>Tp.Cys851= | p.C851=NM_001025107.1:c.1668C>T, NM_001025107.2:c.1668C>T, NM_001111.3:c.2553C>T, NM_001111.4:c.2553C>T, NM_001193495.1:c.1668C>T, NM_015840.2:c.2475C>T, NM_015840.3:c.2475C>T, NM_015841.2:c.2418C>T, NM_015841.3:c.2418C>TLikely benign12/09/2015 
61ADAT3Ex2NM_138422.2:c.16C>Tp.Arg6Cys | p.R6CNM_079834.2:c.-41-2916C>T, NM_138422.1:c.-33C>T, NM_138422.2:c.16C>T, XM_002344161.1:c.-6168G>A, XM_005259481.1:c.-41-2916C>T, XM_005259482.1:c.-41-2916C>T, XM_005259484.1:c.-15-18C>T, XR_244026.1:n.227-2916C>T, XR_244027.1:n.227-2916C>TVOUS03/24/2021
62ADAT3Ex2NM_138422.2:c.274A>Cp.Lys92Gln | p.K92QNM_079834.2:c.-41-2658A>C, NM_138422.1:c.226A>C, NM_138422.2:c.274A>C, XM_005259481.1:c.-41-2658A>C, XM_005259482.1:c.-41-2658A>C, XM_005259484.1:c.226A>C, XR_244026.1:n.227-2658A>C, XR_244027.1:n.227-2658A>CVOUS04/14/2017
63ADAT3Ex2NM_138422.3:c.596C>Tp.Ala199Val | p.A199VNM_079834.2:c.-41-2336C>T, NM_138422.1:c.548C>T, NM_138422.2:c.596C>T, XM_005259481.1:c.-41-2336C>T, XM_005259482.1:c.-41-2336C>T, XM_005259484.1:c.548C>T, XR_244026.1:n.227-2336C>T, XR_244027.1:n.227-2336C>TVOUS08/23/2019

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.