Loading Data . . .

EmVClass

NTD Genetics' Variant Classification Catalog

Please enter the official gene symbol and click Search to see all the variants that have been seen and analyzed by NTD Genetics for that gene.
NTD Genetics classification definitions may be reviewed here.
You may submit a question regarding a variant by clicking the appropriate button on the returned data table.
You may prompt a review of a variant of unknown signifigance (VOUS) reviewed greater than six months ago by clicking the appropriate button on the returned data table.
If a reported variant has changed classification, you may request an amended report by clicking here.
OrderGeneExonNucleotide ChangeProtein ChangeAlias ListingClassificationLast Reviewed  
1ACADVLEx1NM_000018.3:c.1-11G>TNM_000018.2:c.-11G>T, NM_000018.3:c.-11G>T, NM_001033859.1:c.-11G>T, NM_001033859.2:c.-11G>T, NM_001128827.1:c.-2827C>A, NM_001270447.1:c.132-148G>T, NM_001270448.1:c.-314G>T, NM_001365.3:c.-1125C>A, NR_029896.1:n.*3323C>A, XM_005256489.1:c.-1125C>A, XM_005256491.1:c.-2827C>A, XM_005256492.1:c.-2827C>A, XR_243545.1:n.-132C>A, XR_243555.1:n.571G>TVOUS10/18/2017
2ACADVLEx1NM_000018.3:c.49C>Tp.Leu17Phe | p.L17FNM_000018.2:c.49C>T, NM_000018.3:c.49C>T, NM_001033859.1:c.49C>T, NM_001033859.2:c.49C>T, NM_001128827.1:c.-2886G>A, NM_001270447.1:c.132-89C>T, NM_001270448.1:c.-255C>T, NM_001365.3:c.-1184G>A, NR_029896.1:n.*3264G>A, XM_005256489.1:c.-1184G>A, XM_005256491.1:c.-2886G>A, XM_005256492.1:c.-2886G>A, XR_243545.1:n.-191G>A, XR_243555.1:n.630C>TBenign03/30/2016 
3ACADVLEx1NM_000018.3:c.-63_-49dupGGGCGTGCAGGACGCNM_000018.2:c.-49_-48insGGGCGTGCAGGACGC, NM_000018.2:c.-63_-49dup, NM_000018.2:c.-63_-49dupGGGCGTGCAGGACGC, NM_000018.3:c.-49_-48insGGGCGTGCAGGACGC, NM_000018.3:c.-63_-49dup, NM_000018.3:c.-63_-49dupGGGCGTGCAGGACGC, NM_001033859.1:c.-49_-48insGGGCGTGCAGGACGC, NM_001033859.1:c.-63_-49dup, NM_001033859.1:c.-63_-49dupGGGCGTGCAGGACGC, NM_001033859.2:c.-49_-48insGGGCGTGCAGGACGC, NM_001033859.2:c.-63_-49dup, NM_001033859.2:c.-63_-49dupGGGCGTGCAGGACGC, NM_001128827.1:c.-2789_-2775dup, NM_001128827.1:c.-2789_-2775dupGCGTCCTGCACGCCC, NM_001128827.1:c.-2790_-2789insGCGTCCTGCACGCCC, NM_001270447.1:c.132-186_132-185insGGGCGTGCAGGACGC, NM_001270447.1:c.132-200_132-186dup, NM_001270447.1:c.132-200_132-186dupGGGCGTGCAGGACGC, NM_001270448.1:c.-352_-351insGGGCGTGCAGGACGC, NM_001270448.1:c.-366_-352dup, NM_001270448.1:c.-366_-352dupGGGCGTGCAGGACGC, NM_001365.3:c.-1087_-1073dup, NM_001365.3:c.-1087_-1073dupGCGTCCTGCACGCCC, NM_001365.3:c.-1088_-1087insGCGTCCTGCACGCCC, NR_029896.1:n.*3360_*3361insGCGTCCTBenign10/09/2019 
4ACADVLEx2NM_000018.3:c.65C>Ap.Ser22* | p.S22XNM_000018.2:c.65C>A, NM_000018.3:c.65C>A, NM_001033859.1:c.65C>A, NM_001033859.2:c.65C>A, NM_001128827.1:c.-2977G>T, NM_001270447.1:c.134C>A, NM_001270448.1:c.-164C>A, NM_001365.3:c.-1275G>T, NR_029896.1:n.*3173G>TPathogenic03/20/2014 
5ACADVLEx2NM_000018.3:c.128G>Ap.Gly43Asp | p.G43DNM_000018.2:c.128G>A, NM_000018.3:c.128G>A, NM_001033859.1:c.128G>A, NM_001033859.2:c.128G>A, NM_001128827.1:c.-3040C>T, NM_001270447.1:c.197G>A, NM_001270448.1:c.-101G>A, NM_001365.3:c.-1338C>T, NR_029896.1:n.*3110C>T, XM_005256489.1:c.-1338C>T, XM_005256491.1:c.-3040C>T, XM_005256492.1:c.-3040C>T, XR_243545.1:n.-345C>T, XR_243555.1:n.709G>ABenign07/21/2019 
6ACADVLEx2NM_000018.3:c.129T>Ap.Gly43= | p.G43=NM_000018.2:c.129T>A, NM_000018.3:c.129T>A, NM_001033859.1:c.129T>A, NM_001033859.2:c.129T>A, NM_001128827.1:c.-3041A>T, NM_001270447.1:c.198T>A, NM_001270448.1:c.-100T>A, NM_001365.3:c.-1339A>T, NR_029896.1:n.*3109A>TVOUS02/03/2014
7ACADVLEx3NM_000018.3:c.189A>Gp.Lys63= | p.K63=NM_000018.2:c.189A>G, NM_000018.3:c.189A>G, NM_001033859.1:c.139-90A>G, NM_001033859.2:c.139-90A>G, NM_001128827.1:c.-3367T>C, NM_001270447.1:c.258A>G, NM_001270448.1:c.-40A>G, NM_001365.3:c.-1665T>C, NM_004422.2:c.*5351T>C, NR_029896.1:n.*2783T>CVOUS02/03/2014
8ACADVLEx3NM_000018.3:c.194C>Tp.Pro65Leu | p.P65LNM_000018.2:c.194C>T, NM_000018.3:c.194C>T, NM_001033859.1:c.139-85C>T, NM_001033859.2:c.139-85C>T, NM_001128827.1:c.-3372G>A, NM_001270447.1:c.263C>T, NM_001270448.1:c.-35C>T, NM_001365.3:c.-1670G>A, NM_004422.2:c.*5346G>A, NR_029896.1:n.*2778G>A, XM_005256489.1:c.-1670G>A, XM_005256491.1:c.-3372G>A, XM_005256492.1:c.-3372G>A, XM_005256502.1:c.*5346G>A, XM_005256503.1:c.*5346G>A, XM_005256504.1:c.*5346G>A, XR_243545.1:n.-677G>A, XR_243555.1:n.775C>TBenign02/26/2013 
9ACADVLEx4NM_000018.3:c.205-8C>GVOUS**
10ACADVLEx4NM_000018.3:c.205-7T>CVOUS**
11ACADVLEx4NM_000018.3:c.271C>Tp.Pro91Ser | p.P91SNM_000018.2:c.271C>T, NM_000018.3:c.271C>T, NM_001033859.1:c.205C>T, NM_001033859.2:c.205C>T, NM_001128827.1:c.-3523G>A, NM_001270447.1:c.340C>T, NM_001270448.1:c.43C>T, NM_001365.3:c.-1821G>A, NM_004422.2:c.*5195G>A, NR_029896.1:n.*2627G>AVOUS07/01/2013
12ACADVLEx4NM_000018.3:c.277G>Tp.Val93Leu | p.V93LNM_000018.2:c.277G>T, NM_000018.3:c.277G>T, NM_001033859.1:c.211G>T, NM_001033859.2:c.211G>T, NM_001128827.1:c.-3529C>A, NM_001270447.1:c.346G>T, NM_001270448.1:c.49G>T, NM_001365.3:c.-1827C>A, NM_004422.2:c.*5189C>A, NR_029896.1:n.*2621C>AVOUS**
13ACADVLEx5NM_000018.3:c.278-1G>ANM_000018.2:c.278-1G>A, NM_000018.3:c.278-1G>A, NM_001033859.1:c.212-1G>A, NM_001033859.2:c.212-1G>A, NM_001128827.1:c.-3618C>T, NM_001270447.1:c.347-1G>A, NM_001270448.1:c.50-1G>A, NM_001365.3:c.-1916C>T, NM_004422.2:c.*5100C>T, NR_029896.1:n.*2532C>T, XM_005256489.1:c.-1916C>T, XM_005256491.1:c.-3618C>T, XM_005256492.1:c.-3618C>T, XM_005256502.1:c.*5100C>T, XM_005256503.1:c.*5100C>T, XM_005256504.1:c.*5100C>T, XR_243545.1:n.-923C>T, XR_243555.1:n.859-1G>APathogenic03/07/2019 
14ACADVLEx5NM_000018.3:c.294G>Cp.Gln98His | p.Q98HNM_000018.2:c.294G>C, NM_000018.3:c.294G>C, NM_001033859.1:c.228G>C, NM_001033859.2:c.228G>C, NM_001128827.1:c.-3635C>G, NM_001270447.1:c.363G>C, NM_001270448.1:c.66G>C, NM_001365.3:c.-1933C>G, NM_004422.2:c.*5083C>G, NR_029896.1:n.*2515C>G, XM_005256489.1:c.-1933C>G, XM_005256491.1:c.-3635C>G, XM_005256492.1:c.-3635C>G, XM_005256502.1:c.*5083C>G, XM_005256503.1:c.*5083C>G, XM_005256504.1:c.*5083C>G, XR_243545.1:n.-940C>G, XR_243555.1:n.875G>CVOUS05/17/2019
15ACADVLEx5NM_000018.3:c.298_299delCANM_000018.3:c.298_299delCAPathogenic09/08/2014 
16ACADVLEx5NM_000018.3:c.306_342+13delNM_000018.2:c.306_342+13delTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGTAAGGAATGACT, NM_000018.3:c.306_342+13delTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGTAAGGAATGACT, NM_001033859.1:c.240_276+13delTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGTAAGGAATGACT, NM_001033859.2:c.240_276+13delTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGTAAGGAATGACT, NM_001128827.1:c.-3696_-3647delAGTCATTCCTTACCTCGAAGAAACGGGACACAGGCTCCACCAGCTCTTTA, NM_001270447.1:c.375_411+13delTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGTAAGGAATGACT, NM_001270448.1:c.78_114+13delTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGTAAGGAATGACT, NM_001365.3:c.-1994_-1945delAGTCATTCCTTACCTCGAAGAAACGGGACACAGGCTCCACCAGCTCTTTA, NM_004422.2:c.*5022_*5071delAGTCATTCCTTACCTCGAAGAAACGGGACACAGGCTCCACCAGCTCTTTA, NR_029896.1:n.*2454_*2503delAGTCATTCCTTACCTCGAAGAAACGGGACACAGGCTCCACCAGCTCTTTA, XM_005256489.1:c.-1994_-1945delAGTCATTCCTTACCTCGAAGAAACGGGACACAGGCTCCACCAGCTCTTTA, XM_005256491.1:c.-3696_-3647delAGTCATTCCTTACCTCGAAGAAACGGGACACAGGCTCCACCAGCTCTTTA, XM_005256492.1:c.-3696_-Pathogenic07/31/2019 
17ACADVLEx5NM_000018.3:c.322C>Gp.Pro108Ala | p.P108ANM_000018.2:c.322C>G, NM_000018.3:c.322C>G, NM_001033859.1:c.256C>G, NM_001033859.2:c.256C>G, NM_001128827.1:c.-3663G>C, NM_001270447.1:c.391C>G, NM_001270448.1:c.94C>G, NM_001365.3:c.-1961G>C, NM_004422.2:c.*5055G>C, NR_029896.1:n.*2487G>C, XM_005256489.1:c.-1961G>C, XM_005256491.1:c.-3663G>C, XM_005256492.1:c.-3663G>C, XM_005256502.1:c.*5055G>C, XM_005256503.1:c.*5055G>C, XM_005256504.1:c.*5055G>C, XR_243545.1:n.-968G>C, XR_243555.1:n.903C>GVOUS01/19/2016
18ACADVLEx5NM_000018.3:c.326T>Ap.Val109Glu | p.V109ENM_000018.3:c.326T>A, NM_001128827.1:c.-3667A>T, NM_001270447.1:c.395T>A, NM_001365.3:c.-1965A>T, XM_005256489.1:c.-1965A>T, XM_005256491.1:c.-3667A>T, XM_005256492.1:c.-3667A>T, XR_243545.1:n.-972A>T, XR_243555.1:n.907T>AVOUS06/01/2017
19ACADVLEx6NM_000018.3:c.343delGp.Glu115Lysfs*2 | p.E115KfsX2NM_000018.2:c.343delG, NM_000018.3:c.343delG, NM_001033859.1:c.277delG, NM_001033859.2:c.277delG, NM_001128827.1:c.-3777delC, NM_001270447.1:c.412delG, NM_001270448.1:c.115delG, NM_001365.3:c.-2075delC, NM_004422.2:c.*4941delC, NR_029896.1:n.*2373delC, XM_005256489.1:c.-2075delC, XM_005256491.1:c.-3777delC, XM_005256492.1:c.-3777delC, XM_005256502.1:c.*4941delC, XM_005256503.1:c.*4941delC, XM_005256504.1:c.*4941delC, XR_243545.1:n.-1082delC, XR_243555.1:n.924delGPathogenic02/07/2019 
20ACADVLEx6NM_000018.3:c.364A>Gp.Asn122Asp | p.N122DNM_000018.2:c.364A>G, NM_000018.3:c.364A>G, NM_001033859.1:c.298A>G, NM_001033859.2:c.298A>G, NM_001128827.1:c.-3798T>C, NM_001270447.1:c.433A>G, NM_001270448.1:c.136A>G, NM_001365.3:c.-2096T>C, NM_004422.2:c.*4920T>C, NR_029896.1:n.*2352T>C, XM_005256489.1:c.-2096T>C, XM_005256491.1:c.-3798T>C, XM_005256492.1:c.-3798T>C, XM_005256502.1:c.*4920T>C, XM_005256503.1:c.*4920T>C, XM_005256504.1:c.*4920T>C, XR_243545.1:n.-1103T>C, XR_243555.1:n.945A>GPathogenic05/08/2020 
21ACADVLEx6NM_000018.3:c.374T>Cp.Leu125Pro | p.L125PNM_000018.2:c.374T>C, NM_000018.3:c.374T>C, NM_001033859.1:c.308T>C, NM_001033859.2:c.308T>C, NM_001128827.1:c.-3808A>G, NM_001270447.1:c.443T>C, NM_001270448.1:c.146T>C, NM_001365.3:c.-2106A>G, NM_004422.2:c.*4910A>G, NR_029896.1:n.*2342A>G, XM_005256489.1:c.-2106A>G, XM_005256491.1:c.-3808A>G, XM_005256492.1:c.-3808A>G, XM_005256502.1:c.*4910A>G, XM_005256503.1:c.*4910A>G, XM_005256504.1:c.*4910A>G, XR_243545.1:n.-1113A>G, XR_243555.1:n.955T>CVOUS**
22ACADVLEx6NM_000018.3:c.385G>Ap.Glu129Lys | p.E129KNM_000018.2:c.385G>A, NM_000018.3:c.385G>A, NM_001033859.1:c.319G>A, NM_001033859.2:c.319G>A, NM_001128827.1:c.-3819C>T, NM_001270447.1:c.454G>A, NM_001270448.1:c.157G>A, NM_001365.3:c.-2117C>T, NM_004422.2:c.*4899C>T, NR_029896.1:n.*2331C>T, XM_005256489.1:c.-2117C>T, XM_005256491.1:c.-3819C>T, XM_005256492.1:c.-3819C>T, XM_005256502.1:c.*4899C>T, XM_005256503.1:c.*4899C>T, XM_005256504.1:c.*4899C>T, XR_243545.1:n.-1124C>T, XR_243555.1:n.966G>AVOUS04/21/2017
23ACADVLEx6NM_000018.3:c.400C>Tp.Gln134* | p.Q134XPathogenic** 
24ACADVLEx6NM_000018.3:c.425T>Cp.Phe142Ser | p.F142SNM_000018.2:c.425T>C, NM_000018.3:c.425T>C, NM_001033859.1:c.359T>C, NM_001033859.2:c.359T>C, NM_001128827.1:c.-3859A>G, NM_001270447.1:c.494T>C, NM_001270448.1:c.197T>C, NM_001365.3:c.-2157A>G, NM_004422.2:c.*4859A>G, NR_029896.1:n.*2291A>GVOUS07/31/2013
25ACADVLEx6NM_000018.3:c.427G>Tp.Gly143Cys | p.G143CNM_000018.2:c.427G>T, NM_000018.3:c.427G>T, NM_001033859.1:c.361G>T, NM_001033859.2:c.361G>T, NM_001128827.1:c.-3861C>A, NM_001270447.1:c.496G>T, NM_001270448.1:c.199G>T, NM_001365.3:c.-2159C>A, NM_004422.2:c.*4857C>A, NR_029896.1:n.*2289C>A, XM_005256489.1:c.-2159C>A, XM_005256491.1:c.-3861C>A, XM_005256492.1:c.-3861C>A, XM_005256502.1:c.*4857C>A, XM_005256503.1:c.*4857C>A, XM_005256504.1:c.*4857C>A, XR_243545.1:n.-1166C>A, XR_243555.1:n.1008G>TVOUS05/17/2019
26ACADVLEx6NM_000018.3:c.436G>Cp.Val146Leu | p.V146LVOUS03/27/2013
27ACADVLEx6NM_000018.3:c.455G>Ap.Gly152Asp | p.G152DNM_000018.2:c.455G>A, NM_000018.3:c.455G>A, NM_001033859.1:c.389G>A, NM_001033859.2:c.389G>A, NM_001128827.1:c.-3889C>T, NM_001270447.1:c.524G>A, NM_001270448.1:c.227G>A, NM_001365.3:c.-2187C>T, NM_004422.2:c.*4829C>T, NR_029896.1:n.*2261C>T, XM_005256489.1:c.-2187C>T, XM_005256491.1:c.-3889C>T, XM_005256492.1:c.-3889C>T, XM_005256502.1:c.*4829C>T, XM_005256503.1:c.*4829C>T, XM_005256504.1:c.*4829C>T, XR_243545.1:n.-1194C>T, XR_243555.1:n.1036G>AVOUS02/20/2015
28ACADVLEx6NM_000018.3:c.477+1G>CPathogenic** 
29ACADVLEx7NM_000018.3:c.478-35C>TVOUS**
30ACADVLEx7NM_000018.3:c.478-22delCABenign** 
31ACADVLEx7NM_000018.3:c.495G>Tp.Glu165Asp | p.E165DNM_000018.2:c.495G>T, NM_000018.3:c.495G>T, NM_001033859.1:c.429G>T, NM_001033859.2:c.429G>T, NM_001128827.1:c.-4408C>A, NM_001270447.1:c.564G>T, NM_001270448.1:c.267G>T, NM_001365.3:c.-2706C>A, NM_004422.2:c.*4310C>A, NR_029896.1:n.*1742C>AVOUS12/01/2016
32ACADVLEx7NM_000018.3:c.520G>Ap.Val174Met | p.V174MNM_000018.2:c.520G>A, NM_000018.3:c.520G>A, NM_001033859.1:c.454G>A, NM_001033859.2:c.454G>A, NM_001128827.1:c.-4433C>T, NM_001270447.1:c.589G>A, NM_001270448.1:c.292G>A, NM_001365.3:c.-2731C>T, NM_004422.2:c.*4285C>T, NR_029896.1:n.*1717C>T, XM_005256489.1:c.-2731C>T, XM_005256491.1:c.-4433C>T, XM_005256492.1:c.-4433C>T, XM_005256502.1:c.*4285C>T, XM_005256503.1:c.*4285C>T, XM_005256504.1:c.*4285C>T, XR_243545.1:n.-1738C>T, XR_243555.1:n.1101G>APathogenic03/23/2015 
33ACADVLEx7NM_000018.3:c.538G>Ap.Ala180Thr | p.A180TNM_000018.2:c.538G>A, NM_000018.3:c.538G>A, NM_001033859.1:c.472G>A, NM_001033859.2:c.472G>A, NM_001128827.1:c.-4451C>T, NM_001270447.1:c.607G>A, NM_001270448.1:c.310G>A, NM_001365.3:c.-2749C>T, NM_004422.2:c.*4267C>T, NR_029896.1:n.*1699C>TVOUS06/23/2017
34ACADVLEx7NM_000018.3:c.542A>Gp.His181Arg | p.H181RNM_000018.2:c.542A>G, NM_000018.3:c.542A>G, NM_001033859.1:c.476A>G, NM_001033859.2:c.476A>G, NM_001128827.1:c.-4455T>C, NM_001270447.1:c.611A>G, NM_001270448.1:c.314A>G, NM_001365.3:c.-2753T>C, NM_004422.2:c.*4263T>C, NR_029896.1:n.*1695T>C, XM_005256489.1:c.-2753T>C, XM_005256491.1:c.-4455T>C, XM_005256492.1:c.-4455T>C, XM_005256502.1:c.*4263T>C, XM_005256503.1:c.*4263T>C, XM_005256504.1:c.*4263T>C, XR_243545.1:n.-1760T>C, XR_243555.1:n.1123A>GVOUS06/19/2017
35ACADVLEx7NM_000018.3:c.575T>Cp.Phe192Ser | p.F192SNM_000018.2:c.575T>C, NM_000018.3:c.575T>C, NM_001033859.1:c.509T>C, NM_001033859.2:c.509T>C, NM_001128827.1:c.-4488A>G, NM_001270447.1:c.644T>C, NM_001270448.1:c.347T>C, NM_001365.3:c.-2786A>G, NM_004422.2:c.*4230A>G, NR_029896.1:n.*1662A>G, XM_005256489.1:c.-2786A>G, XM_005256491.1:c.-4488A>G, XM_005256492.1:c.-4488A>G, XM_005256502.1:c.*4230A>G, XM_005256503.1:c.*4230A>G, XM_005256504.1:c.*4230A>G, XR_243545.1:n.-1793A>G, XR_243555.1:n.1156T>CVOUS04/21/2017
36ACADVLEx7NM_000018.3:c.601T>Cp.Tyr201His | p.Y201HVOUS**
37ACADVLEx7NM_000018.3:c.605T>Cp.Leu202Pro | p.L202PNM_000018.2:c.605T>C, NM_000018.3:c.605T>C, NM_001033859.1:c.539T>C, NM_001033859.2:c.539T>C, NM_001128827.1:c.-4518A>G, NM_001270447.1:c.674T>C, NM_001270448.1:c.377T>C, NM_001365.3:c.-2816A>G, NM_004422.2:c.*4200A>G, NR_029896.1:n.*1632A>GVOUS05/21/2013
38ACADVLEx7NM_000018.3:c.605T>Ap.Leu202His | p.L202HVOUS12/06/2012
39ACADVLEx8NM_000018.3:c.623-8C>TNM_000018.2:c.623-8C>T, NM_000018.3:c.623-8C>T, NM_001033859.1:c.557-8C>T, NM_001033859.2:c.557-8C>T, NM_001128827.1:c.-4797G>A, NM_001270447.1:c.692-8C>T, NM_001270448.1:c.395-8C>T, NM_001365.3:c.-3095G>A, NM_004422.2:c.*3921G>A, NR_029896.1:n.*1353G>ABenign02/20/2014 
40ACADVLEx8NM_000018.3:c.636C>Tp.Ala212= | p.A212=NM_000018.2:c.636C>T, NM_000018.3:c.636C>T, NM_001033859.1:c.570C>T, NM_001033859.2:c.570C>T, NM_001128827.1:c.-4818G>A, NM_001270447.1:c.705C>T, NM_001270448.1:c.408C>T, NM_001365.3:c.-3116G>A, NM_004422.2:c.*3900G>A, NR_029896.1:n.*1332G>A, XM_005256489.1:c.-3116G>A, XM_005256491.1:c.-4818G>A, XM_005256492.1:c.-4818G>A, XM_005256502.1:c.*3900G>A, XM_005256503.1:c.*3900G>A, XM_005256504.1:c.*3900G>A, XR_243545.1:n.-2123G>A, XR_243555.1:n.1217C>TBenign08/17/2017 
41ACADVLEx8NM_000018.3:c.637G>Ap.Ala213Thr | p.A213TNM_000018.2:c.637G>A, NM_000018.3:c.637G>A, NM_001033859.1:c.571G>A, NM_001033859.2:c.571G>A, NM_001128827.1:c.-4819C>T, NM_001270447.1:c.706G>A, NM_001270448.1:c.409G>A, NM_001365.3:c.-3117C>T, NM_004422.2:c.*3899C>T, NR_029896.1:n.*1331C>T, XM_005256489.1:c.-3117C>T, XM_005256491.1:c.-4819C>T, XM_005256492.1:c.-4819C>T, XM_005256502.1:c.*3899C>T, XM_005256503.1:c.*3899C>T, XM_005256504.1:c.*3899C>T, XR_243545.1:n.-2124C>T, XR_243555.1:n.1218G>APathogenic05/21/2020 
42ACADVLEx8NM_000018.3:c.637G>Cp.Ala213Pro | p.A213PNM_000018.2:c.637G>C, NM_000018.3:c.637G>C, NM_001033859.1:c.571G>C, NM_001033859.2:c.571G>C, NM_001128827.1:c.-4819C>G, NM_001270447.1:c.706G>C, NM_001270448.1:c.409G>C, NM_001365.3:c.-3117C>G, NM_004422.2:c.*3899C>G, NR_029896.1:n.*1331C>G, XM_005256489.1:c.-3117C>G, XM_005256491.1:c.-4819C>G, XM_005256492.1:c.-4819C>G, XM_005256502.1:c.*3899C>G, XM_005256503.1:c.*3899C>G, XM_005256504.1:c.*3899C>G, XR_243545.1:n.-2124C>G, XR_243555.1:n.1218G>CVOUS06/26/2015
43ACADVLEx8NM_000018.3:c.640T>Gp.Phe214Val | p.F214VNM_000018.2:c.640T>G, NM_000018.3:c.640T>G, NM_001033859.1:c.574T>G, NM_001033859.2:c.574T>G, NM_001128827.1:c.-4822A>C, NM_001270447.1:c.709T>G, NM_001270448.1:c.412T>G, NM_001365.3:c.-3120A>C, NM_004422.2:c.*3896A>C, NR_029896.1:n.*1328A>C, XM_005256489.1:c.-3120A>C, XM_005256491.1:c.-4822A>C, XM_005256492.1:c.-4822A>C, XM_005256502.1:c.*3896A>C, XM_005256503.1:c.*3896A>C, XM_005256504.1:c.*3896A>C, XR_243545.1:n.-2127A>C, XR_243555.1:n.1221T>GVOUS08/31/2018
44ACADVLEx8NM_000018.3:c.644_647delGTCTNM_000018.2:c.644_647delGTCT, NM_000018.3:c.644_647delGTCT, NM_001033859.1:c.578_581delGTCT, NM_001033859.2:c.578_581delGTCT, NM_001128827.1:c.-4829_-4826delAGAC, NM_001270447.1:c.713_716delGTCT, NM_001270448.1:c.416_419delGTCT, NM_001365.3:c.-3127_-3124delAGAC, NM_004422.2:c.*3889_*3892delAGAC, NR_029896.1:n.*1321_*1324delAGAC, XM_005256489.1:c.-3127_-3124delAGAC, XM_005256491.1:c.-4829_-4826delAGAC, XM_005256492.1:c.-4829_-4826delAGAC, XM_005256502.1:c.*3889_*3892delAGAC, XM_005256503.1:c.*3889_*3892delAGAC, XM_005256504.1:c.*3889_*3892delAGAC, XR_243545.1:n.-2134_-2131delAGAC, XR_243555.1:n.1225_1228delGTCTPathogenic** 
45ACADVLEx8NM_000018.3:c.663C>Tp.Ser221= | p.S221=NM_000018.2:c.663C>T, NM_000018.3:c.663C>T, NM_001033859.1:c.597C>T, NM_001033859.2:c.597C>T, NM_001128827.1:c.-4845G>A, NM_001270447.1:c.732C>T, NM_001270448.1:c.435C>T, NM_001365.3:c.-3143G>A, NM_004422.2:c.*3873G>A, NR_029896.1:n.*1305G>A, XM_005256489.1:c.-3143G>A, XM_005256491.1:c.-4845G>A, XM_005256492.1:c.-4845G>A, XM_005256502.1:c.*3873G>A, XM_005256503.1:c.*3873G>A, XM_005256504.1:c.*3873G>A, XR_243545.1:n.-2150G>A, XR_243555.1:n.1244C>TVOUS07/09/2019
46ACADVLEx8NM_000018.3:c.664G>Ap.Gly222Arg | p.G222RNM_000018.2:c.664G>A, NM_000018.3:c.664G>A, NM_001033859.1:c.598G>A, NM_001033859.2:c.598G>A, NM_001128827.1:c.-4846C>T, NM_001270447.1:c.733G>A, NM_001270448.1:c.436G>A, NM_001365.3:c.-3144C>T, NM_004422.2:c.*3872C>T, NR_029896.1:n.*1304C>TLikely pathogenic08/31/2017 
47ACADVLEx8NM_000018.3:c.678C>Ap.Ala226= | p.A226=NM_000018.2:c.678C>A, NM_000018.3:c.678C>A, NM_001033859.1:c.612C>A, NM_001033859.2:c.612C>A, NM_001128827.1:c.-4860G>T, NM_001270447.1:c.747C>A, NM_001270448.1:c.450C>A, NM_001365.3:c.-3158G>T, NM_004422.2:c.*3858G>T, NR_029896.1:n.*1290G>T, XM_005256489.1:c.-3158G>T, XM_005256491.1:c.-4860G>T, XM_005256492.1:c.-4860G>T, XM_005256502.1:c.*3858G>T, XM_005256503.1:c.*3858G>T, XM_005256504.1:c.*3858G>T, XR_243545.1:n.-2165G>T, XR_243555.1:n.1259C>AVOUS08/25/2015
48ACADVLEx8NM_000018.3:c.685C>Tp.Arg229* | p.R229XNM_000018.2:c.685C>T, NM_000018.3:c.685C>T, NM_001033859.1:c.619C>T, NM_001033859.2:c.619C>T, NM_001128827.1:c.-4867G>A, NM_001270447.1:c.754C>T, NM_001270448.1:c.457C>T, NM_001365.3:c.-3165G>A, NM_004422.2:c.*3851G>A, NR_029896.1:n.*1283G>APathogenic** 
49ACADVLEx8NM_000018.3:c.689C>Tp.Thr230Ile | p.T230IVOUS**
50ACADVLEx8NM_000018.3:c.693T>Cp.Ser231= | p.S231=NM_000018.2:c.693T>C, NM_000018.3:c.693T>C, NM_001033859.1:c.627T>C, NM_001033859.2:c.627T>C, NM_001128827.1:c.-4875A>G, NM_001270447.1:c.762T>C, NM_001270448.1:c.465T>C, NM_001365.3:c.-3173A>G, NM_004422.2:c.*3843A>G, NR_029896.1:n.*1275A>G, XM_005256489.1:c.-3173A>G, XM_005256491.1:c.-4875A>G, XM_005256492.1:c.-4875A>G, XM_005256502.1:c.*3843A>G, XM_005256503.1:c.*3843A>G, XM_005256504.1:c.*3843A>G, XR_243545.1:n.-2180A>G, XR_243555.1:n.1274T>CVOUS03/07/2019
51ACADVLEx8NM_000018.3:c.693T>Ap.Ser231= | p.S231=NM_000018.2:c.693T>A, NM_000018.3:c.693T>A, NM_001033859.1:c.627T>A, NM_001033859.2:c.627T>A, NM_001128827.1:c.-4875A>T, NM_001270447.1:c.762T>A, NM_001270448.1:c.465T>A, NM_001365.3:c.-3173A>T, NM_004422.2:c.*3843A>T, NR_029896.1:n.*1275A>T, XM_005256489.1:c.-3173A>T, XM_005256491.1:c.-4875A>T, XM_005256492.1:c.-4875A>T, XM_005256502.1:c.*3843A>T, XM_005256503.1:c.*3843A>T, XM_005256504.1:c.*3843A>T, XR_243545.1:n.-2180A>T, XR_243555.1:n.1274T>ABenign06/21/2019 
52ACADVLEx8NM_000018.3:c.713G>Tp.Gly238Val | p.G238VNM_000018.2:c.713G>T, NM_000018.3:c.713G>T, NM_001033859.1:c.647G>T, NM_001033859.2:c.647G>T, NM_001128827.1:c.-4895C>A, NM_001270447.1:c.782G>T, NM_001270448.1:c.485G>T, NM_001365.3:c.-3193C>A, NM_004422.2:c.*3823C>A, NR_029896.1:n.*1255C>A, XM_005256489.1:c.-3193C>A, XM_005256491.1:c.-4895C>A, XM_005256492.1:c.-4895C>A, XM_005256502.1:c.*3823C>A, XM_005256503.1:c.*3823C>A, XM_005256504.1:c.*3823C>A, XR_243545.1:n.-2200C>A, XR_243555.1:n.1294G>TVOUS07/08/2016
53ACADVLEx8NM_000018.3:c.735A>Tp.Gly245= | p.G245=VOUS**
54ACADVLEx9NM_000018.3:c.753-36C>TVOUS**
55ACADVLEx9NM_000018.3:c.753-2A>CNM_000018.2:c.753-2A>C, NM_000018.3:c.753-2A>C, NM_001033859.1:c.687-2A>C, NM_001033859.2:c.687-2A>C, NM_001128827.1:c.-5028T>G, NM_001270447.1:c.822-2A>C, NM_001270448.1:c.525-2A>C, NM_001365.3:c.-3326T>G, NM_004422.2:c.*3690T>G, NR_029896.1:n.*1122T>GPathogenic07/17/2013 
56ACADVLEx9NM_000018.3:c.760G>Ap.Gly254Ser | p.G254SNM_000018.2:c.760G>A, NM_000018.3:c.760G>A, NM_001033859.1:c.694G>A, NM_001033859.2:c.694G>A, NM_001128827.1:c.-5037C>T, NM_001270447.1:c.829G>A, NM_001270448.1:c.532G>A, NM_001365.3:c.-3335C>T, NM_004422.2:c.*3681C>T, NR_029896.1:n.*1113C>T, XM_005256489.1:c.-3335C>T, XM_005256491.1:c.-5037C>T, XM_005256492.1:c.-5037C>T, XM_005256502.1:c.*3681C>T, XM_005256503.1:c.*3681C>T, XM_005256504.1:c.*3681C>T, XR_243545.1:n.-2342C>T, XR_243555.1:n.1341G>AVOUS10/03/2019
57ACADVLEx9NM_000018.3:c.787G>Ap.Ala263Thr | p.A263TNM_000018.2:c.787G>A, NM_000018.3:c.787G>A, NM_001033859.1:c.721G>A, NM_001033859.2:c.721G>A, NM_001128827.1:c.-5064C>T, NM_001270447.1:c.856G>A, NM_001270448.1:c.559G>A, NM_001365.3:c.-3362C>T, NM_004422.2:c.*3654C>T, NR_029896.1:n.*1086C>T, XM_005256489.1:c.-3362C>T, XM_005256491.1:c.-5064C>T, XM_005256492.1:c.-5064C>T, XM_005256502.1:c.*3654C>T, XM_005256503.1:c.*3654C>T, XM_005256504.1:c.*3654C>T, XR_243545.1:n.-2369C>T, XR_243555.1:n.1368G>AVOUS10/24/2019
58ACADVLEx9NM_000018.3:c.818G>Cp.Gly273Ala | p.G273ANM_000018.2:c.818G>C, NM_000018.3:c.818G>C, NM_001033859.1:c.752G>C, NM_001033859.2:c.752G>C, NM_001128827.1:c.-5095C>G, NM_001270447.1:c.887G>C, NM_001270448.1:c.590G>C, NM_001365.3:c.-3393C>G, NM_004422.2:c.*3623C>G, NR_029896.1:n.*1055C>G, XM_005256489.1:c.-3393C>G, XM_005256491.1:c.-5095C>G, XM_005256492.1:c.-5095C>G, XM_005256502.1:c.*3623C>G, XM_005256503.1:c.*3623C>G, XM_005256504.1:c.*3623C>G, XR_243545.1:n.-2400C>G, XR_243555.1:n.1399G>CVOUS**
59ACADVLEx9NM_000018.3:c.829_831delGAGp.Glu277del | p.E277delNM_000018.2:c.829_831delGAG, NM_000018.3:c.829_831delGAG, NM_001033859.1:c.763_765delGAG, NM_001033859.2:c.763_765delGAG, NM_001128827.1:c.-5108_-5106delCTC, NM_001270447.1:c.898_900delGAG, NM_001270448.1:c.601_603delGAG, NM_001365.3:c.-3406_-3404delCTC, NM_004422.2:c.*3610_*3612delCTC, NR_029896.1:n.*1042_*1044delCTC, XM_005256489.1:c.-3406_-3404delCTC, XM_005256491.1:c.-5108_-5106delCTC, XM_005256492.1:c.-5108_-5106delCTC, XM_005256502.1:c.*3610_*3612delCTC, XM_005256503.1:c.*3610_*3612delCTC, XM_005256504.1:c.*3610_*3612delCTC, XR_243545.1:n.-2413_-2411delCTC, XR_243555.1:n.1410_1412delGAGPathogenic03/14/2019 
60ACADVLEx9NM_000018.3:c.833_835delAGANM_000018.2:c.833_835delAGA, NM_000018.3:c.833_835delAGA, NM_001033859.1:c.767_769delAGA, NM_001033859.2:c.767_769delAGA, NM_001128827.1:c.-5112_-5110delTCT, NM_001270447.1:c.902_904delAGA, NM_001270448.1:c.605_607delAGA, NM_001365.3:c.-3410_-3408delTCT, NM_004422.2:c.*3606_*3608delTCT, NR_029896.1:n.*1038_*1040delTCT, XM_005256489.1:c.-3410_-3408delTCT, XM_005256491.1:c.-5112_-5110delTCT, XM_005256492.1:c.-5112_-5110delTCT, XM_005256502.1:c.*3606_*3608delTCT, XM_005256503.1:c.*3606_*3608delTCT, XM_005256504.1:c.*3606_*3608delTCT, XR_243545.1:n.-2417_-2415delTCT, XR_243555.1:n.1414_1416delAGAVOUS04/07/2016
61ACADVLEx9NM_000018.3:c.848T>Cp.Val283Ala | p.V283ANM_000018.2:c.848T>C, NM_000018.3:c.848T>C, NM_001033859.1:c.782T>C, NM_001033859.2:c.782T>C, NM_001128827.1:c.-5125A>G, NM_001270447.1:c.917T>C, NM_001270448.1:c.620T>C, NM_001365.3:c.-3423A>G, NM_004422.2:c.*3593A>G, NR_029896.1:n.*1025A>G, XM_005256489.1:c.-3423A>G, XM_005256491.1:c.-5125A>G, XM_005256492.1:c.-5125A>G, XM_005256502.1:c.*3593A>G, XM_005256503.1:c.*3593A>G, XM_005256504.1:c.*3593A>G, XR_243545.1:n.-2430A>G, XR_243555.1:n.1429T>CPathogenic12/24/2020 
62ACADVLEx9NM_000018.3:c.865G>Ap.Gly289Arg | p.G289RNM_000018.2:c.865G>A, NM_000018.3:c.865G>A, NM_001033859.1:c.799G>A, NM_001033859.2:c.799G>A, NM_001128827.1:c.-5142C>T, NM_001270447.1:c.934G>A, NM_001270448.1:c.637G>A, NM_001365.3:c.-3440C>T, NM_004422.2:c.*3576C>T, NR_029896.1:n.*1008C>T, XM_005256489.1:c.-3440C>T, XM_005256491.1:c.-5142C>T, XM_005256492.1:c.-5142C>T, XM_005256502.1:c.*3576C>T, XM_005256503.1:c.*3576C>T, XM_005256504.1:c.*3576C>T, XR_243545.1:n.-2447C>T, XR_243555.1:n.1446G>APathogenic** 
63ACADVLEx9NM_000018.3:c.866G>Ap.Gly289Glu | p.G289ENM_000018.2:c.866G>A, NM_000018.3:c.866G>A, NM_001033859.1:c.800G>A, NM_001033859.2:c.800G>A, NM_001128827.1:c.-5143C>T, NM_001270447.1:c.935G>A, NM_001270448.1:c.638G>A, NM_001365.3:c.-3441C>T, NM_004422.2:c.*3575C>T, NR_029896.1:n.*1007C>T, XM_005256489.1:c.-3441C>T, XM_005256491.1:c.-5143C>T, XM_005256492.1:c.-5143C>T, XM_005256502.1:c.*3575C>T, XM_005256503.1:c.*3575C>T, XM_005256504.1:c.*3575C>T, XR_243545.1:n.-2448C>T, XR_243555.1:n.1447G>AVOUS12/15/2014
64ACADVLEx9NM_000018.3:c.869dupGNM_000018.2:c.869_870insG, NM_000018.3:c.869_870insG, NM_001033859.1:c.803_804insG, NM_001033859.2:c.803_804insG, NM_001128827.1:c.-5147_-5146insC, NM_001270447.1:c.938_939insG, NM_001270448.1:c.641_642insG, NM_001365.3:c.-3445_-3444insC, NM_004422.2:c.*3571_*3572insC, NR_029896.1:n.*1003_*1004insC, XM_005256489.1:c.-3445_-3444insC, XM_005256491.1:c.-5147_-5146insC, XM_005256492.1:c.-5147_-5146insC, XM_005256502.1:c.*3571_*3572insC, XM_005256503.1:c.*3571_*3572insC, XM_005256504.1:c.*3571_*3572insC, XR_243545.1:n.-2452_-2451insC, XR_243555.1:n.1450_1451insGPathogenic09/19/2016 
65ACADVLEx9NM_000018.3:c.878+5_878+8delGTGANM_000018.2:c.878+5_878+8delGTGA, NM_000018.3:c.878+5_878+8delGTGA, NM_001033859.1:c.812+5_812+8delGTGA, NM_001033859.2:c.812+5_812+8delGTGA, NM_001128827.1:c.-5163_-5160delTCAC, NM_001270447.1:c.947+5_947+8delGTGA, NM_001270448.1:c.650+5_650+8delGTGA, NM_001365.3:c.-3461_-3458delTCAC, NM_004422.2:c.*3555_*3558delTCAC, NR_029896.1:n.*987_*990delTCAC, XM_005256489.1:c.-3461_-3458delTCAC, XM_005256491.1:c.-5163_-5160delTCAC, XM_005256492.1:c.-5163_-5160delTCAC, XM_005256502.1:c.*3555_*3558delTCAC, XM_005256503.1:c.*3555_*3558delTCAC, XM_005256504.1:c.*3555_*3558delTCAC, XR_243545.1:n.-2468_-2465delTCAC, XR_243555.1:n.1459+5_1459+8delGTGAVOUS09/14/2018
66ACADVLEx10NM_000018.3:c.883C>Tp.Pro295Ser | p.P295SVOUS**
67ACADVLEx10NM_000018.3:c.887_888delCTp.Pro296Argfs*17 | p.P296RfsX17NM_000018.2:c.887_888delCT, NM_000018.3:c.887_888delCT, NM_001033859.1:c.821_822delCT, NM_001033859.2:c.821_822delCT, NM_001270447.1:c.956_957delCT, NM_001270448.1:c.659_660delCT, NM_001365.3:c.-3827_-3826delAG, NM_004422.2:c.*3189_*3190delAG, NR_029896.1:n.*621_*622delAG, XM_005256489.1:c.-3827_-3826delAG, XM_005256502.1:c.*3189_*3190delAG, XM_005256503.1:c.*3189_*3190delAG, XM_005256504.1:c.*3189_*3190delAG, XR_243545.1:n.-2834_-2833delAG, XR_243555.1:n.1468_1469delCTPathogenic07/28/2020 
68ACADVLEx10NM_000018.3:c.896_898delAGAp.Lys299del | p.K299delNM_000018.2:c.896_898delAGA, NM_000018.3:c.896_898delAGA, NM_001033859.1:c.830_832delAGA, NM_001033859.2:c.830_832delAGA, NM_001270447.1:c.965_967delAGA, NM_001270448.1:c.668_670delAGA, NM_001365.3:c.-3837_-3835delTCT, NM_004422.2:c.*3179_*3181delTCT, NR_029896.1:n.*611_*613delTCT, XM_005256489.1:c.-3837_-3835delTCT, XM_005256502.1:c.*3179_*3181delTCT, XM_005256503.1:c.*3179_*3181delTCT, XM_005256504.1:c.*3179_*3181delTCT, XR_243545.1:n.-2844_-2842delTCT, XR_243555.1:n.1477_1479delAGAPathogenic05/15/2013 
69ACADVLEx10NM_000018.3:c.950T>Cp.Val317Ala | p.V317AVOUS12/18/2012
70ACADVLEx10NM_000018.3:c.992A>Cp.Lys331Thr | p.K331TNM_000018.2:c.992A>C, NM_000018.3:c.992A>C, NM_001033859.1:c.926A>C, NM_001033859.2:c.926A>C, NM_001270447.1:c.1061A>C, NM_001270448.1:c.764A>C, NM_001365.3:c.-3931T>G, NM_004422.2:c.*3085T>G, NR_029896.1:n.*517T>GVOUS04/14/2014
71ACADVLEx10NM_000018.3:c.995T>Cp.Val332Ala | p.V332ANM_000018.2:c.995T>C, NM_000018.3:c.995T>C, NM_001033859.1:c.929T>C, NM_001033859.2:c.929T>C, NM_001270447.1:c.1064T>C, NM_001270448.1:c.767T>C, NM_001365.3:c.-3934A>G, NM_004422.2:c.*3082A>G, NR_029896.1:n.*514A>GVOUS**
72ACADVLEx10NM_000018.3:c.1001T>Gp.Met334Arg | p.M334RNM_000018.2:c.1001T>G, NM_000018.3:c.1001T>G, NM_001033859.1:c.935T>G, NM_001033859.2:c.935T>G, NM_001270447.1:c.1070T>G, NM_001270448.1:c.773T>G, NM_001365.3:c.-3940A>C, NM_004422.2:c.*3076A>C, NR_029896.1:n.*508A>CVOUS07/02/2015
73ACADVLEx10NM_000018.3:c.1024T>Cp.Phe342Leu | p.F342LNM_000018.2:c.1024T>C, NM_000018.3:c.1024T>C, NM_001033859.1:c.958T>C, NM_001033859.2:c.958T>C, NM_001270447.1:c.1093T>C, NM_001270448.1:c.796T>C, NM_001365.3:c.-3963A>G, NM_004422.2:c.*3053A>G, NR_029896.1:n.*485A>G, XM_005256489.1:c.-3963A>G, XM_005256502.1:c.*3053A>G, XM_005256503.1:c.*3053A>G, XM_005256504.1:c.*3053A>G, XR_243545.1:n.-2970A>G, XR_243555.1:n.1605T>CVOUS11/21/2017
74ACADVLEx10NM_000018.3:c.1038G>Ap.Ala346= | p.A346=NM_000018.2:c.1038G>A, NM_000018.3:c.1038G>A, NM_001033859.1:c.972G>A, NM_001033859.2:c.972G>A, NM_001270447.1:c.1107G>A, NM_001270448.1:c.810G>A, NM_001365.3:c.-3977C>T, NM_004422.2:c.*3039C>T, NR_029896.1:n.*471C>T, XM_005256489.1:c.-3977C>T, XM_005256502.1:c.*3039C>T, XM_005256503.1:c.*3039C>T, XM_005256504.1:c.*3039C>T, XR_243545.1:n.-2984C>T, XR_243555.1:n.1619G>ABenign02/20/2014 
75ACADVLEx10NM_000018.3:c.1048G>Ap.Gly350Ser | p.G350SNM_000018.2:c.1048G>A, NM_000018.3:c.1048G>A, NM_001033859.1:c.982G>A, NM_001033859.2:c.982G>A, NM_001270447.1:c.1117G>A, NM_001270448.1:c.820G>A, NM_001365.3:c.-3987C>T, NM_004422.2:c.*3029C>T, NR_029896.1:n.*461C>T, XM_005256489.1:c.-3987C>T, XM_005256502.1:c.*3029C>T, XM_005256503.1:c.*3029C>T, XM_005256504.1:c.*3029C>T, XR_243545.1:n.-2994C>T, XR_243555.1:n.1629G>AVOUS02/25/2020
76ACADVLEx10NM_000018.3:c.1054A>Gp.Met352Val | p.M352VNM_000018.2:c.1054A>G, NM_000018.3:c.1054A>G, NM_001033859.1:c.988A>G, NM_001033859.2:c.988A>G, NM_001270447.1:c.1123A>G, NM_001270448.1:c.826A>G, NM_001365.3:c.-3993T>C, NM_004422.2:c.*3023T>C, NR_029896.1:n.*455T>C, XM_005256489.1:c.-3993T>C, XM_005256502.1:c.*3023T>C, XM_005256503.1:c.*3023T>C, XM_005256504.1:c.*3023T>C, XR_243545.1:n.-3000T>C, XR_243555.1:n.1635A>GPathogenic** 
77ACADVLEx10NM_000018.3:c.1058G>Tp.Arg353Ile | p.R353IVOUS**
78ACADVLEx10NM_000018.3:c.1065_1067delCATVOUS**
79ACADVLEx10NM_000018.3:c.1066A>Gp.Ile356Val | p.I356VNM_000018.2:c.1066A>G, NM_000018.3:c.1066A>G, NM_001033859.1:c.1000A>G, NM_001033859.2:c.1000A>G, NM_001270447.1:c.1135A>G, NM_001270448.1:c.838A>G, NM_001365.3:c.-4005T>C, NM_004422.2:c.*3011T>C, NR_029896.1:n.*443T>C, XM_005256489.1:c.-4005T>C, XM_005256502.1:c.*3011T>C, XM_005256503.1:c.*3011T>C, XM_005256504.1:c.*3011T>C, XR_243545.1:n.-3012T>C, XR_243555.1:n.1647A>GBenign10/16/2014 
80ACADVLEx10NM_000018.3:c.1076C>Tp.Ala359Val | p.A359VNM_000018.2:c.1076C>T, NM_000018.3:c.1076C>T, NM_001033859.1:c.1010C>T, NM_001033859.2:c.1010C>T, NM_001270447.1:c.1145C>T, NM_001270448.1:c.848C>T, NM_001365.3:c.-4015G>A, NM_004422.2:c.*3001G>A, NR_029896.1:n.*433G>A, XM_005256489.1:c.-4015G>A, XM_005256502.1:c.*3001G>A, XM_005256503.1:c.*3001G>A, XM_005256504.1:c.*3001G>A, XR_243545.1:n.-3022G>A, XR_243555.1:n.1657C>TVOUS02/20/2020
81ACADVLEx10NM_000018.3:c.1077_1077+1delGGinsCACPathogenic10/15/2015 
82ACADVLEx11NM_000018.3:c.1096C>Tp.Arg366Cys | p.R366CNM_000018.2:c.1096C>T, NM_000018.3:c.1096C>T, NM_001033859.1:c.1030C>T, NM_001033859.2:c.1030C>T, NM_001270447.1:c.1165C>T, NM_001270448.1:c.868C>T, NM_001365.3:c.-4302G>A, NM_004422.2:c.*2714G>A, NR_029896.1:n.*146G>A, XM_005256489.1:c.-4302G>A, XM_005256502.1:c.*2714G>A, XM_005256503.1:c.*2714G>A, XM_005256504.1:c.*2714G>A, XR_243545.1:n.-3309G>A, XR_243555.1:n.1677C>TPathogenic07/24/2020 
83ACADVLEx11NM_000018.3:c.1096C>Gp.Arg366Gly | p.R366GNM_000018.2:c.1096C>G, NM_000018.3:c.1096C>G, NM_001033859.1:c.1030C>G, NM_001033859.2:c.1030C>G, NM_001270447.1:c.1165C>G, NM_001270448.1:c.868C>G, NM_001365.3:c.-4302G>C, NM_004422.2:c.*2714G>C, NR_029896.1:n.*146G>C, XM_005256489.1:c.-4302G>C, XM_005256502.1:c.*2714G>C, XM_005256503.1:c.*2714G>C, XM_005256504.1:c.*2714G>C, XR_243545.1:n.-3309G>C, XR_243555.1:n.1677C>GVOUS**
84ACADVLEx11NM_000018.3:c.1097G>Ap.Arg366His | p.R366HNM_000018.2:c.1097G>A, NM_000018.3:c.1097G>A, NM_001033859.1:c.1031G>A, NM_001033859.2:c.1031G>A, NM_001270447.1:c.1166G>A, NM_001270448.1:c.869G>A, NM_001365.3:c.-4303C>T, NM_004422.2:c.*2713C>T, NR_029896.1:n.*145C>T, XM_005256489.1:c.-4303C>T, XM_005256502.1:c.*2713C>T, XM_005256503.1:c.*2713C>T, XM_005256504.1:c.*2713C>T, XR_243545.1:n.-3310C>T, XR_243555.1:n.1678G>APathogenic04/25/2018 
85ACADVLEx11NM_000018.3:c.1103A>Cp.Gln368Pro | p.Q368PNM_000018.2:c.1103A>C, NM_000018.3:c.1103A>C, NM_001033859.1:c.1037A>C, NM_001033859.2:c.1037A>C, NM_001270447.1:c.1172A>C, NM_001270448.1:c.875A>C, NM_001365.3:c.-4309T>G, NM_004422.2:c.*2707T>G, NR_029896.1:n.*139T>G, XM_005256489.1:c.-4309T>G, XM_005256502.1:c.*2707T>G, XM_005256503.1:c.*2707T>G, XM_005256504.1:c.*2707T>G, XR_243545.1:n.-3316T>G, XR_243555.1:n.1684A>CVOUS11/10/2016
86ACADVLEx11NM_000018.3:c.1106T>Cp.Phe369Ser | p.F369SLikely pathogenic10/05/2012 
87ACADVLEx11NM_000018.3:c.1141_1143delGAGNM_000018.2:c.1141_1143delGAG, NM_000018.3:c.1141_1143delGAG, NM_001033859.1:c.1075_1077delGAG, NM_001033859.2:c.1075_1077delGAG, NM_001270447.1:c.1210_1212delGAG, NM_001270448.1:c.913_915delGAG, NM_001365.3:c.-4349_-4347delCTC, NM_004422.2:c.*2667_*2669delCTC, NR_029896.1:n.*99_*101delCTC, XM_005256489.1:c.-4349_-4347delCTC, XM_005256502.1:c.*2667_*2669delCTC, XM_005256503.1:c.*2667_*2669delCTC, XM_005256504.1:c.*2667_*2669delCTC, XR_243545.1:n.-3356_-3354delCTC, XR_243555.1:n.1722_1724delGAGPathogenic** 
88ACADVLEx11NM_000018.3:c.1153C>Tp.Arg385Trp | p.R385WNM_000018.2:c.1153C>T, NM_000018.3:c.1153C>T, NM_001033859.1:c.1087C>T, NM_001033859.2:c.1087C>T, NM_001270447.1:c.1222C>T, NM_001270448.1:c.925C>T, NM_001365.3:c.-4359G>A, NM_004422.2:c.*2657G>A, NR_029896.1:n.*89G>A, XM_005256489.1:c.-4359G>A, XM_005256502.1:c.*2657G>A, XM_005256503.1:c.*2657G>A, XM_005256504.1:c.*2657G>A, XR_243545.1:n.-3366G>A, XR_243555.1:n.1734C>TVOUS04/23/2015
89ACADVLEx11NM_000018.3:c.1182+1G>ANM_000018.2:c.1182+1G>A, NM_000018.3:c.1182+1G>A, NM_001033859.1:c.1116+1G>A, NM_001033859.2:c.1116+1G>A, NM_001270447.1:c.1251+1G>A, NM_001270448.1:c.954+1G>A, NM_001365.3:c.-4389C>T, NM_004422.2:c.*2627C>T, NR_029896.1:n.*59C>T, XM_005256489.1:c.-4389C>TPathogenic01/11/2018 
90ACADVLEx12NM_000018.3:c.1183-15A>GVOUS01/06/2020
91ACADVLEx12NM_000018.3:c.1202_1229delGTGCTAACATGGACCAGGGAGCCACGGAp.Ser401Thrfs*4 | p.S401TfsX4NM_000018.2:c.1202_1229delGTGCTAACAT, NM_000018.2:c.1202_1229delGTGCTAACATGGACCAGGGAGCCACGGA, NM_000018.3:c.1202_1229delGTGCTAACAT, NM_000018.3:c.1202_1229delGTGCTAACATGGACCAGGGAGCCACGGA, NM_001033859.1:c.1136_1163delGTGCTAACAT, NM_001033859.1:c.1136_1163delGTGCTAACATGGACCAGGGAGCCACGGA, NM_001033859.2:c.1136_1163delGTGCTAACAT, NM_001033859.2:c.1136_1163delGTGCTAACATGGACCAGGGAGCCACGGA, NM_001270447.1:c.1271_1298delGTGCTAACAT, NM_001270447.1:c.1271_1298delGTGCTAACATGGACCAGGGAGCCACGGA, NM_001270448.1:c.974_1001delGTGCTAACAT, NM_001270448.1:c.974_1001delGTGCTAACATGGACCAGGGAGCCACGGA, NM_001365.3:c.-4841_-4814delATGTTAGCAC, NM_001365.3:c.-4841_-4814delTCCGTGGCTCCCTGGTCCATGTTAGCAC, NM_004422.2:c.*2175_*2202delATGTTAGCAC, NM_004422.2:c.*2175_*2202delTCCGTGGCTCCCTGGTCCATGTTAGCAC, NR_029896.1:n.-311_-284delATGTTAGCAC, NR_029896.1:n.-311_-284delTCCGTGGCTCCCTGGTCCATGTTAGCAC, XM_005256489.1:c.-4841_-4814delATGTTAGCAC, XM_005256489.1:c.-4841_-4814delTCCGTGGCTCCCTGGTCCATGTTAGCAC, XM_005256502.1:c.*Pathogenic05/21/2020 
92ACADVLEx12NM_000018.3:c.1205C>Tp.Ala402Val | p.A402VNM_000018.2:c.1205C>T, NM_000018.3:c.1205C>T, NM_001033859.1:c.1139C>T, NM_001033859.2:c.1139C>T, NM_001270447.1:c.1274C>T, NM_001270448.1:c.977C>T, NM_001365.3:c.-4817G>A, NM_004422.2:c.*2199G>A, NR_029896.1:n.-287G>AVOUS04/08/2014
93ACADVLEx12NM_000018.3:c.1226C>Tp.Thr409Met | p.T409MVOUS**
94ACADVLEx12NM_000018.3:c.1269G>Tp.Ser423= | p.S423=NM_000018.2:c.1269G>T, NM_000018.3:c.1269G>T, NM_001033859.1:c.1203G>T, NM_001033859.2:c.1203G>T, NM_001270447.1:c.1338G>T, NM_001270448.1:c.1041G>T, NM_001365.3:c.-4881C>A, NM_004422.2:c.*2135C>A, NR_029896.1:n.-351C>A, XM_005256489.1:c.-4881C>A, XM_005256502.1:c.*2135C>A, XM_005256503.1:c.*2135C>A, XM_005256504.1:c.*2135C>A, XR_243545.1:n.-3888C>A, XR_243555.1:n.1850G>TVOUS07/21/2019
95ACADVLEx13NM_000018.3:c.1273G>Ap.Ala425Thr | p.A425TNM_000018.2:c.1273G>A, NM_000018.3:c.1273G>A, NM_001033859.1:c.1207G>A, NM_001033859.2:c.1207G>A, NM_001270447.1:c.1342G>A, NM_001270448.1:c.1045G>A, NM_001365.3:c.-4967C>T, NM_004422.2:c.*2049C>T, NR_029896.1:n.-437C>T, XM_005256489.1:c.-4967C>T, XM_005256502.1:c.*2049C>T, XM_005256503.1:c.*2049C>T, XM_005256504.1:c.*2049C>T, XR_243545.1:n.-3974C>T, XR_243555.1:n.1854G>ALikely pathogenic08/24/2018 
96ACADVLEx13NM_000018.3:c.1291G>Ap.Asp431Asn | p.D431NVOUS**
97ACADVLEx13NM_000018.3:c.1316G>Ap.Gly439Asp | p.G439DNM_000018.2:c.1316G>A, NM_000018.3:c.1316G>A, NM_001033859.1:c.1250G>A, NM_001033859.2:c.1250G>A, NM_001270447.1:c.1385G>A, NM_001270448.1:c.1088G>A, NM_001365.3:c.-5010C>T, NM_004422.2:c.*2006C>T, NR_029896.1:n.-480C>T, XM_005256489.1:c.-5010C>T, XM_005256502.1:c.*2006C>T, XM_005256503.1:c.*2006C>T, XM_005256504.1:c.*2006C>T, XR_243545.1:n.-4017C>T, XR_243555.1:n.1897G>ALikely pathogenic09/15/2020 
98ACADVLEx13NM_000018.3:c.1317dupTp.Met440Tyrfs*23 | p.M440YfsX23NM_000018.2:c.1317dupT, NM_000018.3:c.1317dupT, NM_001033859.1:c.1251dupT, NM_001033859.2:c.1251dupT, NM_001270447.1:c.1386dupT, NM_001270448.1:c.1089dupT, NM_001365.3:c.-5011dupA, NM_004422.2:c.*2005dupA, NR_029896.1:n.-481dupA, XM_005256489.1:c.-5011dupA, XM_005256502.1:c.*2005dupA, XM_005256503.1:c.*2005dupA, XM_005256504.1:c.*2005dupA, XR_243545.1:n.-4018dupA, XR_243555.1:n.1898dupTPathogenic01/11/2018 
99ACADVLEx13NM_000018.3:c.1322G>Ap.Gly441Asp | p.G441DNM_000018.2:c.1322G>A, NM_000018.3:c.1322G>A, NM_001033859.1:c.1256G>A, NM_001033859.2:c.1256G>A, NM_001270447.1:c.1391G>A, NM_001270448.1:c.1094G>A, NM_001365.3:c.-5016C>T, NM_004422.2:c.*2000C>T, NR_029896.1:n.-486C>T, XM_005256489.1:c.-5016C>TPathogenic05/03/2013 
100ACADVLEx13NM_000018.3:c.1328T>Gp.Met443Arg | p.M443RNM_000018.2:c.1328T>G, NM_000018.3:c.1328T>G, NM_001033859.1:c.1262T>G, NM_001033859.2:c.1262T>G, NM_001270447.1:c.1397T>G, NM_001270448.1:c.1100T>G, NM_001365.3:c.-5022A>C, NM_004422.2:c.*1994A>C, NR_029896.1:n.-492A>C, XM_005256489.1:c.-5022A>C, XM_005256502.1:c.*1994A>C, XM_005256503.1:c.*1994A>C, XM_005256504.1:c.*1994A>C, XR_243545.1:n.-4029A>C, XR_243555.1:n.1909T>GVOUS01/19/2016
101ACADVLEx14NM_000018.3:c.1345G>Cp.Glu449Gln | p.E449QVOUS03/05/2013
102ACADVLEx14NM_000018.3:c.1349G>Ap.Arg450His | p.R450HNM_000018.2:c.1349G>A, NM_000018.3:c.1349G>A, NM_001033859.1:c.1283G>A, NM_001033859.2:c.1283G>A, NM_001270447.1:c.1418G>A, NM_001270448.1:c.1121G>A, NM_001365.3:c.-5135C>T, NM_004422.2:c.*1881C>T, NR_029896.1:n.-605C>T, XM_005256489.1:c.-5135C>T, XM_005256502.1:c.*1881C>T, XM_005256503.1:c.*1881C>T, XM_005256504.1:c.*1881C>T, XR_243545.1:n.-4142C>T, XR_243555.1:n.1930G>ALikely pathogenic01/27/2015 
103ACADVLEx14NM_000018.3:c.1357C>Tp.Arg453* | p.R453XNM_000018.2:c.1357C>T, NM_000018.3:c.1357C>T, NM_001033859.1:c.1291C>T, NM_001033859.2:c.1291C>T, NM_001270447.1:c.1426C>T, NM_001270448.1:c.1129C>T, NM_001365.3:c.-5143G>A, NM_004422.2:c.*1873G>A, NR_029896.1:n.-613G>A, XM_005256489.1:c.-5143G>A, XM_005256502.1:c.*1873G>A, XM_005256503.1:c.*1873G>A, XM_005256504.1:c.*1873G>A, XR_243545.1:n.-4150G>A, XR_243555.1:n.1938C>TPathogenic12/15/2014 
104ACADVLEx14NM_000018.3:c.1360G>Cp.Asp454His | p.D454HVOUS**
105ACADVLEx14NM_000018.3:c.1360G>Ap.Asp454Asn | p.D454NPathogenic** 
106ACADVLEx14NM_000018.3:c.1366C>Tp.Arg456Cys | p.R456CNM_000018.2:c.1366C>T, NM_000018.3:c.1366C>T, NM_001033859.1:c.1300C>T, NM_001033859.2:c.1300C>T, NM_001270447.1:c.1435C>T, NM_001270448.1:c.1138C>T, NM_001365.3:c.-5152G>A, NM_004422.2:c.*1864G>A, NR_029896.1:n.-622G>A, XM_005256489.1:c.-5152G>A, XM_005256502.1:c.*1864G>A, XM_005256503.1:c.*1864G>A, XM_005256504.1:c.*1864G>A, XR_243545.1:n.-4159G>A, XR_243555.1:n.1947C>TVOUS08/20/2014
107ACADVLEx14NM_000018.3:c.1367G>Ap.Arg456His | p.R456HNM_000018.2:c.1367G>A, NM_000018.3:c.1367G>A, NM_001033859.1:c.1301G>A, NM_001033859.2:c.1301G>A, NM_001270447.1:c.1436G>A, NM_001270448.1:c.1139G>A, NM_001365.3:c.-5153C>T, NM_004422.2:c.*1863C>T, NR_029896.1:n.-623C>T, XM_005256489.1:c.-5153C>T, XM_005256502.1:c.*1863C>T, XM_005256503.1:c.*1863C>T, XM_005256504.1:c.*1863C>T, XR_243545.1:n.-4160C>T, XR_243555.1:n.1948G>APathogenic08/15/2019 
108ACADVLEx14NM_000018.3:c.1375dupCp.Arg459Profs*4 | p.R459PfsX4** ERROR **, NM_000018.2:c.1375dupC, NM_000018.3:c.1375dupC, NM_001033859.1:c.1309dupC, NM_001033859.2:c.1309dupC, NM_001270447.1:c.1444dupC, NM_001270448.1:c.1147dupC, NM_001365.3:c.-5161dupG, NM_004422.2:c.*1855dupG, NR_029896.1:n.-631dupG, XM_005256489.1:c.-5161dupG, XM_005256502.1:c.*1855dupG, XM_005256503.1:c.*1855dupG, XM_005256504.1:c.*1855dupG, XR_243545.1:n.-4168dupG, XR_243555.1:n.1956dupCPathogenic08/20/2019 
109ACADVLEx14NM_000018.3:c.1388G>Ap.Gly463Glu | p.G463ENM_000018.2:c.1388G>A, NM_000018.3:c.1388G>A, NM_001033859.1:c.1322G>A, NM_001033859.2:c.1322G>A, NM_001270447.1:c.1457G>A, NM_001270448.1:c.1160G>A, NM_001365.3:c.-5174C>T, NM_004422.2:c.*1842C>T, NR_029896.1:n.-644C>T, XM_005256489.1:c.-5174C>T, XM_005256502.1:c.*1842C>T, XM_005256503.1:c.*1842C>T, XM_005256504.1:c.*1842C>T, XR_243545.1:n.-4181C>T, XR_243555.1:n.1969G>AVOUS08/26/2020
110ACADVLEx14NM_000018.3:c.1389dupGPathogenic10/05/2012 
111ACADVLEx14NM_000018.3:c.1406G>Ap.Arg469Gln | p.R469QPathogenic08/06/2012 
112ACADVLEx14NM_000018.3:c.1414G>Ap.Val472Met | p.V472MNM_000018.2:c.1414G>A, NM_000018.3:c.1414G>A, NM_001033859.1:c.1348G>A, NM_001033859.2:c.1348G>A, NM_001270447.1:c.1483G>A, NM_001270448.1:c.1186G>A, NM_001365.3:c.-5200C>T, NM_004422.2:c.*1816C>T, NR_029896.1:n.-670C>T, XM_005256489.1:c.-5200C>T, XM_005256502.1:c.*1816C>T, XM_005256503.1:c.*1816C>T, XM_005256504.1:c.*1816C>T, XR_243545.1:n.-4207C>T, XR_243555.1:n.1995G>AVOUS**
113ACADVLEx14NM_000018.3:c.1434+14T>ANM_000018.2:c.1434+14T>A, NM_000018.3:c.1434+14T>A, NM_001033859.1:c.1368+14T>A, NM_001033859.2:c.1368+14T>A, NM_001270447.1:c.1503+14T>A, NM_001270448.1:c.1206+14T>A, NM_001365.3:c.-5234A>T, NM_004422.2:c.*1782A>T, NR_029896.1:n.-704A>T, XM_005256489.1:c.-5234A>T, XM_005256502.1:c.*1782A>T, XM_005256503.1:c.*1782A>T, XM_005256504.1:c.*1782A>T, XR_243545.1:n.-4241A>T, XR_243555.1:n.2015+14T>AVOUS05/20/2019
114ACADVLEx15NM_000018.3:c.1468G>Cp.Ala490Pro | p.A490PNM_000018.2:c.1468G>C, NM_000018.3:c.1468G>C, NM_001033859.1:c.1402G>C, NM_001033859.2:c.1402G>C, NM_001270447.1:c.1537G>C, NM_001270448.1:c.1240G>C, NM_001365.3:c.-5330C>G, NM_004422.2:c.*1686C>G, NR_029896.1:n.-800C>G, XM_005256489.1:c.-5330C>G, XM_005256502.1:c.*1686C>G, XM_005256503.1:c.*1686C>G, XM_005256504.1:c.*1686C>G, XR_243545.1:n.-4337C>G, XR_243555.1:n.2049G>CPathogenic** 
115ACADVLEx15NM_000018.3:c.1504C>Gp.Leu502Val | p.L502VNM_000018.2:c.1504C>G, NM_000018.3:c.1504C>G, NM_001033859.1:c.1438C>G, NM_001033859.2:c.1438C>G, NM_001270447.1:c.1573C>G, NM_001270448.1:c.1276C>G, NM_001365.3:c.-5366G>C, NM_004422.2:c.*1650G>C, NR_029896.1:n.-836G>C, XM_005256489.1:c.-5366G>C, XM_005256502.1:c.*1650G>C, XM_005256503.1:c.*1650G>C, XM_005256504.1:c.*1650G>C, XR_243545.1:n.-4373G>C, XR_243555.1:n.2085C>GLikely pathogenic07/06/2015 
116ACADVLEx15NM_000018.3:c.1532G>Ap.Arg511Gln | p.R511QNM_000018.2:c.1532G>A, NM_000018.3:c.1532G>A, NM_001033859.1:c.1466G>A, NM_001033859.2:c.1466G>A, NM_001270447.1:c.1601G>A, NM_001270448.1:c.1304G>A, NM_001365.3:c.-5394C>T, NM_004422.2:c.*1622C>T, NR_029896.1:n.-864C>T, XM_005256489.1:c.-5394C>T, XM_005256502.1:c.*1622C>T, XM_005256503.1:c.*1622C>T, XM_005256504.1:c.*1622C>T, XR_243545.1:n.-4401C>T, XR_243555.1:n.2113G>AVOUS12/05/2016
117ACADVLEx15NM_000018.3:c.1532+1G>ANM_000018.2:c.1532+1G>A, NM_000018.3:c.1532+1G>A, NM_001033859.1:c.1466+1G>A, NM_001033859.2:c.1466+1G>A, NM_001270447.1:c.1601+1G>A, NM_001270448.1:c.1304+1G>A, NM_001365.3:c.-5395C>T, NM_004422.2:c.*1621C>T, NR_029896.1:n.-865C>T, XM_005256489.1:c.-5395C>TPathogenic04/14/2014 
118ACADVLEx16NM_000018.3:c.1567G>Ap.Gly523Arg | p.G523RNM_000018.2:c.1567G>A, NM_000018.3:c.1567G>A, NM_001033859.1:c.1501G>A, NM_001033859.2:c.1501G>A, NM_001270447.1:c.1636G>A, NM_001270448.1:c.1339G>A, NM_001365.3:c.-5506C>T, NM_004422.2:c.*1510C>T, NR_029896.1:n.-976C>T, XM_005256489.1:c.-5506C>T, XM_005256502.1:c.*1510C>T, XM_005256503.1:c.*1510C>T, XM_005256504.1:c.*1510C>T, XR_243545.1:n.-4513C>T, XR_243555.1:n.2148G>AVOUS08/25/2015
119ACADVLEx16NM_000018.3:c.1591C>Tp.Arg531Trp | p.R531WNM_000018.2:c.1591C>T, NM_000018.3:c.1591C>T, NM_001033859.1:c.1525C>T, NM_001033859.2:c.1525C>T, NM_001270447.1:c.1660C>T, NM_001270448.1:c.1363C>T, NM_001365.3:c.-5530G>A, NM_004422.2:c.*1486G>A, NR_029896.1:n.-1000G>A, p.R491WVOUS11/25/2013
120ACADVLEx16NM_000018.3:c.1600G>Ap.Glu534Lys | p.E534KNM_000018.2:c.1600G>A, NM_000018.3:c.1600G>A, NM_001033859.1:c.1534G>A, NM_001033859.2:c.1534G>A, NM_001270447.1:c.1669G>A, NM_001270448.1:c.1372G>A, NM_001365.3:c.-5539C>T, NM_004422.2:c.*1477C>T, NR_029896.1:n.-1009C>T, XM_005256489.1:c.-5539C>TBenign02/26/2013 
121ACADVLEx16NM_000018.3:c.1605+6T>CNM_000018.2:c.1605+6T>C, NM_000018.3:c.1605+6T>C, NM_001033859.1:c.1539+6T>C, NM_001033859.2:c.1539+6T>C, NM_001270447.1:c.1674+6T>C, NM_001270448.1:c.1377+6T>C, NM_001365.3:c.-5550A>G, NM_004422.2:c.*1466A>G, NR_029896.1:n.-1020A>G, XM_005256489.1:c.-5550A>GBenign01/06/2020 
122ACADVLEx18NM_000018.3:c.1679-6G>ANM_000018.2:c.1679-6G>A, NM_000018.3:c.1679-6G>A, NM_001033859.1:c.1613-6G>A, NM_001033859.2:c.1613-6G>A, NM_001270447.1:c.1748-6G>A, NM_001270448.1:c.1451-6G>A, NM_001365.3:c.-5787C>T, NM_004422.2:c.*1229C>T, NR_029896.1:n.-1257C>T, XM_005256489.1:c.-5787C>T, XM_005256502.1:c.*1229C>T, XM_005256503.1:c.*1229C>T, XM_005256504.1:c.*1229C>T, XR_243545.1:n.-4794C>T, XR_243555.1:n.2256-6G>APathogenic07/11/2019 
123ACADVLEx18NM_000018.3:c.1684C>Gp.Gln562Glu | p.Q562ENM_000018.2:c.1684C>G, NM_000018.3:c.1684C>G, NM_001033859.1:c.1618C>G, NM_001033859.2:c.1618C>G, NM_001270447.1:c.1753C>G, NM_001270448.1:c.1456C>G, NM_001365.3:c.-5798G>C, NM_004422.2:c.*1218G>C, NR_029896.1:n.-1268G>C, XM_005256489.1:c.-5798G>C, XM_005256502.1:c.*1218G>C, XM_005256503.1:c.*1218G>C, XM_005256504.1:c.*1218G>C, XR_243545.1:n.-4805G>C, XR_243555.1:n.2261C>GVOUS03/14/2019
124ACADVLEx18NM_000018.3:c.1700G>Ap.Arg567Gln | p.R567QNM_000018.2:c.1700G>A, NM_000018.3:c.1700G>A, NM_001033859.1:c.1634G>A, NM_001033859.2:c.1634G>A, NM_001270447.1:c.1769G>A, NM_001270448.1:c.1472G>A, NM_001365.3:c.-5814C>T, NM_004422.2:c.*1202C>T, NR_029896.1:n.-1284C>T, XM_005256489.1:c.-5814C>T, XM_005256502.1:c.*1202C>T, XM_005256503.1:c.*1202C>T, XM_005256504.1:c.*1202C>T, XR_243545.1:n.-4821C>T, XR_243555.1:n.2277G>AVOUS10/03/2019
125ACADVLEx18NM_000018.3:c.1711G>Ap.Gly571Arg | p.G571RNM_000018.2:c.1711G>A, NM_000018.3:c.1711G>A, NM_001033859.1:c.1645G>A, NM_001033859.2:c.1645G>A, NM_001270447.1:c.1780G>A, NM_001270448.1:c.1483G>A, NM_001365.3:c.-5825C>T, NM_004422.2:c.*1191C>T, NR_029896.1:n.-1295C>TVOUS05/24/2013
126ACADVLEx18NM_000018.3:c.1733T>Cp.Met578Thr | p.M578TVOUS03/05/2013
127ACADVLEx18NM_000018.3:c.1747T>Cp.Ser583Pro | p.S583PVOUS**
128ACADVLEx19NM_000018.3:c.1754C>Tp.Ala585Val | p.A585VNM_000018.2:c.1754C>T, NM_000018.3:c.1754C>T, NM_001033859.1:c.1688C>T, NM_001033859.2:c.1688C>T, NM_001270447.1:c.1823C>T, NM_001270448.1:c.1526C>T, NM_001365.3:c.-5962G>A, NM_004422.2:c.*1054G>A, NR_029896.1:n.-1432G>A, XM_005256489.1:c.-5962G>A, XM_005256502.1:c.*1054G>A, XM_005256503.1:c.*1054G>A, XM_005256504.1:c.*1054G>A, XR_243545.1:n.-4969G>A, XR_243555.1:n.2331C>TVOUS04/22/2016
129ACADVLEx19NM_000018.3:c.1820G>Ap.Cys607Tyr | p.C607YVOUS**
130ACADVLEx19NM_000018.3:c.1825G>Ap.Glu609Lys | p.E609KNM_000018.2:c.1825G>A, NM_000018.3:c.1825G>A, NM_001033859.1:c.1759G>A, NM_001033859.2:c.1759G>A, NM_001270447.1:c.1894G>A, NM_001270448.1:c.1597G>A, NM_001365.3:c.-6033C>T, NM_004422.2:c.*983C>T, NR_029896.1:n.-1503C>T, XM_005256502.1:c.*983C>T, XM_005256503.1:c.*983C>T, XM_005256504.1:c.*983C>T, XR_243555.1:n.2402G>AVOUS03/23/2015
131ACADVLEx20NM_000018.3:c.*8delCNM_000018.2:c.*8delC, NM_000018.3:c.*8delC, NM_001033859.1:c.*8delC, NM_001033859.2:c.*8delC, NM_001270447.1:c.*8delC, NM_001270448.1:c.*8delC, NM_004422.2:c.*760delG, NR_029896.1:n.-1726delGVOUS06/18/2013
132ACADVLEx20NM_000018.3:c.1837C>Tp.Arg613Trp | p.R613WPathogenic** 
133ACADVLEx20NM_000018.3:c.1839G>Ap.Arg613= | p.R613=NM_000018.2:c.1839G>A, NM_000018.3:c.1839G>A, NM_001033859.1:c.1773G>A, NM_001033859.2:c.1773G>A, NM_001270447.1:c.1908G>A, NM_001270448.1:c.1611G>A, NM_001365.3:c.-6119C>T, NM_004422.2:c.*897C>T, NR_029896.1:n.-1589C>T, XM_005256502.1:c.*897C>T, XM_005256503.1:c.*897C>T, XM_005256504.1:c.*897C>T, XR_243555.1:n.2416G>ALikely benign08/25/2020 
134ACADVLEx20NM_000018.3:c.1843C>Tp.Arg615* | p.R615XPathogenic** 
135ACADVLEx20NM_000018.3:c.1844G>Ap.Arg615Gln | p.R615QNM_000018.2:c.1844G>A, NM_000018.3:c.1844G>A, NM_001033859.1:c.1778G>A, NM_001033859.2:c.1778G>A, NM_001270447.1:c.1913G>A, NM_001270448.1:c.1616G>A, NM_001365.3:c.-6124C>T, NM_004422.2:c.*892C>T, NR_029896.1:n.-1594C>T, XM_005256502.1:c.*892C>T, XM_005256503.1:c.*892C>T, XM_005256504.1:c.*892C>T, XR_243555.1:n.2421G>AVOUS02/05/2019
136ACADVLEx20NM_000018.3:c.1882delCNM_000018.2:c.1882delC, NM_000018.3:c.1882delC, NM_001033859.1:c.1816delC, NM_001033859.2:c.1816delC, NM_001270447.1:c.1951delC, NM_001270448.1:c.1654delC, NM_001365.3:c.-6162delG, NM_004422.2:c.*854delG, NR_029896.1:n.-1632delG, XM_005256502.1:c.*854delG, XM_005256503.1:c.*854delG, XM_005256504.1:c.*854delG, XR_243555.1:n.2459delCPathogenic** 
137ACADVLEx20NM_000018.3:c.1913C>Tp.Ser638Phe | p.S638FNM_000018.2:c.1913C>T, NM_000018.3:c.1913C>T, NM_001033859.1:c.1847C>T, NM_001033859.2:c.1847C>T, NM_001270447.1:c.1982C>T, NM_001270448.1:c.1685C>T, NM_001365.3:c.-6193G>A, NM_004422.2:c.*823G>A, NR_029896.1:n.-1663G>A, XM_005256502.1:c.*823G>A, XM_005256503.1:c.*823G>A, XM_005256504.1:c.*823G>A, XR_243555.1:n.2490C>TVOUS06/21/2019

* Review is pending
** Variant has not been reviewed since the launch of this product (6/15/2012)

URL Parameter Syntax

EmVClass may be automatically searched using the argument [approved_symbol] such as in the example link for the gene CFTR: https://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CFTR

Download

EmVClass data for all genes and variants that have been seen and analyzed by NTD Genetics may be downloaded as a CSV plain text file which is designated to be updated quarterly. Data is subject to change and format is subject to modification.

EmVClass.2021-Q4.csv

Disclaimer

The interpretation of nucleotide changes is based on our current understanding of the variant at the time it was observed in a clinical case. Interpretations may not be current. Some data may not be represented. These interpretations may change over time as more information about the genes becomes available. The data presented here are not intended for clinical use outside of the context of an official NTD Genetics clinical report and should be approached with caution. Only variants identified at NTD Genetics are listed in the EmVClass. If you intend to use NTD Genetics' classification for publication purposes please contact the laboratory for permission.